OL Oncology Letters 1792-1074 1792-1082 D.A. Spandidos 10.3892/ol.2015.3028 OL-0-0-3028 Articles Expression and clinical significance of the microRNA-200 family in gastric cancer CHANGLIANG1 * GUOFENGJIE2 * HUOBINGJIE1 LVYALEI1 WANGYUDONG1 LIUWEI1 Department of Medical Oncology, Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050000, P.R. China Tianjin Key Laboratory of Lung Cancer Metastasis and Tumor Microenvironment, Tianjin Lung Cancer Institute, Tianjin Medical University General Hospital, Tianjin 300000, P.R. China Correspondence to: Dr Liang Chang, Department of Medical Oncology, Fourth Hospital of Hebei Medical University, 12 Jiankang Road, Shijiazhuang, Hebei 050000, P.R. China, E-mail: changliang1081@163.com

Contributed equally

 2015-05-01 2015-03-11 9 5 2317 2324 07062014 10022015 Copyright © 2015, Spandidos Publications 2015

Gastric cancer is one of the most common malignant tumors and one of the leading causes of cancer-related mortality. Recent studies have revealed that there is a difference in microRNA (miR/miRNA) profiles between cancerous and normal tissues. To find a potentially useful prognostic predictor and a promising therapeutic tool for gastric cancer, the present study investigated the expression and clinical significance of the miR-200 family in gastric cancer. The miR-200 family has five members: hsa-miR-200a, hsa-miR-200b, hsa-miR-200c, hsa-miR-141 and hsa-miR-429. In 46 clinical samples of gastric cancer and paired non-cancerous tissues, the present study observed that the expression levels of the miR-200 family in the cancer tissues were significantly lower than those in the non-cancerous tissues (P<0.001). Lower levels of the five family members were associated with histological grade and the presence of an intravascular cancer embolus (P<0.05). The results revealed that the miR-200 family is downregulated in gastric cancer, and that there are significant differences in the expression of the miR-200 family between normal and cancer tissues. The miR-200 family may therefore become a potentially useful prognostic predictor of the aggressiveness of gastric cancer and a possible therapeutic tool in affected patients.

 microRNA-200 family gastric cancer histological grade intravascular cancer embolus Introduction

Gastric cancer is one of the most common malignant tumors and one of the primary causes of cancer-related mortality in China. This is mainly a result of patients being diagnosed late and the consequently low surgical resection rate (1–3). An improved understanding of the pathogenesis and pathological characteristics of gastric cancer will provide a novel method to ensure an early diagnosis and treatment.

microRNAs (miR/miRNAs) are a class of small and highly conserved non-coding RNA, which regulate gene expression by binding to the 3′ untranslated region (3′UTR) of target mRNAs. Growing evidence indicates that miRNAs play a key role in cancer development, differentiation and progression, acting as tumor oncogenes or suppressors (4–6). Notably, miR-200 family is downregulated in certain types of cancer, such as hepatocellular carcinoma and renal cell carcinoma, while being overexpressed in others, including melanoma, and ovarian and bladder cancer (7–9).

In the present study, in order to identify the changes in expression of miR-200 in normal and cancer tissues, the expression of the miR-200 family was examined in cancerous and paired non-cancerous tissues by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and the distinguishing characteristics of the five members of the miR-200 family were analyzed. Positive results from this study may serve as the foundation for a novel prognostic predictor of grading and a possible therapeutic tool for gastric cancer.

 Materials and methods <sec> <title>Human tissue samples

A total of 46 fresh tissue samples, consisting of gastric cancer tissues and paired normal tissues (5 cm away from the tumor), were obtained from surgical resection specimens collected by the Fourth Hospital of Hebei Medical University (Shijiazhuang, Hebei, China) between 2010 and 2011. The tissues were collected and used after obtaining informed consent from the patients. All tissue samples were immediately cut and snap frozen in liquid nitrogen until RNA extraction. Histological typing of the tumor and paired non-cancerous tissues was pathologically confirmed. This study was approved by the ethics committee of the Fourth Hospital of Hebei Medical University.

 RT-qPCR

Total RNA, including miRNA, was extracted from the tissues using the miRNeasy Mini kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. Total RNA was subsequently reverse transcribed to cDNA with the stem-loop reverse transcription primer (Beijing Genomics Institute, Beijing, China) for miRNA detection. The U6 small nuclear RNA (Beijing Genomics Institute) was used as an internal control for the miRNA. All primer sequences are listed in Table I. RT-qPCR was carried out using SYBR® Premix Ex Taq™ (Takara Biotechnology, Co., Ltd., Dalian, China). The reactions were placed in a 96-well plate (Applied Biosystems Life Technologies, Foster City, CA, USA) using a preheated real-time instrument (ABI 7500HT; Applied Biosystems Life Technologies). The relative levels of expression were quantified and analyzed using Bio-Rad iCycler iQ software (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Ct values were used to calculate the RNA expression levels. The amount of target gene expression (2−∆∆Ct) was normalized using the endogenous U6 reference.

 Statistical analysis

Data are presented as the median ± standard deviation, unless otherwise stated. All statistical tests were two-sided, and a value of P<0.05 was considered to indicate a statistically significant difference. Student's t-test and a one-way analysis of variance (ANOVA) were employed to analyze the differences among groups and comparisons between two groups using Statistical Analysis System V8 software (SAS Institute Inc., Cary, NC, USA).

 Results <sec> <title>Expression of the miR-200 family in gastric cancer tissues

To investigate the role of the miR-200 family in gastric cancer, the expression of the miR-200 family in 46 cancerous and paired non-cancerous tissues were detected by RT-qPCR. Through the analysis of data, the results showed that all five members of the miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) exhibited significantly lower expression levels in the cancerous tissues compared with the corresponding normal tissues (Fig. 1; P<0.05). It was observed that the difference in miR-200c and miR-141 expression between the cancerous and normal tissues was similar.

 Correlation with histoclinical data

To determine whether the downregulation of the expression of the miR-200 family in gastric cancer tissues was correlated with clinicopathological characteristics, an ANOVA was performed. The median of the relative expression values and the clinicopathological factors are presented in Tables II–VI. The statistical analysis showed that the expression levels of the five family members were associated with histological grade and the presence of an intravascular cancer embolus (P<0.05). The expression level of the family was downregulated in G3 grade gastric cancer compared with G2 grade. In the gastric cancer tissues, the expression level of the miR-200 family was decreased when an intravascular cancer embolus was present. However, no association was observed with regard to gender, age, tumor size, invasive depth, lymph node metastasis, tumor-node-metastasis stage and Borrmann type.

 Discussion

Numerous miRNAs have been suggested to play vital roles in gastric cancer development and progression, functioning in a either a cooperative manner or alone (10–12). An independent study by Kogo et al reported that miR-146a levels were dramatically decreased in gastric cancer, and more importantly, lower levels of miR-146a were associated with lymph node metastasis and venous invasion (13). The expression of let-7f has also been proven to be decreased in metastatic gastric cancer tissues, while let-7f overexpression in gastric cancer was able to inhibit the invasion and migration of gastric cancer cells (14). Another study demonstrated the significant downregulation of miR-148b in 106 gastric cancer tissues and the consequent suppression of gastric cancer cell growth, suggesting that miR-148b could become a potential biomarker and therapeutic target against gastric cancer (15).

The five members of the miR-200 family share similar seed sequences, and are located in two distinct genomic clusters. The miR-200a-200b-429 cluster is located on chromosome 1 and the miR-200c-141 cluster is located on chromosome 12. The expression level of the miR-200 family is commonly altered in various biological and pathological processes (16–19). Notably, the expression of the miR-200 family can be downregulated or upregulated in different types of cancers, and the tissue of origin may account for this. One study clearly showed that the expression of miRNA-141 and miRNA-200c was significantly decreased in renal cell carcinoma samples (20). However, a number of studies have shown that the miR-200 family is overexpressed in bladder, ovarian and cervical cancer. Together, these data suggest that the miR-200 family may play multiple roles in potentially regulating tumor initiation and progression (21,22).

In the present study, the expression and clinical significance of the miR-200 family in gastric cancer was analyzed using a standardized qPCR approach. The results highlight the significance of the miR-200 family as a promising tumor suppressor in gastric cancer. It was shown that the miR-200 family is frequently downregulated in gastric cancer tissues compared with matched non-cancerous tissues. Furthermore, low miR-200 family expression levels were also shown to correlate with histological grade and the presence of an intravascular cancer embolus.

In summary, the present comprehensive analysis showed that the expression of the miR-200 family has a correlation with the development of gastric cancer. Additionally, we found that lower levels of the five family menbers of the miR-200 family were associated with the clinical significance of gastric cancer. These results suggest that the miR-200 family can serve as a new prognostic predictor of the aggressiveness of gastric cancer and as a possible therapeutic tool for affected patients.

 Acknowledgements

The present study was supported by a grant from the National Natural Science Foundation of China (no. 81172333).

 References NobiliSBrunoLLandiniIGenomic and genetic alterations influence the progression of gastric cancerWorld J Gastroenterol17290299201110.3748/wjg.v17.i3.29021253387 TsengCWLinCCChenCNIntegrative network analysis reveals activemicroRNAs and their functions in gastric cancerBMC Syst Biol599201110.1186/1752-0509-5-9921703006 GuoSLPengZYangXmiR-148a promoted cell proliferation by targeting p27 in gastric cancer cellsInt J Biol Sci7567574201110.7150/ijbs.7.56721552422 Bou KheirTFutoma-KazmierczakEJacobsenAmiR-449 inhibits cellproliferation and is down-regulated in gastric cancerMol Cancer1029201110.1186/1476-4598-10-2921418558 HuXSchwarzJKLewisJSJrA microRNA expression signature for cervical cancer prognosisCancer Res7014411448201010.1158/0008-5472.CAN-09-328920124485 DontuGde RinaldisEMicroRNAs: shortcuts in dealing with molecular complexity?Breast Cancer Res12301201010.1186/bcr245520122290 Elson-SchwabILorentzenAMarshallCJMicroRNA-200 family members differentially regulate morphologicalplasticity and mode of melanoma cell invasionPLoS One5e13176201010.1371/journal.pone.001317620957176 NamEJYoonHKimSWMicroRNA expression profiles in serous ovarian carcinomaClin Cancer Res1426902695200810.1158/1078-0432.CCR-07-173118451233 HanYChenJZhaoXMicroRNA expression signatures of bladder cancer revealed by deep sequencingPloS One6e18286201110.1371/journal.pone.001828621464941 ParkNJZhouHElashoffDSalivary microRNA: discovery, characterization and clinical utility for oral cancer detectionClin Cancer Res1554735477200910.1158/1078-0432.CCR-09-073619706812 CarlssonJDavidssonSHeleniusGA miRNA expression signature that separates betweennormal and malignant prostate tissuesCancer Cell Int1114201110.1186/1475-2867-11-1421619623 BonnetETatariMJoshiAModule network inference from a cancer gene expression data set identifies microRNA regulated modulesPloS One5e10162201010.1371/journal.pone.001016220418949 KogoRMimoriKTanakaFClinical significance of miR-146a in gastric cancer casesClin Cancer Res1742774284201110.1158/1078-0432.CCR-10-286621632853 LiangSHeLZhaoXMicroRNA let-7f inhibits tumorinvasion and metastasis by targeting MYH9 in human gastric cancerPloS One6e18409201110.1371/journal.pone.001840921533124 SongYXYueZYWangZNMicroRNA-148b is frequently down-regulated in gastriccancer and acts as a tumor suppressor by inhibiting cell proliferationMol Cancer101201110.1186/1476-4598-10-121205300 BrackenCPGregoryPAKolesnikoffNA double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transitionCancer Res6878467854200810.1158/0008-5472.CAN-08-194218829540 SaydamOShenYWürdingerTDownregulated microRNA-200a in meningiomas promotes tumor growth by reducing E-cadherin and activating the Wnt/β-catenin signaling pathwayMol Cell Biol2959235940200910.1128/MCB.00332-0919703993 ShimonoYZabalaMChoRWDownregulation of miRNA-200c links breast cancer stem cells with normal stem cellsCell138592603200910.1016/j.cell.2009.07.01119665978 MurakamiYToyodaHTanakaMThe progression of liver fibrosis is related with overexpression of the miR-199 and 200 familiesPloS One6e16081201110.1371/journal.pone.001608121283674 SlabyOJancovicovaJLakomyRExpression of miRNA-106b in conventional renal cell carcinoma is a potential marker for prediction of early metastasis after nephrectomyJ Exp Clin Cancer Res2990201010.1186/1756-9966-29-10520609231 LinZWangXFewellCCameronJDifferential expression of the miR-200 family microRNAs inepithelial and Bcells and regulation of Epstein-Barr virus reactivation by the miR-200 family member miR-429J Virol8478927897201010.1128/JVI.00379-1020484493 ChoiPSZakharyLChoiWYMembers of the miRNA-200 family regulate olfactory neurogenesisNeuron574155200810.1016/j.neuron.2007.11.01818184563

Expression of the miR-200 family in gastric cancer tissues. The expression of the miR-200 family in 46 cancerous (T) and paired non-cancerous (N) tissues were detected by reverse transcription-quantitative polymerase chain reaction. The expression level of the five family members in the cancerous tissues was significantly downregulated compared with the normal tissues (P<0.05). miR/miRNA, microRNA.

Primer sequences for RT and qPCR

Gene Primer Sequence (5′-3′)
miR-200a RT 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATCGT-
qPCR-F GGCCCGTAACACTGTCTGGTAA
miR-200b RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCATCAT
qPCR-F GCCGCTTTAATACTGCCTGGTA
miR-200c RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCATCA
qPCR-F GCCGATTTAATACTGCCGGGT
miR-141 RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCATCTT
qPCR-F GCCGCTAACACTGTCTGGTAAA
miR-429 RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACGGTTT
qPCR-F GCCGATTAATACTGTCTGGTAA
U6 RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAACTGC
qPCR-F GGGTGCTCGCTTCGGCAGC
Common qPCR-R CAGTGCAGGGTCCGAGGT

All primers were obtained from the Beijing Genomics Institute (Beijing, China). RT, reverse transcription; qPCR, quantitative polymerase chain reaction; miR, microRNA; F, forward; R, reverse.

Expression of miRNA-200a and the correlation with the clinicopathological parameters of gastric cancer.

Clinicopathological parameters n miRNA-200a, median (range) P-value
Gender 0.1631
  Male 35 0.071 (0.001–1.635)
  Female 11 0.174 (0.011–1.974)
Age, years 0.6367
  ≥60 19 0.157 (0.001–1.635)
  <60 27 0.065 (0.003–1.974)
Tumor size, cm 0.8354
  ≤5 22 0.165 (0.003–1.635)
  >5 24 0.033 (0.001–1.974)
Invasive depth 0.5514
  T1+T2+T3 13 0.172 (0.001–0.796)
  T4 33 0.065 (0.003–1.974)
Lymph node metastasis 0.1678
  N0 11 0.157 (0.001–1.635)
  N1 9 0.016 (0.007–0.249)
  N2 10 0.098 (0.016–0.857)
  N3 16 0.367 (0.011–1.974)
TNM stage 0.9806
  I 3 0.486 (0.001–0.796)
  II 11 0.157 (0.003–1.635)
  III 31 0.071 (0.011–1.974)
  IV 1 0.353
Histological grade 0.0135
  G2 24 0.220 (0.013–1.974)
  G3 22 0.054 (0.001–0.796)
Intravascular cancer embolus 0.0004
  Negative 33 0.801 (0.011–1.974)
  Positive 13 0.065 (0.001–0.796)
Lauren type 0.3632
  Intestinal 16 0.020 (0.001–1.635)
  Diffuse 14 0.094 (0.003–1.974)
  Mixed 7 0.481 (0.101–0.965)
  Undetermined 9 0.073 (0.013–0.702)
Borrmann type 0.9231
  I 3 0.101 (0.003–0.796)
  II 12 0.123 (0.007–0.825)
  III 27 0.071 (0.001–1.974)
  IV 4 0.247 (0.016–0.965)

TNM, tumor-node-metastasis.

Expression of miRNA-200b and the correlation with the clinicopathological parameters of gastric cancer.

Clinicopathological parameters n miRNA-200b, median (range) P-value
Gender 0.4103
  Male 35 0.054 (0.001–1.550)
  Female 11 0.161 (0.014–1.300)
Age, years 0.9843
  ≥60 19 0.140 (0.001–1.550)
  <60 27 0.061 (0.003–1.471)
Tumor size, cm 0.4119
  ≤5 22 0.160 (0.003–1.550)
  >5 24 0.041 (0.001–1.300)
Invasive depth 0.8398
  T1+T2+T3 13 0.166 (0.001–0.799)
  T4 33 0.046 (0.003–1.550)
Lymph node metastasis 0.1423
  N0 11 0.140 (0.001–1.550)
  N1 9 0.022 (0.003–0.210)
  N2 10 0.113 (0.016–0.630)
  N3 16 0.218 (0.013–1.300)
TNM stage 0.7918
  I 3 0.590 (0.001–0.799)
  II 11 0.140 (0.003–1.550)
  III 31 0.054 (0.013–1.300)
  IV 1 0.342
Histological grade 0.0209
  G2 24 0.204 (0.004–1.550)
  G3 22 0.042 (0.001–0.799)
Intravascular cancer embolus 0.0013
  Negative 33 0.504 (0.018–1.550)
  Positive 13 0.046 (0.001–0.799)
Lauren type 0.7097
  Intestinal 16 0.026 (0.001–1.550)
  Diffuse 14 0.133 (0.003–1.300)
  Mixed 7 0.504 (0.054–0.704)
  Undetermined 9 0.061 (0.013–0.590)
Borrmann type 0.9992
  I 3 0.054 (0.003–0.799)
  II 12 0.111 (0.003–1.471)
  III 27 0.099 (0.001–1.550)
  IV 4 0.283 (0.015–0.704)

TNM, tumor-node-metastasis.

Expression of miRNA-200b and the correlation with the clinicopathological parameters of gastric cancer.

Clinicopathological parameters n miRNA-200c, median (range) P-value
Gender 0.5526
  Male 35 0.059 (0.001–0.739)
  Female 11 0.068 (0.004–0.685)
Age, years 0.5040
  ≥60 19 0.071 (0.001–0.560)
  <60 27 0.059 (0.003–0.739)
Tumor size, cm 0.9137
  ≤5 22 0.076 (0.003–0.739)
  >5 24 0.040 (0.001–0.685)
Invasive depth 0.7276
  T1+T2+T3 13 0.084 (0.001–0.341)
  T4 33 0.019 (0.003–0.739)
Lymph node metastasis 0.2434
  N0 11 0.059 (0.001–0.739)
  N1 9 0.009 (0.005–0.108)
  N2 10 0.157 (0.005–0.338)
  N3 16 0.102 (0.004–0.685)
TNM stage 0.9147
  I 3 0.068 (0.001–0.310)
  II 11 0.059 (0.003–0.739)
  III 31 0.019 (0.004–0.685)
  IV 1 0.247
Histological grade 0.0479
  G2 24 0.135 (0.006–0.739)
  G3 22 0.020 (0.001–0.354)
Intravascular cancer embolus 0.0069
  Negative 33 0.184 (0.006–0.739)
  Positive 13 0.021 (0.001–0.354)
Lauren type 0.8673
  Intestinal 16 0.009 (0.001–0.739)
  Diffuse 14 0.084 (0.003–0.685)
  Mixed 7 0.184 (0.071–0.354)
  Undetermined 9 0.164 (0.009–0.327)
Borrmann type 0.7826
  I 3 0.068 (0.003–0.071)
  II 12 0.124 (0.005–0.739)
  III 27 0.019 (0.001–0.685)
  IV 4 0.098 (0.009–0.354)

TNM, tumor-node-metastasis.

Expressions of miRNA-141 and the correlation with the clinicopathological parameters of gastric cancer.

Clinicopathological parameters n miRNA-141, median (range) P-value
Gender 0.1709
  Male 35 0.038 (0.0004–0.644)
  Female 11 0.101 (0.001–1.050)
Age, years 0.3072
  ≥60 19 0.098 (0.0004–0.475)
  <60 27 0.038 (0.001–1.050)
Tumor size, cm 0.9171
  ≤5 22 0.101 (0.001–0.644)
  >5 24 0.026 (0.0004–1.050)
Invasive depth 0.7717
  T1+T2+T3 13 0.119 (0.0004–0.415)
  T4 33 0.015 (0.001–1.050)
Lymph node metastasis 0.2789
  N0 11 0.037 (0.0004–0.644)
  N1 9 0.005 (0.003–0.143)
  N2 10 0.143 (0.002–0.371)
  N3 16 0.112 (0.001–1.050)
TNM stage 0.9970
  I 3 0.127 (0.0004–0.242)
  II 11 0.037 (0.002–0.644)
  III 31 0.038 (0.002–1.050)
  IV 1 0.167
Histological grade 0.0255
  G2 24 0.130 (0.003–1.050)
  G3 22 0.014 (0.0004–0.371)
Intravascular cancer embolus 0.0030
  Negative 33 0.181 (0.003–1.050)
  Positive 13 0.019 (0.0004–0.412)
Lauren type 0.6016
  Intestinal 16 0.005 (0.0004–0.644)
  Diffuse 14 0.078 (0.002–1.050)
  Mixed 7 0.171 (0.098–0.244)
  Undetermined 9 0.138 (0.005–0.242)
Borrmann type 0.8988
  I 3 0.098 (0.002–0.127)
  II 12 0.119 (0.003–0.644)
  III 27 0.019 (0.0004–1.050)
  IV 4 0.088 (0.003–0.211)

TNM, tumor-node-metastasis.

Expressions of miRNA-429 and the correlation with the clinicopathological parameters of gastric cancer.

Clinicopathological parameters n miRNA-429, median (range) P-value
Gender 0.4166
  Male 35 0.080 (0.001–1.962)
  Female 11 0.194 (0.009–1.720)
Age, years 0.5590
  ≥60 19 0.143 (0.001–1.962)
  <60 27 0.093 (0.002–1.738)
Tumor size, cm 0.7291
  ≤5 22 0.173 (0.002–1.962)
  >5 24 0.051 (0.001–1.720)
Invasive depth 0.5014
  T1+T2+T3 13 0.191 (0.001–1.245)
  T4 33 0.072 (0.002–1.962)
Lymph node metastasis 0.2178
  N0 11 0.143 (0.001–1.962)
  N1 9 0.021 (0.008–0.194)
  N2 10 0.123 (0.008–1.377)
  N3 16 0.259 (0.014–1.720)
TNM stage 0.8561
  I 3 0.681 (0.001–1.245)
  II 11 0.143 (0.002–1.962
  III 31 0.080 (0.008–1.720)
  IV 1 0.398
Histological grade 0.0105
  G2 24 0.225 (0.005–1.962)
  G3 22 0.058 (0.001–1.245)
Intravascular cancer embolus <0.0001
  Negative 33 1.226 (0.015–1.962)
  Positive 13 0.072 (0.001–1.245)
Lauren type 0.2606
  Intestinal 16 0.030 (0.001–1.962)
  Diffuse 14 0.130 (0.002–1.720)
  Mixed 7 0.593 (0.080–1.377)
  Undetermined 9 0.093 (0.010–0.681)
Borrmann type 0.9877
  I 3 0.080 (0.002–1.245)
  II 12 0.144 (0.008–1.738)
  III 27 0.107 (0.001–1.962)
  IV 4 0.150 (0.010–1.337)

TNM, tumor-node-metastasis.