ETM Experimental and Therapeutic Medicine 1792-0981 1792-1015 D.A. Spandidos 10.3892/etm.2018.5800 ETM-0-0-5800 Articles ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population WangXianhua 1 MaAiguo 1 HanXiuxia 1 LitifuAishan 2 XueFeng 3 The School of Public Health, Qingdao University Medical College, Qingdao, Shandong 266021, P.R. China Department of Respiratory Medicine, Xinjiang Uygur Autonomous Region Chest Hospital, Urumqi, Xinjiang, 830049, P.R. China Department of Tuberculosis, Xinjiang Uygur Autonomous Region Center for Disease Control and Prevention, Xinjiang Uygur Autonomous Region, Urumqi, Xinjiang 830001, P.R. China Correspondence to: Dr Aiguo Ma or Dr Xiuxia Han, The School of Public Health, Qingdao University Medical College, 38 Dengzhou Road, Qingdao, Shandong 266021, P.R. China, E-mail: aiguomamed@163.com, E-mail: xiuxiahanmed@163.com 04 2018 25 01 2018 15 4 3392 3398 22082017 10012018 Copyright: © Wang et al. 2018 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Seven single-nucleotide polymorphism (SNP) sites located in ASAP1 gene have been found associated with tuberculosis (TB) susceptibility by genome-wide association studies in Russia. The case-control study was carried out to test whether these seven SNPs were associated with susceptibility to TB in a Chinese Xinjiang Muslim population. The seven SNPs were genotyped in a case-control design that included 780 Xinjiang Muslim subjects (400 TB patients and 380 controls). Multiplex PCR and direct sequencing were used to detect ASAP1 gene polymorphisms. Hardy-Weinberg equilibrium test was performed to test whether the sample was from genetic equilibrium population. The associations of SNPs with TB risk were determined by the distributions of allelic frequencies and different genetic models. Significant differences of the allelic distribution of rs4733781 and rs1017281 in ASAP1 gene were observed between control group and TB group. A allele of rs4733781 was associated with TB risk (TB vs. control, OR=1.242; 95% CI: 1.004–1.537, P=0.046); While in rs1017281 site, G allele was associated with increased risk for TB (TB vs. control, OR: 0.792, 95% CI: 0.643–0.976, P=0.028). The recessive model of rs4733781 (CC vs. AC+AA) in Xinjiang Muslim populations was associated with a lower TB risk [P=0.003, OR=0.51 (0.324–0.802)], while the recessive model of rs1017281 (GG vs. AG+AA) was associated with a higher TB risk [P=0.011, OR=1.792 (1.135–2.828)]. Using case-control analysis, we identified that two genetic polymorphism sites in the ASAP1 relate to host susceptibility of TB in a Chinese Xinjiang Muslim population.

 ASAP1 tuberculosis single-nucleotide polymorphism Xinjiang Muslim population Introduction

Tuberculosis (TB) is one of the public health emergencies all over the world and severely affects human health. TB is especially epidemic in China, which accounted for 12% of the global total cases in 2012 (1). According to 2010 National Technical Steering Group of the Epidemiological Sampling Survey for TB, the weighted prevalence of active, smear-positive, bacteriological positive pulmonary TB were 459/100,000, 66/100,000, 119/100,000, respectively (2). The geographical distribution of TB prevalence presented that it was relatively low in the eastern parts and high in the western parts, and the prevalence rates of active pulmonary TB, Mycobacterium-positive pulmonary TB and smear-positive pulmonary TB in Xinjiang Uygur autonomous region were all higher than that in other provinces (3,4), which demonstrated that Xinjiang bore a heavy burden of TB.

TB is caused by Mycobacterium tuberculosis (MTB), which has infected around a third of the world population (5), but only 10% of those infected progress to active disease in their lifetime, and up to 90% of infected people are asymptomatic with a latent infection (6). Susceptibility to TB varies between different people. Since 1890s, how genetic factors affect clinical outcomes with MTB infection was illustrated by a series of research. For example, several twin studies have found that concordance of TB was higher in monozygotic twins compared to dizygotic twins (7–9). Beyond that, adoption research, Genome-wide association studies, and case-control analysis have been performed to demonstrate that the associations between individual genetics and susceptibility to TB (10–12). These indicated that host genetic factors are important determinants of TB susceptibility.

The ASAP1 gene (known as AMAP1 or DDEF1), located at 8q24.1–8q24.2, encodes an Arf GTPase-activating protein (Arf GAP), which is a multifunctional scaffold protein that induces hydrolysis of GTP bound to the ADP ribosylation factor family GTP-binding (Arf) proteins (13–15). ASAP1 has been implicated in regulating cell motility and invasion (16,17). It was found to functionally link with the progression and metastasis of tumor cells, including ovary cancer (18), prostate cancer (19), and breast cancer (20,21). Curtis et al (14) found that the expression of ASAP1 gene in MTB-infected dendritic cells was dramatically reduced, which may impair DC migration, suggesting a potential mechanism that predisposes to TB.

Genome-wide association study is an effective way (9) to screen for the genes exerting the best population-wide impact on susceptibility to a multifactorial disease (22). By using this method, Curtis et al identified a novel ASAP1 gene which was associated with susceptibility to TB (14). Eleven single-nucleotide polymorphisms (SNP)s were identified with significant association with susceptibility to MTB (P<5×10−8). Seven out of the most significantly associated ASAP1 SNPs were individually genotyped to replicate their discovery, the most significant association was at rs4733781 (P=2.6×10−11). Then the associations between ASAP1 SNPs and susceptibility to MTB were studied in Chinese population, but not in Xinjiang minorities (23,24). As far as we know, it is the first study which explored association between ASAP1 SNPs and susceptibility to MTB in Xinjiang Muslim populations.

Owing to population heterogeneity, different races have different causative polymorphisms (25). In this study, we selected a set of SNPs within the entire ASAP1 gene and used case-control analysis in Xinjiang Muslim populations to investigate whether ASAP1 SNP was associated with TB risk.

 Materials and methods <sec> <title>Subject

In this study all the participants, including 400 TB patients and 380 control subjects, were of Xinjiang Muslim ethnicity. For TB patients, there were 322 Uyghur patients, 46 Kazak patients and 32 Hui nationality patients. Correspondingly, the Uyghur patients, Kazak patients and Hui nationality patients were 306, 44 and 30, respectively in the control group.

Eligible cases were adult patients who were newly diagnosed with active TB. These patients have evident lesions of TB through simple computed tomography, X-ray, and positive results of sputum smears and cultures for mycobacteria. Patients with HIV-infection, hepatitis virus infection, immunodeficiency disease, and other lung diseases were excluded from this cohort. Healthy controls were nationality-, age- and sex-matched Xinjiang minorities from Department of Respiratory Medicine, Xinjiang Uygur Autonomous Region Chest Hospital, the Xinjiang Uygur Autonomous Region, Urumqi, Xinjiang, China. The controls were negative both for history of TB and T-SPOT assay. All participants were BCG vaccinated.

Each patient and control enrolled in this study provided a written informed consent. The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Ethics Committee of Department of Respiratory Medicine, Xinjiang Uygur Autonomous Region Chest Hospital.

 Blood sample collection, DNA isolation, purification and quality test

Peripheral blood samples (10 ml) was collected from each participants and stored at −80°C. Genomic DNA was extracted from peripheral blood collected from 400 TB patients and 380 non-TB controls using a Genomic DNA Mini Preparation kit (Beyotime, Shanghai, China) according to the manufacturer's instructions. Then a reference gene ASAP1 was used for qualifying the extracted samples by polymerase chain reaction (PCR) and electrophoresis. Obvious imaging was regarded as qualified, or genomic DNA would be extracted again.

 Gene polymorphism detection SNP selection

According to Curtis et al (14), 7 polymorphic sites in ASAP1 gene were adopted in our study, including rs1017281, rs10956514, rs1469288, rs17285138, rs2033059, rs4733781, rs12680942. The details of primers are presented in Table I.

 Primer design

After searching the whole ASAP1 gene sequence in Genebank, 7 primers pairs were designed and synthetized by Shanghai Biological Engineering Company (Table II).

 Multiplex PCR amplification and product purification

SNPs were genotyped by multiplex PCR reaction using AmpliTaq Gold® 360 Master Mix (Applied Biosystems, Carlsbad, CA, USA), according to its protocol. The PCR reaction was designed to amplify fragments covering all 7 SNP loci. The PCR product was purified using PCR Clean Up kit (Beyotime) according to the protocol.

 SNP detection

Polymorphic loci genotypes were detected using Sanger sequencing.

 Statistical analysis

Statistical power was calculated by a post hoc power analysis by G*Power 3.1.9.2 software (Program written, conceptualized and designed by Franz, Universitat Kiel, Germany; freely available windows application software). The data were analyzed by SPSS 18.0 software (SPSS Inc., Chicago, IL). Continuous variables and categorical data were compared by χ2 test. Hardy-Weinberg equilibrium test was used to detect whether the two groups were in genetic equilibrium. Genotype frequency comparisons between groups were presented as odds ratio (OR) and 95% confidence interval (CI). Haploview 4.2 (26) was used to performed linkage disequilibrium analysis. The tests were 2-sided and P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>General characteristic of TB patients and healthy controls

The clinical characteristics of the total TB patients and healthy controls are summarized in Table III. TB patients were age matched with healthy controls. The age distribution between the patients (55.4±12.4 years) and controls (55.7±12.1 years) was not significantly different based on Mann-Whitney U test (P=0.675), as the data were non-normally distributed (Table I). Patients were also gender-matched with controls, no significant difference of gender was found between the two groups (χ2=0.666, P=0.415). Nationality of objects display no difference between patients and controls (χ2=0.281, P=0.869). Among 400 TB patients, 38 persons had family history of TB, while there were 29 persons with family history of TB in control group, no significance was found between two groups (χ2=1.319, P=0.251). A post hoc power analysis showed that Power value equals 0.8620, meaning a high statistical effect (Fig. 1). The parameters used in power analysis were as follows: cases, 400; controls, 380; prevalence, 0.00178; odds ratio, 1.5070; minor allele frequency, 0.3536.

 Hardy-Weinberg equilibrium test

The rs10956514, rs1469288, rs2033059, rs4733781, rs1017281, rs17285138, rs12680942 SNPs were investigated in 400 pulmonary TB cases and 380 healthy controls in the Xinjiang Muslim population. rs10956514 site was not in Hardy-Weinberg equilibrium (P<0.05), so it was excluded from our research. The last six SNPs were in Hardy-Weinberg equilibrium in the control group and the pulmonary TB group (P>0.05) (Tables III and IV).

 Genotype frequency distribution of ASAP1 gene SNPs in the Xinjiang Muslim population

We used the case-control analysis to examine whether 7 polymorphisms in the ASAP1 gene were associated with susceptibility to TB in Xinjiang Muslim population. The genotype and allelic frequencies of ASAP1 7 SNPs are summarized in Tables III and IV. Two polymorphisms were associated with TB (P<0.05), while the other five SNPs showed no significance. For SNP rs4733781 the frequency of allele A in the pulmonary TB group was higher than that in the control group, and there was a significant difference between the two groups (P=0.046). While SNP rs1017281 was lower than that in the control group (Tables III and IV). The direction of effect for the associated alleles of rs4733781 and rs1017281 was the same as in Curtis et al (14).

 Associations between genetic model of SNPs and TB risk

In order to find the optimal genetic model, we built codominant, dominant, recessive and overdominant model of ASAP1 gene polymorphisms. rs4733781 site was found related to the occurrence of TB in the recessive model (CC vs. AA+AC: OR, 0.51; 95% CI: 0.324–0.802; P=0.003) and co-dominant model (AA vs. CC: OR, 1.926; 95% CI: 1.198–3.097; P=0.006). rs1017281 site was associated with TB in the recessive model (GG vs. AA+AG: OR, 1.792; 95% CI: 1.135–2.828; P=0.011) and co-dominant model (AA vs. GG: OR, 0.532; 95% CI: 0.329–0.826; P=0.01) (Tables V and VI).

 Linkage disequilibrium analysis

Haploview 4.2 was used to performed linkage disequilibrium analysis. As shown in Fig. 2, linkage disequilibrium patterns for the cluster of 7 SNPs in the ASAP1 gene genotyped in a Chinese Xinjiang Muslim population. The results showed that the whole areas were strong linkage disequilibrium and they can be used as a block. Therefore, rs4733781 and rs1017281 were linked together, they should be considered as one locus.

 Discussion

Xinjiang Uygur Autonomous Region bears heavier tuberculosis (TB) burden than other areas in China (3). The selection of candidate genes and detection of their polymorphism sites have been considered breakthroughs of TB prevention and treatment. Curtis et al (14) found single-nucleotide polymorphisms of ASAP1 gene was associated with the susceptibility to TB in the Russian population (14), while Hu et al (23) and Miao et al (24) found no associations. This may be partly due to differences between populations and small statistical power of the follow-up studies to detect weak genetic effects. However, no case-control analysis has been reported in Xinjiang Muslim population to date. Hence, investigating the susceptibility genes in Xinjiang Muslim population may provide access to control TB in Xinjiang Uygur autonomous region.

In the present study, we tested association of ASAP1 gene polymorphism and TB susceptibility in Xinjiang Muslim population by SNP genotyping. Our data suggested that ASAP1 rs4733781 and rs1017281 polymorphisms were associated with TB susceptibility in Xinjiang Muslim population (P=0.046 and P=0.028). While no significant associations were found in rs10956514, rs1469288, rs2033059, rs12680942 and rs17285138. In contrast to our findings, Hu et al (23) and Miao et al (24) found that ASAP1 gene polymorphism was not associated with TB susceptibility in Chinese population and Tibetan population. As known, there are ethnic variations of the allelic frequency distribution in the investigated polymorphism markers (25). In addition, numerous gene studies indicated that the risk variants of genetic heterogeneity and ethnicity specificity was associated with TB (27,28). An explanation for these divergent results may involve whether polymorphism itself acts functionally and confers a truly altered susceptibility to TB disease or the associated allele was an unknown disease susceptibility allele in linkage disequilibrium. In this regard, it is necessary to note that excessive reduction of ASAP1 expression results in the impaired migration of Mycobacterium tuberculosis (MTB)-infected DCs, which may contribute to TB pathogenesis (14). Other co-variables may not be excluded, such as socio-economic factors, nutritional status, and interactions between genes (29). Therefore, in-depth study on the function of these sites is needed. In addition, in light of marginal P-values of associations between ASAP1 SNPs and TB susceptibility (P=0.046 and P=0.028), multiple corrections should be considered in our later work, such as nationality, age, sex, smoking and family history. An independent Uyghur sample will be a good option to get converse results.

Regarding different genotype models, our results demonstrated that a trend of higher rs4733781 A allele and rs1017281 G allele in TB group compared to controls. Different genotype models revealed that subjects with rs4733781 A and rs1017281 G could be more susceptible to TB while subjects with rs4733781 T and rs1017281 A could be more resistant. The recessive model of rs4733781 (CC vs. AC+AA) in Xinjiang Muslim populations tended to be related with a lower TB risk [P=0.003, OR=0.51 (0.324–0.802)], while the recessive model of rs1017281 (GG vs. AA+AG) seemed to be related with a higher TB risk [P=0.011, OR=1.792 (1.135–2.828)].Additionally, the linkage disequilibrium analysis showed that rs4733781 and rs1017281 were linked together, they should be considered one locus. Next, profound studies will be performed to explore the potential functional roles of these two SNPs to help understand major findings. Do they participate in the immunoreaction caused by TB? What is the exact mechanism? Much work remains to be done.

In conclusion, ASAP1 rs4733781 and rs1017281 polymorphism may be a genetic factor for susceptibility to MTB among the Xinjiang Muslim populations. Further investigations of the functional role of SNP rs4733781 and rs1017281 and the genomic surrounding region are warranted.

 Acknowledgements

Not applicable.

 Funding

The study was supported by the National Natural Science Foundation of China (81673160) and The Xinjiang Uygur Autonomous Region Natural Science Foundation (2016D01B015) and The Xinjiang Uygur Autonomous Region Natural Science Foundation (2017D01A25).

 Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

 Authors' contributions

XW contributed to the conception of the study; AM and XH contributed significantly to analysis and manuscript preparation; AL performed the data analyses and wrote the manuscript; FX helped perform the analysis with constructive discussions. All authors read and approved the final manuscript.

 Ethics approval and consent to participate

The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Ethics Committee of Department of Respiratory Medicine, Xinjiang Uygur Autonomous Region Chest Hospital. Each patient and control enrolled in this study provided a written informed consent.

 Consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References ZumlaAGeorgeASharmaVHerbertRHOxleyAOliverMBaroness Masham of Ilton: The WHO 2014 global tuberculosis report - further to goLancet Glob Health3e10e12201510.1016/S2214-109X(14)70361-425539957 National Technical Steering Group of the Epidemiological Sampling Survey for TuberculosisImplementing Office of the Epidemiological Sampling Survey for Tuberculosis: The prevalence of pulmonary tuberculosis in a national survey across China in 2010Zhonghua Jie He He Hu Xi Za Zhi356656682012(In Chinese)23158068 LiXXZhangHJiangSWLiuXQFangQLiJLiXWangLXGeographical distribution regarding the prevalence rates of pulmonary tuberculosis in China in 2010Zhonghua Liu Xing Bing Xue Za Zhi349809842013(In Chinese)24377991 WubuliAXueFJiangDYaoXUpurHWushouerQSocio-demographic predictors and distribution of pulmonary tuberculosis (TB) in Xinjiang, China: A spatial analysisPLoS One10e0144010201510.1371/journal.pone.014401026641642 SirokaAPonceNALönnrothKAssociation between spending on social protection and tuberculosis burden: A global analysisLancet Infect Dis16473479201610.1016/S1473-3099(15)00401-626725446 PngEAlisjahbanaBSahiratmadjaEMarzukiSNelwanRBalabanovaYNikolayevskyyVDrobniewskiFNejentsevSAdnanIA genome wide association study of pulmonary tuberculosis susceptibility in IndonesiansBMC Med Genet135201210.1186/1471-2350-13-522239941 ComstockGWTuberculosis in twins: A re-analysis of the Prophit surveyAm Rev Respir Dis1176216241978565607 VarpelaEStudies on tuberculosis in twinsDuodecim732422501957(In Finnish)13461791 RubinsteinUSchachterJSharonNTalnirRAmirJTuberculosis in a pair of twins - the use of molecular biology methods for the detection of the source of infectionHarefuah1461701722482007(In Hebrew)17460918 KhorCCVannbergFOChapmanSJGuoHWongSHWalleyAJVukcevicDRautanenAMillsTCChangKCCISH and susceptibility to infectious diseasesN Engl J Med36220922101201010.1056/NEJMoa090560620484391 GarzónMCAngéeDYLlerenaCOrjuelaDLVictoriaJESurveillance of Mycobacterium tuberculosis resistance to antituberculosis drugsBiomedica283193262008(In Spanish)10.7705/biomedica.v28i3.7119034356 LadefogedKRendalTSkifteTAnderssonMSøborgBKochARisk factors for tuberculosis in Greenland: Case-control studyInt J Tuberc Lung Dis154449201121276295 NieZRandazzoPAArf GAPs and membrane trafficJ Cell Sci11912031211200610.1242/jcs.0292416554436 CurtisJLuoYZennerHLCuchet-LourençoDWuCLoKMaesMAlisaacAStebbingsELiuJZSusceptibility to tuberculosis is associated with variants in the ASAP1 gene encoding a regulator of dendritic cell migrationNat Genet47523527201510.1038/ng.324825774636 TienDNKishihataMYoshikawaAHashimotoASabeHNishiEKameiKAraiHKitaTKimuraTAMAP1 as a negative-feedback regulator of nuclear factor-κB under inflammatory conditionsSci Rep45094201410.1038/srep0509424865276 OdaAWadaIMiuraKOkawaKKadoyaTKatoTNishiharaHMaedaMTanakaSNagashimaKCrkL directs ASAP1 to peripheral focal adhesionsJ Biol Chem27864566460200310.1074/jbc.M21081720012522101 NieZHirschDSLuoRJianXStaufferSCremestiAAndradeJLebowitzJMarinoMAhvaziBA BAR domain in the N terminus of the Arf GAP ASAP1 affects membrane structure and trafficking of epidermal growth factor receptorCurr Biol16130139200610.1016/j.cub.2005.11.06916431365 HouTYangCTongCZhangHXiaoJLiJOverexpression of ASAP1 is associated with poor prognosis in epithelial ovarian cancerInt J Clin Exp Pathol7280287201324427349 LinDWatahikiABayaniJZhangFLiuLLingVSadarMDEnglishJFazliLSoAASAP1, a gene at 8q24, is associated with prostate cancer metastasisCancer Res6843524359200810.1158/0008-5472.CAN-07-523718519696 SabeHHashimotoSMorishigeMOgawaEHashimotoANamJMMiuraKYanoHOnoderaYThe EGFR-GEP100-Arf6-AMAP1 signaling pathway specific to breast cancer invasion and metastasisTraffic10982993200910.1111/j.1600-0854.2009.00917.x19416474 OnoderaYHashimotoSHashimotoAMorishigeMMazakiYYamadaAOgawaEAdachiMSakuraiTManabeTExpression of AMAP1, an ArfGAP, provides novel targets to inhibit breast cancer invasive activitiesEMBO J24963973200510.1038/sj.emboj.760058815719014 BellamyRSusceptibility to mycobacterial infections: The importance of host geneticsGenes Immun4411200310.1038/sj.gene.636391512595896 HuXPengWChenXZhaoZZhangJZhouJCaiBChenJZhouYLuXNo significant effect of ASAP1 gene variants on the susceptibility to tuberculosis in Chinese populationMedicine (Baltimore)95e3703201610.1097/MD.000000000000370327227929 MiaoRGeHXuLSunZLiCWangRDingSYangCXuFGenetic variants at 18q11.2 and 8q24 identified by genome-wide association studies were not associated with pulmonary tuberculosis risk in Chinese populationInfect Genet Evol40214218201610.1016/j.meegid.2016.03.00526964908 YimJJSelvarajPGenetic susceptibility in tuberculosisRespirology15241256201010.1111/j.1440-1843.2009.01690.x20199642 BarrettJCFryBMallerJDalyMJHaploview: Analysis and visualization of LD and haplotype mapsBioinformatics21263265200510.1093/bioinformatics/bth45715297300 DelgadoJCBaenaAThimSGoldfeldAEEthnic-specific genetic associations with pulmonary tuberculosisJ Infect Dis18614631468200210.1086/34489112404162 El BaghdadiJRemusNBenslimaneAEl AnnazHChentoufiMAbelLSchurrEVariants of the human NRAMP1 gene and susceptibility to tuberculosis in MoroccoInt J Tuberc Lung Dis7599602200312797705 PerrinPHuman and tuberculosis co-evolution: An integrative viewTuberculosis (Edinb)95Suppl 1S112S116201510.1016/j.tube.2015.02.01625841342

Linkage disequilibrium (LD) patterns of seven SNPs among CHB (n=103). The left displays Pairwise D' and the right displays r2. Strong linkage disequilibrium is represented by a high percentage. The red squares without a number indicate 100%. The whole area was in strong linkage disequilibrium, can be used as a block.

Linkage disequilibrium analysis.

Clinical characteristics of patients and controls.

Characteristics TB patients Control χ2 P-value
Number 400 380
Age (years) 55.4±12.4 55.7±12.1 0.675
Nationality 0.281 0.869
  Uyghur 322 (79.8%) 306 (81.2%)
  Kazakhs 46 (11.5%) 44 (11.0%)
  Hui 32 (8.8%) 30 (7.9%)
Sex 0.666 0.415
  Male 237 (59.2%) 236 (62.1%)
  Female 163 (40.8%) 144 (37.9%)
Family history of TB 1.319 0.251
  Yes 38 (9.5%) 29 (7.2%)
  No 362 (90.5%) 371 (92.8%)

TB, tuberculosis.

SNPs with their primers.

SNP ID Gene SNP Primer sequence (5′-3′) Annealing temperature (°C) Fragment size (bp)
rs10956514 ASAP1 A/G GGCCACTGGCAAAAATAAGC 55 320
AGTTGTCCAACTGCGGATAC
rs4733781 ASAP1 A/C CAAATGAACCCCCATAAAGG 55 238
CCAGTGGCTGCATCCTACAT
rs1017281 ASAP1 C/T TATCTAATGTGCAGGGGATTG 55 298
TCTCCCTTTTGCAGCTCACA
rs1469288 ASAP1 C/T TCCACACTGCTGAAAAATCTG 55 521
AAGGATGTGGGGAGTTGAGG
rs2033059 ASAP1 C/T ACATACGTGGTGGTTGACTG 54 393
TCCCAAAGCACAGAGGAAGA
rs12680942 ASAP1 A/G GCTGCTATAAAGACCCAGAAG 56 207
GGCCATTTCTCCAAAGCCTCT
rs17285138 ASAP1 A/T CTGACTTGGTGCCAGCCTAC 54 319
TGCTTTCCCAGAGCTTTCAG

SNP, single-nucleotide polymorphism; ASAP1, Arf GTPase-activating protein-1.

Genotyping of rs1469288, rs2033059, rs12680942, Rs17285138 in TB and control group in Xinjiang Muslin population.

Site/genotype/allele SNP TB patients Control OR (95% CI) P-value
rs1469288 HWE(P) 0.20
  Genotype AA 203 (50.8%) 194 (51.1%)
AG 169 (42.4%) 160 (42.2%)
GG 28 (6.8%) 26 (6.7%) 0.994
  Allele A 575 (71.9%) 548 (72.1%)
G 225 (28.1%) 212 (27.9%) 0.989 (0.793–1.233) 0.919
rs2033059 HWE(P) 0.45
  Genotype CC 130 (32.5%) 108 (28.5%)
CT 192 (48.0%) 203 (53.3%)
TT   78 (19.5%)   69 (18.2%) 0.293
  Allele C 452 (56.5%) 419 (55.1%)
T 348 (43.5%) 341 (44.9%) 1.507 (0.866–1.291) 0.586
rs12680942 HWE(P) 0.99
  Genotype AA 132 (33.0%) 110 (29.0%)
AG 183 (45.9%) 202 (53.0%)
GG   85 (21.2%)   68 (17.9%) 0.116
  Allele A 447 (55.9%) 422 (55.5%)
G 353 (44.1%) 338 (44.5%) 1.014 (0.83–1.239) 0.89
rs17285138 HWE(P) 0.09
  Genotype AA 126 (31.6%) 105 (27.7%)
AT 204 (51.0%) 204 (53.6%)
TT   70 (17.4%)   71 (18.7%) 0.496
  Allele A 456 (57.0%) 414 (54.5%)
T 344 (43.0%) 346 (45.5%) 1.108 (0.907–1.353) 0.315

HWE(P), Hardy-Weinberg equilibrium P-value; OR, odds ratio; CI, confidence intervals.

Genotyping of rs10956514, rs4733781, rs1017281 in TB and control group in Xinjiang Muslin population.

Site/genotype/allele SNP TB patients Control OR (95% CI) P-value
rs10956514 HWE(P) 0.013
  Genotype GG 136 (34.0%) 133 (35.0%)
GA 207 (51.8%) 199 (52.4%)
AA   57 (14.2%)   48 (12.6%) 0.799
  Allele G 479 (59.9%) 465 (61.2%)
A 321 (40.1%) 295 (38.8%) 0.947 (0.773–1.160) 0.597
rs4733781 HWE(P) 0.12
  Genotype AA 194 (48.6%) 174 (45.8%)
AC 173 (43.2%) 149 (39.2%)
CC 33 (8.2%) 57 (15%) 0.012
  Allele A 561 (70.1%) 497 (65.4%)
C 239 (29.9%) 263 (34.6%) 1.242 (1.004–1.537) 0.046
rs1017281 HWE(P) 0.56
  Genotype AA 165 (41.2%) 171 (45.0%)
AG 187 (46.8%) 177 (46.6%)
GG 58 (12.0%) 32 (8.4%) 0.034
  Allele A 517 (64.6%) 519 (67.3%)
G 283 (35.4%) 241 (31.7%) 0.792 (0.643–0.976) 0.028

HWE(P), Hardy-Weinberg equilibrium P-value; OR, odds ratio; CI, confidence intervals. Bold text, statistically significant.

Association of ASAP1 SNP genotypes with pulmonary TB under different genotype models.

Model Genotype Case Control OR (95% CI) P-value
rs4733781 AA 194 (48.6%) 174 (45.8%) 1
Codominant AC 173 (43.2%) 149 (39.2%) 0.96 (0.712–1.296) 0.791
CC 33 (8.2%) 57 (15%) 1.926 (1.198–3.097) 0.006
Dominant AA 194 (48.5%) 174 (45.8%)
AC+CC 206 (51.5%) 206 (54.2%) 1.115 (0.841–1.477) 0.448
Recessive CC 33 (8.2%)   57 (15.0%)
AC+AA 367 (91.8%) 323 (85.0%) 0.51 (0.324–0.802) 0.003
Overdominant AA+CC 227 (56.8%) 231 (60.8%)
AC 173 (43.2%) 149 (39.2%) 0.846 (0.636–1.126) 0.252
rs1017281 AA 165 (41.2%) 171 (45.0%) 1
Codominant AG 187 (46.8%) 177 (46.6%) 0.913 (0.679–1.229) 0.549
GG   58 (12.0%) 32 (8.4%) 0.532 (0.329–0.862) 0.01
Dominant AA 165 (41.2%) 171 (45.0%)
AG+GG 235 (58.8%) 209 (55.0%) 0.858 (0.646–1.140) 0.29
Recessive GG   48 (12.0%) 32 (8.4%)
AA+AG 352 (88.0%) 348 (91.0%) 1.792 (1.135–2.828) 0.011
Overdominant AA+GG 213 (53.2%) 203 (53.4%)
AG 187 (46.8%) 177 (46.6%) 1.04 (0.786–1.375) 0.785

Bold text, statistically significant.

The data of D' and r2 among 7 SNPs of ASPAP1 gene in the Chinese Xinjiang Muslim population.

L1 L2 D' r^2
rs1469288 rs1017281 1 1
rs1469288 rs10956514 1 0.979
rs1469288 rs12680942 1 1
rs1469288 rs2033059 1 0.959
rs1469288 rs4733781 1 1
rs1469288 rs17285138 1 0.979
rs1017281 rs10956514 1 0.979
rs1017281 rs12680942 1 1
rs1017281 rs2033059 1 0.959
rs1017281 rs4733781 1 1
rs1017281 rs17285138 1 0.979
rs10956514 rs12680942 1 0.979
rs10956514 rs2033059 1 0.979
rs10956514 rs4733781 1 0.979
rs10956514 rs17285138 0.979 0.958
rs12680942 rs2033059 1 0.959
rs12680942 rs4733781 1 1
rs12680942 rs17285138 1 0.979
rs2033059 rs4733781 1 0.959
rs2033059 rs17285138 1 0.979
rs4733781 rs17285138 1 0.979