Antibodies against phosphotyrosine (4G10, cat. no. 05-321) and Hck (cat. no. 06-833) were from EMD Millipore (Billerica, MA, USA). M45 antibody was a gift from Dr Pat Hearing (Stony Brook University, NY, USA). Protein A, buffers, antibiotics and other chemicals were from Sigma-Aldrich (St. Louis, MO, USA). Glutathione agarose was purchased from Molecular Probes/Life Technologies (Carlsbad, CA, USA). The mammalian expression vector for Hck was as described previously (12).

Polymerase chain reaction (PCR) was used to amplify the WDCP coding sequence from human cDNA, clone HEP04702 (obtained from the Human Genome Center, Institute of Medical Science, University of Tokyo, Tokyo, Japan). The primers used were: forward, 5′, GGATCCTGA TGGAGTTGGGAAAAGGAAAACTACTCAGG; and reverse 3′, AAGCTTTCAAGCCATGCCATCTACATGGTT ACAACAGCC. The WDCP cDNA was cloned into the BamHI and HindIII sites of plasmid pCM45 (a gift from Dr Pat Hearing, Stony Brook University) to produce an N-terminal M45-tagged version. Protein features were predicted with the Universal Protein Resource UniProt (13).

Human embryonic kidney (HEK) 293 cells were maintained in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, 100 U/ml streptomycin sulfate and 100 µg/ml amphotericin B. Transfections were carried out with Mirus TransIT (Mirus Corp., Madison, WI, USA) using HEK293 cells, which had been plated 24 h previously. The cells were harvested 48 h after transfection and were lysed in buffer containing 20 mmol/l Tris (pH 8.0), 5 mmol/l EDTA, 1% Nonidet P-40, 150 mmol/l NaCl and 2 mmol/l sodium orthovanadate, with protease inhibitors (5 mg/l aprotinin, 5 mg/l leupeptin and 0.1 mmol/l phenylmethylsulfonyl fluoride) at 4°C for 30 min. The cell lysates were centrifuged at 14,000 x g for 15 min at 4°C. Following protein concentration determination, 1 mg/ml concentrations of the cell lysates were used for immunoprecipitation experiments. The lysates were first precleared with protein A beads for 1 h at 4°C. The protein A beads were discarded following centrifugation. Subsequently, 1 µg antibody (or the immunoglobulin G control) and 15 µl protein A beads were added to the precleared cell lysates and incubated for 1 h at 4°C. The beads were washed three times with lysis buffer and immunoprecipitated proteins were resolved by SDS-PAGE. The proteins were transferred to polyvinylidene difluoride membranes and western blotting was carried out with the appropriate antibodies. The proteins were visualized using horseradish peroxidase-conjugated secondary antibody and an enhanced chemiluminescent detection kit (GE Life Sciences, Pittsburgh, PA, USA).

Glutathione S-transferase (GST) or GST-SH3 fusions (Hck, Crk, Grb2 N-terminal SH3 and Nck) were immobilized on glutathione-agarose. HEK293 cell lysates were added to the resins and agitated at 4°C for 30 min. The resins were washed extensively with lysis buffer and bound proteins were eluted with SDS sample buffer and analyzed by SDS-PAGE and western blotting.

HEK293 lysates were fractionated on a Superdex-200 fast protein liquid chromatography column (GE Life Sciences, Pittsburgh, PA, USA) pre-equilibrated with 20 mmol/l Tris (pH 8.0), 0.2 M NaCl, 10% glycerol and 0.2 mmol/l Na₃VO₄. The proteins were eluted from the column at a flow rate of 0.15 ml/min. Fractions of 0.15 ml were collected. The column fractions were subjected to anti-M45 immunoprecipitation, and assayed for WDCP using anti-M45 western blotting. The molecular weight calibration was performed using protein standards (Sigma-Aldrich) and by constructing a standard curve of retention time vs. molecular weight.

We previously conducted a proteomic screen for the binding partners of the SH3 domain of the Hck non-receptor tyrosine in the U937 human monocytic cell line. One of the proteins identified was the product of the human C2orf44 gene (12). PCR was used to amplify the full-length cDNA encoding the C2orf44 protein. The protein consists of 721 amino acids (Fig. 1). The amino-terminal half of the protein contains two WD repeats (WD1 and WD2); these units are involved in a range of biological functions, including apoptosis, transcriptional regulation and signal transduction (14). The carboxy-terminal half of the protein contains a proline-rich sequence (PPRLPQR) that is similar to known ligands for the SH3 domains (15). The C-terminus is also predicted to have a leucine-rich coiled coil region (CC). In view of these sequence elements, the C2orf44-encoded protein was designated as WDCP.

CC regions are frequently involved in protein oligomerization, often through the formation of amphiphilic structures. WD repeats have also been observed to mediate oligomerization (14). The C2orf44-ALK gene fusion in colorectal cancer could potentially be activated by the inappropriate oligomerization of the ALK tyrosine kinase. To test whether WDCP exists as an oligomer, a mammalian expression vector encoding WDCP with an N-terminal M45 tag was produced. The protein was expressed in HEK293 cells and cell lysates were fractionated on a Superdex-200 gel filtration column that had been calibrated with molecular weight standards. WDCP was visualized in column fractions by western blotting with anti-M45 antibodies (Fig. 2). Although the predicted molecular weight of WDCP is 79 kilodaltons (kDa), relatively low amounts of the protein were detected in this mass range. Instead, the majority of the proteins co-eluted in the same region as higher (130–140 and >200 kDa) molecular weight standards. These results are consistent with the formation of WDCP oligomers in mammalian cells.

Subsequently, the ability of WDCP to interact with SH3 domains was tested. M45-tagged WDCP was expressed in HEK293 cells and incubated lysates with the GST-tagged Hck SH3 domain, immobilized on glutathione agarose. In certain reactions, a Pro-rich competitor peptide (YEVPPPVPPRRR, a peptide we previously showed binds tightly to the Hck SH3 domain) was included (16). WDCP bound to the immobilized Hck SH3 domain in the absence of the competitor peptide (Fig. 3A). Binding was substantially reduced in the presence of 50 µM Pro-rich peptide and eliminated altogether in the presence of 500 µM peptide (Fig. 3A). WDCP did not bind to control beads containing immobilized GST (Fig. 3A). These experiments validated the results of the proteomic screen and indicated that WDCP binds to the typical ligand-binding site on the Hck SH3 domain, which recognizes proline-rich sequences.

WDCP contains one predicted SH3 ligand sequence between amino acids 539 and 545. This Pro-rich sequence is predicted to be a class 2 motif, with the consensus sequence PXXPXR (15). The two proline residues within this sequence (Pro 540 and Pro 543) were mutated to alanine and the wild-type and mutant forms were expressed in HEK293 cells. Binding experiments were carried out using cell lysates and a variety of immobilized SH3 domains. Wild-type WDCP showed a strong preference for the SH3 domain of Hck; there were trace amounts of binding to the Crk SH3 domain and undetectable binding to the SH3 domains of Grb2 (N-SH3) and Nck (Fig. 3B). The proline to alanine mutations eliminated binding to the SH3 domain of Hck (Fig. 3B). The expression of the Pro-mutant form of WDCP was confirmed to be equally strong as the wild-type (Fig. 3C). Thus, the SH3 binding site was localized on WDCP to the Pro-rich sequence between 539–545 and it was demonstrated that WDCP has selectivity with respect to the SH3-mediated protein-protein interactions in which it is involved.

Subsequently, the interaction of WDCP with full-length Hck kinase in mammalian cells was tested. M45-tagged WDCP was expressed in HEK293 cells, either alone or together with Hck. Following immunoprecipitation of WDCP, anti-Hck western blotting experiments were performed to show that the two proteins interact (Fig. 4A). The levels of precipitated WDCP were similar in the presence or absence of Hck (Fig. 4B). The blot was stripped and reprobed with anti-phosphotyrosine antibodies (Fig. 4C). These experiments showed that WDCP is tyrosine phosphorylated when co-expressed with Hck, but not when expressed alone. Thus, Hck promotes WDCP tyrosine phosphorylation, either directly (via an enzyme-substrate interaction) or indirectly (for example, by stimulating another kinase that directly phosphorylates WDCP).