Human cervical cancer cell lines (HeLa) were obtained from the American Type Culture Collection (ATCC) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen Biotechnology, Shanghai, China). Cultures were grown at 37°C in a humidified atmosphere, containing 5% CO₂.

DNA template oligonucleotides corresponding to the human survivin gene (GenBank accession no. NM_001168) were designed and synthesized as in our previous study [23]: survivin-shRNA1 (sense, 5′-GATCCGGAACTGGCCCTT CTTGGAGTTCAAGAGACTCCAAGAAGGGCCAGTTCT TTTTTGGAAG-3′); survivin-shRNA2 (sense, 5′-GATCCG ACTGGACAAGAGAAAGAGCCTTCAAGAGAGGCTCTT TCTCTGTCCAGTTTTTTTGGAAG-3′); survivin-shRNA3 (sense, 5′-GATCCGGGACCACCGCATCTCTACATTCAA GAGATGTAGAGATGCGGTGGTCCTTTTTTGGAAG-3′). These double strand oligonucleotides were subcloned into a linearized U6 promoter-driven pSIREN-DNR-DsRed-Express vector (BD Biosciences Clontech, USA) at the BamHI and EcoRI sites. The selected reconstructed plasmids for transfection were extracted and purified using a Qiaquick kit (Qiagen, Crawley, UK). Those specific recombinant shRNA vectors were termed pSIREN/S1, pSIREN/S2 and pSIREN/S3, respectively. Similarly, a non-specific control vector was constructed (pSIREN/con). Transient transfections were performed using Lipofectamine™ 2000 (Invitrogen Biotechnology, Shanghai, China), as described previously (24,25).

Briefly, cells were harvested by 0.25% trypsin digestion after reaching 80-90% confluence and were resuspended in DMEM media (300 μl/well) at a concentration of 1×10⁷ cell/ml (26). SonoVue microbubbles (Bracco, Milan, Italy) were used to promote cavitation and were reconstituted in saline solution at a concentration of 25–30 particles/cell, and slowly added to the cell suspension prior to ultrasound exposure (25). The UTMD experiments were performed in an exposure tank and the transducer (Accusonic, Metron Medical Australia Pty., Ltd.) was held in a positioning device at the base of the tank, as previously described (27).

Experiments were divided into the groups: negative control group, Lipofectamine-transfected groups (pSIREN/CON+L, pSIREN/S1+L, pSIREN/S2+L, pSIREN/S3+L) and UTMD-treated groups (pSIREN/S1+UTMD, pSIREN/S2+UTMD, pSIREN/S3+UTMD).

The study was approved by the Ethics Committee of The Third Affiliated Hospital of Guangzhou Medical College, Guangzhou, China.

Plasmid (final concentration 25 μg/ml) was added to the cell suspension prior to ultrasound exposure. The cells were exposed to various ultrasound intensities (0.4, 1.0, 1.6 and 2.2 W/cm²) for various durations (1 and 3 min), with a 10 or 20% of duty cycle (DC) and frequency of 1 MHz, n=6 for each parameter.

The transfected cell expression of red fluorescence protein (RFP) was visualized by an inverse fluorescence microscope (Olympus IX71, Japan) after 48 h (28). The cells were then harvested, collected and resuspended in phosphate-buffered saline (PBS). Approximately 1×10⁵ cells were obtained from each sample for transfection efficiency analysis, with a 488-nm wavelength excitation light and a 585±42 nm wavelength emission light to detect the red fluorescence using flow cytometry (FACSCalibur, Becton-Dickinson, USA). The transfection efficiency was assessed as the number of cells expressing RFP per total number of surviving cells.

Plasmid DNA (100 μl) or SonoVue/DNA complexes were added into 6 wells of 96-well culture plates, as described previously (15), and exposed to ultrasound irradiation (0.4, 1.0, 1.6 and 2.2 W/cm²; DC, 20%; exposure time, 3 min) with or without the addition of SonoVue microbubbles. Gel electrophoresis analysis was performed immediately after ultrasound irradiation.

Cells were harvested 48 h following transfection, and total RNA was extracted with TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The RNA was reverse-transcribed into cDNA with a reverse transcription kit (Promega, Madison, WI, USA). Specific primers were designed on the basis of human cDNA sequences using Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA, USA) and synthesized by Invitrogen. The sequences of the primers were: forward, 5′-ACCACCGCATCTCTACATTC-3′; reverse, 5′-AGTCTG GCTCGTTCTCAGTG-3′; and the predicted product was 113 bp. GAPDH was used as an internal standard and its mRNA was amplified with primers: forward, 5′-GAAGGTGAA GGTCGGAGTC-3′; reverse, 5′-GAAGATGGTGATGGG ATTTC-3′; and the predicted product was 226 bp. PCR amplification of the sequences was performed and the products obtained were electrophoresed through a 1% agarose gel with ethidium bromide. The intensity of survivin and GAPDH were evaluated using Quantity One software (Bio-Rad, Hercules, CA, USA). The relative expression levels of survivin were expressed as the ratio of survivin/GAPDH.

The cells were washed twice with cold PBS prior to being lysed in cell lysis buffer. Cell extracts were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto nitrocellulose membranes (Millipore, Billerica, MA, USA). Immunoblot analysis was performed according to standard protocol (24). The blots were developed using enhanced chemiluminescence. The relative levels of survivin were expressed as the ratio of survivin/β-actin.

DNA was extracted from detached and adherent cells, and was subjected to electrophoresis using agarose gel as previously described (15).

Cells were assessed by flow cytometry (FACSCalibur, BectonDickinson) following the double staining of cells with annexin V and 7-AAD (Jinmei Biotech Co. Ltd., Wuhan, China). Early apoptotic cells were stained with FITC-labelled annexin-V alone, whereas necrotic and late apoptotic cells were stained with annexin V and 7-AAD (29). Each assay was performed three times.

A total of 48 h after transfection, HeLa cells were collected by trypsinization, pooled with non-attached cells, and fixed in 70% ethanol on ice for 30 min. Fixed cells were pelleted by centrifugation and suspended in 10 mg/ml propidium iodide, 100 mg/ml RNase A and 0.05% Triton X-100 in PBS (pH 7.4), and finally stained with 20 mg/ml propidium iodide (PI; 300 ml) for 20 min. Samples were analyzed for DNA content by flow cytometry. The samples were assayed in triplicate, and the fraction of every cell cycle phase was calculated.

Statistical analysis was performed using the SPSS 13.0 package (SPSS, Chicago, IL, USA). The variables were shown as the mean ± standard deviation (SD). P<0.05 was considered to indicate a statistically significant difference.

First, we investigated whether the UTMD technique was suitable for the delivery of shRNA into cells. As shown in Fig. 1A, transfection efficiency was affected by transfection parameters, such as ultrasound intensity and exposure time. The optimal conditions of ultrasound exposure achieved the highest transfection efficiency (Fig. 1A-D). Moreover, our results showed that the appearance of DNA fragments was correlated with the transfection parameters (Fig. 1C). No significant effect was noted on the structure of vectors under suitable exposure conditions. The optimized parameters (1.0 W/cm² for 3 min with 20% DC pulse mode) were used in the subsequent UTMD-treated groups.

We examined whether delivery of survivin-shRNA by our UTMD system was capable of efficiently knocking down the expression of survivin. When shRNA expression vectors were introduced into HeLa cells, the results of RT-PCR showed that survivin mRNA expression was markedly knocked down, whereas the control or pSIREN/con groups did not have this effect (Fig. 2A and C). Furthermore, the expression levels of survivin mRNA declined markedly in the UTMD-treated groups as compared with the Lipofectamine- transfected groups (P<0.05 for all). Western blot analysis also revealed that the expression of survivin protein was further suppressed in the groups transfected with pSIREN/S1, pSIREN/S2 and pSIREN/S3 vectors (Fig. 2B and C). Transfection in the UTMD group was found to induce the greatest inhibition of survivin protein expression, as compared with the Lipofectamine-treated groups (P<0.05 for all).

To evaluate the effect of survivin depletion on the proliferation and apoptosis of HeLa cells in vitro, we used the flow cytometry assay to detect the effect of loss of survivin on cell apoptosis. The survivin shRNA construct-transfected HeLa cells showed a robust induction in cell apoptosis compared to the control (Fig. 3). Our data demonstrated that the apoptosis ratio in the pSIREN/S3+UTMD group (42.03±1.52%) was significantly higher than that of the pSIREN/S3+L group (31.46±2.78%) (Fig. 3A, P<0.05). To further determine the impact of survivin shRNA on cell growth, we detected the morphological changes in HeLa transfectants and the DNA ladder. The apoptotic cells in the pSIREN/S3+UTMD group presented typical morphological changes of cell apoptosis, such as cell shrinkage, round shape and bubbled cell membranes (Fig. 3B). Moreover, the apparent DNA ladder was detected in the pSIREN/S3+UTMD or pSIREN/S3+L groups, whereas there was no marked change in the control or non-specific vector groups (Fig. 3C).

Cell cycle distribution analysis by flow cytometry indicated that, as compared with the control group, there were marked changes in the P+L and P+UTMD groups; a number of cells were blocked in the G₀/G₁ phase (70.81±1.78 vs. 74.9±1.21 vs. 56.54±2.01%, P<0.01), reduced sharply in the G₂/M phase (6.11±0.67 vs. 5.20±1.71 vs. 19.89±1.77%, P<0.01) and S phase (23.08±1.29 vs. 19.89±1.11 vs. 23.56±1.99%, P<0.01), and an apoptosis peak was observed prior to the G₁ phase (Fig. 4A).