All animal experiments were conducted in accordance with the ‘Guide for the care and use of laboratory animals of the School of Medicine, Tsinghua University’ in Tsinghua University (Beijing, China). Wistar rats with a body weight of ~130 g were purchased from the Institute of Laboratory Animal Sciences, Chinese Academy of Medical Sciences (Beijing, China). This study was approved by the ethics committee of Tsinghua University (Beijing, China).

The Walker-256 tumor cells were obtained from the Institute of Materia Medica, Chinese Academy of Medical Sciences (Beijing, China). The rats were injected in the right flanks with 2×10⁶ Walker-256 tumor cells, obtained from an ascitic Walker-256 tumor-bearing rat. Following inoculation, the diameter of the tumors at 8 days ranged between 0.5 and 0.8 cm. Saline or 62.5 mg/ml magnetic nanoparticle fluid, with a volume at 50% of each tumor, was intratumorally injected, as described previously (13). Magnetic Fe₃O₄ nanoparticles with a mean diameter of 20 nm were prepared, as previously described (14). The rats were randomly allocated to 5 groups of 24 rats each, including rats injected with saline without magnetic field treatment (NS group), rats injected with magnetic nanoparticle fluid without magnetic field treatment (MF group) and rats injected with magnetic nanoparticle fluid with magnetic field treatment performed once (MFH1 group), twice (MFH2 group) or three times (MFH3 group). The animals were treated with an alternating current magnetic field at a frequency of 180 kHz, 55 GS for 30 min, and the temperatures inside the tumors were monitored with a temperature probe and manually adjusted to 50–55°C, similar to previously described (13). In the MFH2 and MFH3 groups, the subsequent treatment was performed 24 h after the previous treatment.

The size of the tumors was measured every 2 days with a caliper. The tumor volume was then calculated with the following formula: Tumor volume = 0.5 × (length × width²).

For the immunohistochemical staining, the tumors were resected and fixed in a 10% formalin solution 4 days after the hyperthermia treatment. The tumor tissues were sectioned to a 5-μm thickness and fixed to slides. The slides were deparaffinized and incubated with 10% normal serum for 30 min to block background staining. The slides were then incubated for 60 min at 37°C with a rabbit anti-VEGF polyclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) or a rabbit anti-cluster of differentiation (CD)34 polyclonal antibody (Boster Biological Technology, Ltd., Wuhan, China), and subsequently incubated with horseradish peroxidase-conjugated secondary antibodies. Each step was followed by washing with phosphate-buffered saline three times. Peroxidase activity was visualized by treatment with 0.02% diaminobenzidine tetrahydrochloride solution containing 0.005% hydrogen peroxide at room temperature for 5–10 min. The sections were also counterstained with hematoxylin and eosin. Iron in the magnetic nanoparticles was stained with prussian blue. Protein quantification was performed by Imagepro-plus 6.0 software (Media Cybernetics, Rockville, MD, USA), and the intensity values were normalized to the background.

Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA), as described by the manufacturer. mRNA was reverse transcribed with RevertAid (MBI Fermentas, Inc., Burlington, ON, Canada) at 42°C for 60 min, and the resulting cDNA was subjected to PCR (94°C for 1 min followed by 20–25 cycles at 94°C for 30 sec, 60°C for 30 sec, 68°C for 1 min and an extension for 10 min at 68°C). The PCR products were separated on 1.0% agarose gels and visualized with ethidium bromide. The forward (F) and reverse (R) primer pairs are listed (5′ to 3′) as follows: VEGF-F, CCTGGTGGACATCTTCCAGGAGTACC and VEGF-R, GAAGCTCATCTCTCCTATGTGCTGGC; Flt-1-F, CGGGATCCAAGGGACTCTACACTTGTC and Flt-1-R, GGAATTCCCGAATAGCGAGCAGATTT; Flk-1-F, CATTGTGTCCTGCATCCGGGATAACCT and Flk-1-R, TGTACACGATGCCATGCTCGTCACTGA; 18S-RNA-F, GCCCGAAGCGTTTACTTTGAA and 18S-RNA-R, GGTGAGGTTTCCCGTGTTGA. The quantification of gene expression was performed by Imagepro-plus 6.0 software, and the intensity values were normalized to 18S RNA.

All experiments were performed at least three times and the representative results are shown. Results are expressed as the mean ± standard deviation. The differences between groups were examined for statistical significance using Student’s t-test, except where indicated. Survival rate was assessed using the Kaplan-Meier method and log-rank test. P≤0.05 was considered to indicate a statistically significant difference.

First, the rat breast carcinoma models were established by inoculation of Walker-256 tumor cells in the right flanks of the rats. When the tumor reached 0.5–0.8 cm in diameter, hyperthermia treatment was performed by the intratumoral administration of MFH, and the temperature in the tumors were measured to determine whether a high temperature had been induced. Fig. 1 shows the mean temperature inside the tumor tissues after hyperthermia treatment, and the temperature inside the rectum as a control. The temperature inside the tumor tissues was increased to 52.5°C rapidly with the MFH treatment, and was maintained within ±2.5°C for the remainder of the treatment. In the controls, the rectal temperature remained normal following the alternating magnetic field treatment. These results indicate that a high temperature was induced successfully in the tumor tissues by MFH.

MFH has been reported to be feasible for tumor therapy in several cancer types (15–20). In the present study, following the induction of a high temperature in the tumor tissues, attention was paid to the effect of hyperthermia on tumor growth. As shown in Fig. 2, the treatment of tumors with MFH downregulated tumor growth. When compared with the rats injected with saline without the magnetic field treatment (NS group), the rats injected with the magnetic nanoparticle fluid without magnetic field treatment (MF group) had extremely similar tumor growth profiles. These results indicated that the magnetic nanoparticle fluid itself did not affect tumor growth. The rats injected with the magnetic nanoparticle fluid with the magnetic field treatment performed once (MFH1 group) had significantly reduced tumor growth compared with the rats in the NS or MF groups. The rats injected with the magnetic nanoparticle fluid with the magnetic field treatment performed twice (MFH2 group) or three times (MFH3 group) had dramatically reduced tumor growth. The inhibition of tumor growth induced by the MFH treatment lasted for ~2 weeks. The speed of the tumor growth in the MFH2 and MFH3 groups was gradually recovered to that of the NS or MF groups two weeks later.

As it was found that MFH treatment inhibited tumor growth in vivo, attention was paid to the effect of MFH on the survival rate of the tumor-bearing rats. The results in Fig. 3 show that consistent with the effect of the MFH treatment on tumor growth, the rats injected with the magnetic nanoparticle fluid with the magnetic field treatment performed twice (MFH2 group) or three times (MFH3 group) had a significantly increased survival rate compared with the rats injected with saline (NS group) or with the magnetic nanoparticle fluid without the magnetic field treatment (MF group) (P<0.05).

Hyperthermia has been reported to inhibit tumor growth by the downregulation of angiogenesis (11,12). To confirm whether angiogenesis was affected in the present rat breast carcinoma model, the VEGF protein in the tumor tissues 4 days after MFH treatment was detected by immunohistochemistry. As shown in Fig. 4A and B, the VEGF protein level in the MFH2 or MFH3 groups was significantly reduced by the MFH treatment compared with that in the NS or MF groups. These results indicate that hyperthermia treatment may affect angiogenesis by the downregulation of VEGF expression.

To further confirm the effect of the MFH treatment on VEGF expression, the gene expression of VEGF and its receptors, Flt-1 and Flk-1, was measured by RT-PCR, and 18S RNA was amplified as the internal control. As shown in Fig. 5A and B, the VEGF mRNA level in the MFH2 or MFH3 groups was significantly reduced by the MFH treatment compared with that in the NS or MF groups, which is consistent with the protein expression of VEGF affected by the MFH treatment. Similarly, the mRNA level of Flt-1 was significantly reduced in the MFH3 group (Fig. 5A and C), and the mRNA level of Flk-1 was slightly reduced in the MFH1 group and markedly downregulated in the MFH2 and MFH3 groups (Fig. 5A and D). These results also indicate that MFH treatment may inhibit angiogenesis by downregulation of VEGF and its receptors, Flt-1 and Flk-1.

CD34 has been reported to be a marker for microvessel density (21–22). Therefore, the microvessel density was detected using immunohistochemistry with the anti-CD34 antibody (Fig. 6), as described previously (23). As expected, the microvessel density in the MFH2 and MFH3 groups was significantly reduced by the MFH treatment compared with that in the NS and MF groups (Fig. 6). The microvessel density in the MFH1 group was not significantly different compared with that in the NS or MF groups (Fig. 6). These results further demonstrated that the MFH treatment with magnetic nanoparticles inhibited angiogenesis.