Contributed equally
Programmed cell death 1 (PD-1) is an immuno-checkpoint receptor which is primarily expressed on T cells, monocytes, natural killer cells and macrophages. Programmed death-ligand 1 (PD-L1) is the primary ligand of PD-1 and is constitutively expressed on antigen presenting cells, mesenchymal stem cells and bone marrow-derived mast cells. In addition, PD-L1 is also expressed on a wide range of tumor cells, including lung cancer, breast cancer and melanoma. PD-1 and PD-L1 are important members of the immunoglobulin super-family and participate in immune regulation. In the present study, the immune-suppressive effects of a number of tumor cell lines were determined. The breast tumor cell lines MCF-7 and MDA-MB-231 displayed the largest inhibitory effects on T-cell activation and cytokine secretion in a co-culture system. The HepG2, A549 and A375 cells displayed limited inhibitory effects. MCF-7 and MDA-MB-231 cells expressed the highest level of PD-L1 among the cells used, which may explain their higher immuno-suppressive effects. Compound A0-L, a small molecule inhibitor of the PD-1/PD-L1 interaction, restored T cell functions. Additionally, it was demonstrated that the tumor cells with higher levels of PD-L1 expression suppressed signaling pathways involved in T-cell activation, such as the T-cell receptor- zeta chain of T cell receptor associated protein kinase ZAP70-RAS-GTPase-extracellular-signal-regulated kinases and CD28-PI3K-Akt serine/threonine kinases pathways. These findings suggest that tumor cells with higher expression levels of PD-L1 may exhibit higher immuno-suppressive activity, and that drugs targeting the PD-1/PD-L1 interaction may have improved therapeutic effects on tumors expressing higher levels of PD-L1.
Tumors utilize a variety of mechanisms to impair the functionality of tumor-specific immune cells, T cells, macrophages and other cells associated with the immune response (
The immune system regulates tumor biology, and, depending on the tumor, can either support or inhibit tumor development, growth, invasion and metastasis (
As an immunosuppressive molecule receptor, PD-1 can inhibit the activation of T lymphocytes and play an important role in immune escape. PD-1 belongs to the CD28/CTLA-4 family of molecules, and it negatively regulates PD-1 signaling. When two PD-L1 or PD-L2 ligands are concomitantly bound to PD-1, a protein tyrosine phosphatase, tyrosine-protein phosphatase non-receptor type 11 (SHP-2) is recruited intracellularly (
Although several PD-1/PD-L1 inhibitors have been approved for cancer therapy, the effectiveness of these inhibitors appears to be tumor specific (
A PGL3-nuclear factor of activated T-cells (NFAT)-TA-Luciferase plasmid containing the full-length luciferase gene under the control of an NFAT-driven promoter, was used in the present study. NFAT is a nuclear factor of activated T cells that synergizes with activator protein 1 transcription factors at composite sites that are located in the promoters and enhancers of a number of cytokine genes. This indicates that the NFAT promoter an important factor in the immune response (
DMEM, RPMI-1640 medium, Leibovitz 15 medium, FBS, GlutaMAX™ and 2-mercaptoethanol were purchased from Gibco; Thermo Fisher Scientific, Inc. Penicillin-streptomycin was purchased from Sigma-Aldrich (Merck KGaA). FuGENE® HD Transfection Reagent was purchased from Promega Corporation and TRIzol® reagent was purchased from Invitrogen (Thermo Fisher Scientific, Inc). Anti-CD3 and anti-CD28 were purchased from BD Biosciences. Allophycocyanin-conjugated anti-human-CD274/PD-L1 antibody were purchased from eBioscience (Thermo Fisher Scientific, Inc.). Rabbit anti-Erk1/2, rabbit anti-phospho-Erk1/2, rabbit anti-AKT, rabbit anti-GAPDH and horseradish peroxidase-conjugated Goat anti-rabbit immunoglobulin G were purchased from Cell Signaling Technology, Inc. Human IFN-γ ELISA kits and human IL-2 ELISA kits were purchased from Cisbio (PerkinElmer, Inc.). A0-L (a PD-1 inhibitor; patent no. WO 2015/034820 A1; molecular weight, 475.58) was synthesized by Dr Wei Lv of East China Normal University. The company name and catalog number for ELISA kits and all antibodies are listed in
A total of 2×105 293, MCF-7, A375, A549, HeLa or HepG2 cells were cultured per well in 6-well cell culture plates with DMEM, supplemented with 10% FBS at 37°C for 24 h. In the A549 cells, 1% GlutaMAX™ was added to the culture medium. MDA-MB-231 (2×105 cells/well) were cultured in 6-well cell culture plates with Leibovitz's L-15 Medium, supplemented with 10% FBS and 1% GlutaMAX™ at 37°C for 24 hours. The culture media was collected and centrifuged at 12,000 × g for 10 min using a pre-chilled centrifuge set to 4°C. The supernatant was collected and termed ‘conditioned medium’.
Jurkat cells were transfected with 3.3 µg PGL3-NFAT-TA-Luciferase using FuGENE® HD Transfection Reagent. After 16 h, 2×105 MCF-7, MDA-MB-231, A549, A375, HeLa or HepG2 cells were seeded into wells with their respective growth medium, and 2×104 Jurkat cells transfected with PGL3-NFAT-TA-Luciferase were added to the wells. The conditioned media was collected from the cultures after 24 h. The conditioned media was added to 2×104 Jurkat cells transfected with PGL3-NFAT-TA-Luciferase. After 30 min, anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml) were added to the culture systems: Tumor cells; Jurkat cells co-cultured with tumor cells in normal media; Jurkat cells alone in conditioned media. After 24 h of co-culture, luciferase activities were measured using the Luciferase system (Promega Corporation) and EnVision multiplate reader (PerkinElmer, Inc.) according to the manufacturer's protocol.
PBMCs derived from healthy volunteers were provided by the Shanghai Blood Center. PBMCs were isolated using a Ficoll-Paque gradient. To separate PBMCs, 20 ml Ficoll was placed in a 50 ml conical centrifuge tube and an equal volume of whole blood diluted 1:1 with PBS was layered on top. The 50-ml tubes were centrifuged at 2,000 × g for 30 min at room temperature with a low acceleration speed. The PBMCs at the interface between the Ficoll and the plasma were gently collected by aspiration using a Pasteur pipette and placed in a 15 ml conical tube. Subsequently, the PBMCs were washed twice with 10 ml PBS and centrifuged at 500 × g for 5 min at 4°C (
A total of 2×105 MCF-7, MDA-MB-231, A549, A375, HeLa, or HepG2 cells were seeded per a well in their respective growth medium for 30 min and then 2×104 PBMCs were added to each well. Tumor cell conditioned media was collected from the cultures after 24 h. PBMCs were exposed to tumor cell conditioned media. After 30 min, anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml) were added to the tumor cells/PBMCs or tumor cell conditioned media/PBMCs co-culture system. After 48 h of co-culture, cell culture supernatants were collected and analyzed for IL-2 and IFN-γ using the HTRF kit (Cisbio; PerkinElmer, Inc.) according to the manufacturer's protocol.
Total RNA was extracted using TRIzol® reagent according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc.). RNA (1 µg) was used to synthesize cDNA using a PrimeScript RT Reagent kit (Takara Bio, Inc.) according to the manufacturer's protocol. qPCR was performed for PD-L1, PD-L2, CD80, CD86, herpesvirus entry mediator (HVEM), CD70, CD137, OX40L and GAPDH. The sequences of the primer pairs used are shown in
Cells were incubated with allophycocyanin-conjugated anti-human-CD274 antibody (1:100) at 4°C for 30 min in the dark for flow cytometry analysis using a Guava® easyCyte Benchtop flow cytometer and FlowJo software (FlowJo™; version 10.6.1; FlowJo LLC) was used to analyze the data.
MCF-7 and MDA-MB-231 cells were plated in 6 well plates at a density of 1×105 cells/ml. The cells were co-cultured with Jurkat cells (2×105) in serum-free medium, and treated with anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml) for 5, 15 and 30 min, respectively. After the treatment, Jurkat cells were washed in PBS and lysed with RIPA lysis buffer (CoWin Biosciences). Protein concentrations were determined using a bicinchoninic acid assay kit (Thermo Fisher Scientific, Inc.). Western blot analysis was performed as previously described (
Data were analyzed with GraphPad Prism version 5.0 (GraphPad Software, Inc.). The results were analyzed using a two-way ANOVA followed by post-hoc Bonferroni's tests or a one-way ANOVA followed by a post-hoc Newman-Keuls test. All data are presented as the mean ± standard error of the mean. P<0.05 was considered to indicate a statistically significant difference.
NFATs are a family of transcription factors which serve important roles in the immune response (
Jurkat is an immortalized cell line of human T lymphocytes (
The aforementioned results suggest that different tumor cells have different effects on suppressing immune cell function. Thus, whether the expression levels of immune checkpoint proteins on tumor cells affected their immune-suppressive activity was determined. The mRNA expression levels of PD-L1 and other immune checkpoint genes, PD-L2, CD80, CD86, HVEM, CD70, CD137 and OX40L were measured in these tumor cells (
MCF-7 and MDA-MB-231 cells had the highest level of PD-L1 expression, and the largest inhibitory effect on T-cell activation and cytokine secretion in the co-culture system. Therefore, the two tumor cell lines were used to investigate the effect of the PD-1/PD-L1 inhibitor on the function of lymphocytes. Stimulation of Jurkat cells with anti-CD3 and anti-CD28 antibodies significantly induced the expression of luciferase, whereas MCF-7 and MDA-MB-231 cells significantly inhibited the expression of luciferase (
Similar results were observed in the PBMC cytokine secretion assay. Anti-CD3 and anti-CD28 co-stimulation induced IFN-γ and IL-2 secretion from PBMC cells, which was significantly inhibited by the co-culture with MCF-7 and MDA-MB-231 cells (
MCF-7 or MDA-MB-231 cells were co-cultured with Jurkat cells to investigate the regulatory effects of tumor cells on AKT and ERK1/2 phosphorylation in immune cells. Jurkat cells were stimulated with anti-CD3 and anti-CD28 (1 µg/ml) antibodies for various durations, and AKT and ERK1/2 phosphorylation was assessed by western blotting. Anti-CD3 and anti-CD28 were increased phosphorylation of AKT and ERK1/2 in a time-dependent manner (
Previous findings have shown that PD-L1 is expressed on the surface of tumor cells in a number of different types of cancer and could induce immunosuppression to enable the host to evade anticancer immune responses (
T-cell activation is initiated by the binding of TCRs to their physiological ligands, which are foreign peptides bound to the MHC expressed on antigen-presenting cells (APCs) (
The PD-1/PD-L1 targeting strategy was a breakthrough in immunotherapy that restores the functions of T cells (e.g., immune cell activation and differentiation, and cytokine secretion) and promotes immune response (
Not applicable.
The present study was supported by grants from The National Science & Technology Major Project: Key New Drug Creation and Manufacturing Program (Beijing, China; grant no. 2017ZX09101004-012-008); Personalized Medicines-Molecular Signature-based Drug Discovery and Development; Strategic Priority Research Program of the Chinese Academy of Sciences (Beijing, China; grant no. XDA12040212), and Shanghai Commission of Science and Technology (Shanghai, China; grant no. 16431901500).
The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.
YZ performed the majority of the experiments, analyzed the data and wrote the manuscript. YCF performed some of the experiments. JL supervised the study, analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.
The use of human PBMCs was specifically approved by The Medical Ethics Committee of Shanghai Blood Center, (Shanghai, China). Prior to donating blood, the volunteers were informed and provided written informed consent for the scientific research use of blood samples. Due to ethical constraints, no clinical information on the blood donors was obtained.
Not applicable.
The authors declare that they have no competing interests.
Immunosuppression by cancer cells. (A) Jurkat cells transfected with PGL3-NFAT-TA-Luciferase plasmid were co-cultured with various cancer cell lines and stimulated with anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml). Luciferase activity was measured 24 h after stimulation. **P<0.01, ***P<0.001 vs. control (−). (B) Jurkat cells transfected with PGL3-NFAT-TA-Luciferase plasmid were cultured in various cancer cell-conditioned media and stimulated with anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml). Luciferase activity was measured 24 h after stimulation. (C) Human PBMCs were co-cultured with various cancer cell lines and then stimulated with anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml). **P<0.01, ***P<0.001 vs. control (−). (D) Human PBMCs cultured in various cancer cell-conditioned media were stimulated with anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml). hPBMC, human peripheral blood mononuclear cells; IL-2, interleukin-2; IFN-γ, interferon-γ.
Expression of immune checkpoint markers in various cancer cell lines. mRNA expression levels of (A) PD-L1, (B) PD-L2, (C) CD80, (D) CD86, (E) HVEM, (F) CD70, (G) CD137 and (H) OX40L in tumor cell lines. *P<0.05, **P<0.01, **P<0.001. (I) mRNA expression levels of immune checkpoint receptors in Jurkat cells. Gene expression was normalized to GAPDH in the same sample. (J) FACS analysis of PD-L1 in various cancer cell lines. APC-conjugated anti-human-PD-L1 was used as a binding antibody to cell-surface PD-L1 protein (red line, isotype control staining; blue line, PD-L1 staining). Cell count has been normalized to the peak height at the mode of the distribution, such that absolute count is presented as a percent of the total count. (K) Quantification of the FACS analysis shown in (J). **P<0.01, ***P<0.001 vs. 293. APC, allophycocyanin.
PD-1/PD-L1 inhibitor restores the function of lymphocytes. (A) Jurkat cells transfected with PGL3-NFAT-TA-Luciferase plasmid cocultured with various cancer cell lines were treated with A0-L (10 µM) and subsequently stimulated with anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml). Luciferase activity was measured 24 h later. **P<0.01, ***P<0.001. hPBMCs were co-cultured with MCF-7 or MDA-MB-231 in the presence of A0-L (10 µM), subsequently stimulated with anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml), and the levels of (B) IL-2 and (C) IFN-γ were measured. ***P<0.001. PD-1, programmed cell death 1; PD-L1, programmed death ligand 1; IL-2, interleukin-2; IFN-γ, interferon-γ; hPBMC, human peripheral blood mononuclear cells.
Activation of AKT and ERK in Jurkat cells co-cultured with cancer cells. (A) Jurkat cells cultured alone or in the presence of MCF-7 or MDA-MB-231 cells were activated by anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml). Jurkat cells were collected and lysates were prepared, and the amounts of the indicated proteins were determined by western blotting. (B) Densitometry analysis of the phosphorylation of AKT and ERK presented in (A). For each time point, fold changes in the amounts of the indicated proteins in activated Jurkat cells that were stimulated through anti-CD3 (1 µg/ml), anti-CD28 (1 µg/ml) were compared with cells that were not activated. *P<0.05, **P<0.01, ***P<0.001 vs. 0 min. unstimulated cells; #P<0.05, ##P<0.01, ###P<0.001 vs. Jurkat cells that were stimulated with anti-CD3 (1 µg/ml), anti-CD28 (1 µg/ml). (C) Jurkat cells cultured with MCF-7 in the absence or presence of A0-L (10 µM) were activated by anti-CD3 (1 µg/ml) and anti-CD28 (1 µg/ml). Jurkat cells were collected and lysates were prepared, and the amounts of the indicated proteins were examined by western blotting. (D) Densitometry analysis of the phosphorylation of AKT and ERK presented in (C). Fold changes in the amounts of the indicated proteins in activated Jurkat cells that were suppressed by MCF-7. *P<0.05, **P<0.01, ***P<0.001 vs. Jurkat cells that were stimulated through anti-CD3 (1 µg/ml), anti-CD28 (1 µg/ml) at 5 min. unactivated Jurkat cells that were reversed by A0-L; #P<0.05, ##P<0.01, ###P<0.001 vs. Jurkat cells that were stimulated with anti-CD3 (1 µg/ml), anti-CD28 (1 µg/ml) and co-cultured with MCF-7. AKT, protein kinase B; ERK, extracellular-signal regulated kinase; p, phospho; Ab, antibody.
Forward and reverse primers used for all RT-qPCR analyses.
Gene | Forward | Reverse |
---|---|---|
GAPDH | AGCCGCATCTTCTTTTGCGT | TGACGAACATGGGGGCATCA |
PDL1 | GCTGCACTAATTGTCTATTGGGA | AATTCGCTTGTAGTCGGCACC |
IDO1 | GCGCTGTTGGAAATAGCTTC | ATGTCCTCCACCAGCAGTC |
PDL2 | CAGCAATGTGACCCTGGAAT | GGACTTGAGGTATGTGGAACG |
TIM3 | GGAATACAGAGCGGAGGTCG | AGGGACACATCTCCTTTGCG |
LAG3 | ACCCCATCCCAGAGGAGTTT | GTCGCCACTGTCTTCTCCAA |
CTLA4 | CCGTGCCCAGATTCTGACTT | ACATTCTGGCTCTGTTGGGG |
CD80 | TCTGTTCAGGTGTTATCCACG | GGGCGTACACTTTCCCTTCT |
CD86 | ATTCGGACAGTTGGACCCTG | CCAAGGAATGTGGTCTGGGG |
CD28 | ACACCTTTGTCCAAGTCCCC | AGCAGTGCTGCTTCTCTTACC |
ICOS | TTGAACACTGAACGCGAGGA | AAAACTGGCCAACGTGCTTC |
HVEM | GTCTTGAGGCTGGTGCTGTA | TGGTCTGGTGCTGACATTCC |
BTLA | GACCCTCCAAGGACGAAGTG | TTCTCAGGCAGCAGAACAGG |
CD137L | CGCAGTCTCTCGTCATGGAA | CCTCTTTGTAGCTCAGGCCC |
CD70 | GACACACTCTGCACCAACCT | TAATCAGCAGCAGTGGTCAGG |
OX40L | AGGCCAAGATTCGAGAGGAAC | CAGTGGTGCATCTTACCTGAA |