<?xml version="1.0" encoding="utf-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "journalpublishing3.dtd">
<article xml:lang="en" article-type="research-article" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">OR</journal-id>
<journal-title-group>
<journal-title>Oncology Reports</journal-title></journal-title-group>
<issn pub-type="ppub">1021-335X</issn>
<issn pub-type="epub">1791-2431</issn>
<publisher>
<publisher-name>D.A. Spandidos</publisher-name></publisher></journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3892/or.2011.1617</article-id>
<article-id pub-id-type="publisher-id">or-27-04-1266</article-id>
<article-categories>
<subj-group>
<subject>Articles</subject></subj-group></article-categories>
<title-group>
<article-title>CDK10 functions as a tumor suppressor gene and regulates survivability of biliary tract cancer cells</article-title></title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>YU</surname><given-names>JIAN-HUA</given-names></name><xref rid="af1-or-27-04-1266" ref-type="aff">1</xref></contrib>
<contrib contrib-type="author">
<name><surname>ZHONG</surname><given-names>XIANG-YU</given-names></name><xref rid="af1-or-27-04-1266" ref-type="aff">1</xref></contrib>
<contrib contrib-type="author">
<name><surname>ZHANG</surname><given-names>WEI-GUANG</given-names></name><xref rid="af2-or-27-04-1266" ref-type="aff">2</xref></contrib>
<contrib contrib-type="author">
<name><surname>WANG</surname><given-names>ZHI-DONG</given-names></name><xref rid="af1-or-27-04-1266" ref-type="aff">1</xref></contrib>
<contrib contrib-type="author">
<name><surname>DONG</surname><given-names>QIN</given-names></name><xref rid="af2-or-27-04-1266" ref-type="aff">2</xref></contrib>
<contrib contrib-type="author">
<name><surname>TAI</surname><given-names>SHENG</given-names></name><xref rid="af1-or-27-04-1266" ref-type="aff">1</xref></contrib>
<contrib contrib-type="author">
<name><surname>LI</surname><given-names>HUI</given-names></name><xref rid="af2-or-27-04-1266" ref-type="aff">2</xref></contrib>
<contrib contrib-type="author">
<name><surname>CUI</surname><given-names>YUN-FU</given-names></name><xref rid="af1-or-27-04-1266" ref-type="aff">1</xref><xref ref-type="corresp" rid="c1-or-27-04-1266"/></contrib></contrib-group>
<aff id="af1-or-27-04-1266">
<label>1</label>Department of Hepatopancreatobiliary Surgery, Second Affiliated Hospital of Harbin Medical University, Harbin 150086</aff>
<aff id="af2-or-27-04-1266">
<label>2</label>Department of Biochemistry and Molecular Biology, Basic Medical Science College, Harbin Medical University, Harbin 150081, P.R. China</aff>
<author-notes>
<corresp id="c1-or-27-04-1266"><italic>Correspondence to:</italic> Dr Yun-Fu Cui, Department of Hepatopancreatobiliary Surgery, Second Affiliated Hospital of Harbin Medical University, 157 Baojian Road, Harbin 150086, P.R. China, E-mail: <email>yfcui777@hotmail.com</email></corresp></author-notes>
<pub-date pub-type="collection">
<month>4</month>
<year>2012</year></pub-date>
<pub-date pub-type="epub">
<day>30</day>
<month>12</month>
<year>2011</year></pub-date>
<pub-date pub-type="ppub">
<month>4</month>
<year>2012</year></pub-date>
<volume>27</volume>
<issue>4</issue>
<fpage>1266</fpage>
<lpage>1276</lpage>
<history>
<date date-type="received">
<day>09</day>
<month>11</month>
<year>2011</year></date>
<date date-type="accepted">
<day>14</day>
<month>12</month>
<year>2011</year></date></history>
<permissions>
<copyright-statement>Copyright &#x000A9; 2012, Spandidos Publications</copyright-statement>
<copyright-year>2012</copyright-year></permissions>
<abstract>
<p>Cyclin-dependent kinase 10 (CDK10) is a member of the Cdc2 family of kinases, and has been demonstrated to be an important determinant of resistance to endocrine therapy for breast cancer. To investigate the expression and possible function of CDK10 in biliary tract cancer (BTC), we systematically examined CDK10 in tissues and cell lines. We found that expression of CDK10 was downregulated in both biliary tract tumors and cell lines. Remarkably, the expression of CDK10 correlated with clinical characteristics. Overexpression or knockdown of CDK10, respectively, inhibited or promoted cell proliferation, colony formation and migration. This suggests that CDK10 functions as a tumor suppressor gene in BTC. Overexpression of CDK10 caused malignant cells to become sensitive to chemotherapy and other hostile environments, suggesting that CDK10 functions to regulate survivability of BTC cells. We investigated the expression of six genes to resolve the mechanism. c-RAF was negatively regulated by CDK10 in both cells and specimens. Our results indicate that CDK10 plays a crucial role in the growth and survivability of biliary tract cancer, and offers a potential therapeutic target for this fatal disease.</p></abstract>
<kwd-group>
<kwd>CDK10</kwd>
<kwd>biliary tract cancers</kwd>
<kwd>chemotherapy</kwd>
<kwd>c-RAF</kwd>
<kwd>cholangiocarcinoma</kwd></kwd-group></article-meta></front>
<body>
<sec sec-type="intro">
<title>Introduction</title>
<p>Biliary tract cancer (BTC) arises from the ductal epithelium of the biliary tree, and is the second most common primary hepatobiliary malignancy (<xref rid="b1-or-27-04-1266" ref-type="bibr">1</xref>), with a rising incidence and a dismal prognosis (<xref rid="b1-or-27-04-1266" ref-type="bibr">1</xref>&#x02013;<xref rid="b3-or-27-04-1266" ref-type="bibr">3</xref>). This fatal disease has traditionally been divided into cholangiocarcinoma (CCA) and gallbladder cancer (GBC), which have similar pathogenesis and clinical characteristics (<xref rid="b1-or-27-04-1266" ref-type="bibr">1</xref>). Furthermore, CCA can be classified into intrahepatic cholangiocarcinoma (ICC) and extrahepatic cholangiocarcinoma (ECC) according to the site of the tumor (<xref rid="b1-or-27-04-1266" ref-type="bibr">1</xref>,<xref rid="b4-or-27-04-1266" ref-type="bibr">4</xref>). ECC is divided into perihilar cholangiocarcinoma (PCC) and distal extrahepatic cholangiocarcinoma (DECC) (<xref rid="b1-or-27-04-1266" ref-type="bibr">1</xref>). The most effective treatment for BTC is surgical resection (<xref rid="b5-or-27-04-1266" ref-type="bibr">5</xref>); however, the disease is still fatal because patients are always diagnosed at advanced stages (<xref rid="b6-or-27-04-1266" ref-type="bibr">6</xref>). Except surgery, both chemotherapy and radiation are used as adjuvant therapy, but the effect is still far from satisfactory (<xref rid="b1-or-27-04-1266" ref-type="bibr">1</xref>,<xref rid="b5-or-27-04-1266" ref-type="bibr">5</xref>). Finding effective biomarkers for earlier diagnosis, and clarifying the molecular mechanisms associated with pathogenesis and chemotherapy resistance are required to improve prognosis (<xref rid="b5-or-27-04-1266" ref-type="bibr">5</xref>,<xref rid="b7-or-27-04-1266" ref-type="bibr">7</xref>).</p>
<p>Cyclin-dependent kinase 10 (CDK10) is a member of the Cdc2 family of kinases and plays a role in the cell cycle (<xref rid="b8-or-27-04-1266" ref-type="bibr">8</xref>). Similar to other CDKs, CDK10 contains tyrosine and threonine sites in the ATP binding domain and the phosphorylation status of these sites is crucial for determining its activity (<xref rid="b9-or-27-04-1266" ref-type="bibr">9</xref>). Although the cyclin partner of CDK10 has not been identified, CDK10 associations have been described that play an important role in its function in the cell (<xref rid="b9-or-27-04-1266" ref-type="bibr">9</xref>,<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). CDK10 has been reported as the regulator of the Ets2 transcription factor and modulates its transactivation activity (<xref rid="b9-or-27-04-1266" ref-type="bibr">9</xref>). In addition, the CDK10/Ets2/c-RAF signaling has been demonstrated as an important determinant of resistance to endocrine therapy for breast cancer (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). Recent studies have shown that CDK10 is a potential tumor suppressor not only in breast cancer, but also in other tumors, such as seminoma (<xref rid="b11-or-27-04-1266" ref-type="bibr">11</xref>).</p>
<p>The Raf/MEK/MAPK cascade is a crucial signaling pathway for the development of CCA (<xref rid="b12-or-27-04-1266" ref-type="bibr">12</xref>). This signaling pathway is regulated by CDK10 in breast cancer (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). In CCA and GBC, deletion or loss of heterozygosity (LOH) has been frequently detected for several regions of the long arm of chromosome 16 (<xref rid="b13-or-27-04-1266" ref-type="bibr">13</xref>,<xref rid="b14-or-27-04-1266" ref-type="bibr">14</xref>), where CDK10 is located (<xref rid="b15-or-27-04-1266" ref-type="bibr">15</xref>).</p>
<p>In this study, we proposed that CDK10 may be a candidate tumor suppressor gene for BTC, including CCA and GBC. To support our proposals, we systematically examined the expression of CDK10 in human tumor tissue and cell lines. The impact of CDK10 expression on BTC cell biology and survivability was also evaluated by either overexpression or RNAi methods to confirm our hypothesis.</p></sec>
<sec sec-type="methods">
<title>Materials and methods</title>
<sec>
<title>Cell culture</title>
<p>HCCC-9180, SSP25 and RBE cholangiocarcinoma cell lines and the GBC-SD gallbladder cancer line were obtained from the Chinese Academy of Sciences Shanghai Branch Cell Bank (Shanghai, China). HCCC-9180, SSP25 and RBE cell lines were cultured in RPMI-1640 medium with 10&#x00025; fetal bovine serum (FBS), 100 IU/ml penicillin and 100 &#x003BC;g/ml streptomycin. GBC-SD cells were maintained in RPMI-1640 medium with 20&#x00025; FBS and antibiotics. Human intrahepatic biliary epithelial cells (BECs) and epithelial cell medium were purchased from ScienCell Research Laboratories (San Diego, CA, USA). BECs were cultured in complete medium containing 10&#x00025; FBS and antibiotics. In this study, BECs were employed as the control cells for normal biliary epithelial cells.</p></sec>
<sec>
<title>Plasmids, siRNA and transfection</title>
<p>To increase the expression of CDK10 in cell lines, pCMV6-Entry-CDK10 vector was purchased from OriGene (Rockville, MD, USA), and the ORF (open reading frame) of CDK10 was inserted into the vector. At 80&#x02013;90&#x00025; confluence, cells were transfected with pCMV6-Entry-CDK10 or empty vectors using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). To obtain stable transfectants, the cells were transfected in accordance with the aforementioned criteria. Forty-eight hours post-transfection, the cells were switched to the medium containing G418 (600 &#x003BC;g/ml), and the medium containing G418 was replaced every 3&#x02013;4 days. After 2 weeks, isolated colonies began to appear. In 3 weeks, we selected stable transfectants expressing CDK10 for further study. The control clones expressing empty vector (Mock) were isolated at the same time.</p>
<p>Three siRNAs targeting CDK10 were obtained from RiboBio (Guangzhou, China) and sequences were 5&#x02032;-CUGC ACAGGAACUUCAUUA-3&#x02032; (si-1), 5&#x02032;-GCUCCUAUUUCA AGGAGAA-3&#x02032; (si-2), 5&#x02032;-CCAGCCUCCUGGAGAAUAU-3&#x02032; (si-3), respectively. The control siRNA was also obtained from RiboBio. Twenty-four hours prior to transfection, cells were plated onto a 35-mm dish at 50&#x02013;60&#x00025; confluence. Transfection was performed with Lipofectamine 2000 according to the manufacturer&#x02019;s protocol. The transfected cells were resuspended and cultured in regular culture medium for 48&#x02013;72 h before analysis.</p></sec>
<sec>
<title>Clinical tissue samples</title>
<p>Tissue samples were obtained from 65 patients at the Second Affiliated Hospital of Harbin Medical University from January 2007 to March 2011. Informed consent was obtained from patients and the tissue acquisition protocol was approved by the Harbin Medical University Institutional Review Board. There were 47 samples of tumor tissues (including ICC, PCC, DECC, GBC and metastasis), and 18 samples from normal bile ducts or gallbladder. Normal specimens were obtained from patients undergoing pancreatoduodenectomy because of pancreatic or duodenal diseases and whose bile ducts were disease-free. Tumor samples were obtained from CCA or GBC patients undergoing cancer-related surgery. The clinical characteristics of the patients were collected, including tumor location, histological type, differentiation grade, lymph node invasion, TNM staging and 1-year survival. Fresh tissue was frozen in liquid nitrogen and used for RNA and protein extraction.</p></sec>
<sec>
<title>RNA extraction and quantitative real-time PCR</title>
<p>Total RNA was isolated from tissue samples or cells using TRIzol (Invitrogen Life Technologies) and total RNA was reverse transcribed to cDNA, using the PrimeScript Reagent kit (Takara, Tokyo, Japan) according to the manufacturer&#x02019;s instructions. Quantitative real-time PCR was performed with a SYBR-Green kit (Takara) using the ABI 7500 Real-time PCR system (Applied Biosystems, Foster City, CA, USA). Specific primers were designed for CDK10, c-RAF, TP53 (p53), BID, ABCC2, ABCB1 and ABCB11 (<xref rid="tI-or-27-04-1266" ref-type="table">Table I</xref>). Human &#x003B2;-actin was used as an endogenous control. The PCR procedures were performed according to the manufacturer&#x02019;s instructions. All assays were performed at least three times. The relative expression levels were then determined by using the 2<sup>&#x02212;&#x00394;&#x00394;Ct</sup> method (<xref rid="b16-or-27-04-1266" ref-type="bibr">16</xref>).</p></sec>
<sec>
<title>Western blot analysis</title>
<p>Total proteins were extracted from tissue samples or cells using lysis buffer containing phenylmethyl sulfonylfluoride. Samples mixed with loading buffer were denatured, separated by electrophoresis on 12&#x00025; SDS-PAGE, and then transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5&#x00025; non-fat milk for 2 h, and were exposed to the appropriate primary antibodies (anti-CDK10, Abgent, San Diego, CA, USA; anti-c-RAF-pS338 Phospho, Abgent; anti-PCNA, Santa Cruz Biotechnology, Santa Cruz, CA, USA; anti-&#x003B2;-actin, Santa Cruz Biotechnology) at an appropriate dilution for 12 h at 4&#x000B0;C. After three extensive times washes using TBST for 10 min each, the membranes were incubated with appropriate horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) at a dilution of 1:8,000 for 2 h at 25&#x000B0;C. Immunoreactive bands were visualized with chemiluminescence. Human &#x003B2;-actin was employed as an endogenous control.</p></sec>
<sec>
<title>Colony formation assay and wound healing assays</title>
<p>Twenty-four hours post-transfection with RNA oligonucleotide or plasmid DNA, HCCC-9180 and GBC-SD cells were seeded for colony formation in 35-mm dishes at a density of 200 viable cells per well. After 21 days, the cells grown in plates were fixed in 4&#x00025; paraformaldehyde for 15 min. After washing, the cells were stained with 0.005&#x00025; crystal violet solution for 1 h (<xref rid="b17-or-27-04-1266" ref-type="bibr">17</xref>). The plates were aspirated, washed and allowed to air dry. Colonies were counted only if a single clone contained &gt;50 cells. Each assay was performed in triplicate.</p>
<p>For wound healing assays, cells were seeded and grown to confluence on 35-mm cell culture dishes. A wound was introduced by scratching the confluent monolayer with a pipette tip (200 &#x003BC;l). After washing twice with PBS, serum-free medium (inhibiting cell proliferation) was added. Imaging was conducted using light microscopy at &#x000D7;40 magnification, and wound healing was quantified as the average linear speed of the wound edges after 24-h incubation.</p></sec>
<sec>
<title>Cell proliferation assays, chemotherapy sensitivity assays, serum-dependent growth assays and assays of tolerance to low oxygen conditions</title>
<p>BTC cells were transfected with RNA oligonucleotide or plasmid DNA. Five hours after transfection, equal numbers of viable cells were seeded in 96-well plates for cell proliferation assays. Cell growth was determined using the 3-&#x0005B;4,5-dimethylthiazol-2-yl&#x0005D;-2, 5-diphenyltetrazolium bromide assay (MTT) (Sigma, St. Louis, MO, USA). One-tenth volume of MTT with serum-free medium was added to each well at different time points, and the plates were further incubated at 37&#x000B0;C for 4 h. Formazan crystals were dissolved in DMSO. The A<sub>590</sub> was measured with an enzyme-labeling instrument (BioTek, Winooski, VT, USA).</p>
<p>For the chemotherapy sensitivity assays, 5-fluorouracil (5-FU), epidoxorubicin (EADM), cisplatin (CDDP) and hydroxycamptothecin (HCPT) were supplied by Pharmacia Qilu (Jinan, China) and were used as the chemotherapy drugs to evaluate the effect of CDK10 on chemotherapy sensitivity. Cells that were transfected with RNA oligonucleotide (48 h post-transfection) and stable transfectants were seeded into a 96-well plate (4&#x000D7;10<sup>3</sup> cells/well), and allowed to attach overnight. Cells were treated with various concentrations of anticancer drugs in at least six replicate wells and incubated for 48 h. The MTT assay was performed in accordance with the aforementioned criteria and dose-response curves were used to describe the results.</p>
<p>For studies of serum-dependence growth assays, cells were seeded onto a 96-well plate (4&#x000D7;10<sup>3</sup> cells/well), and allowed to attach overnight. Cells were washed twice with serum-free medium, new medium with 20, 15, 10, 5 or 1&#x00025; serum was added, and cells were cultured for 3 days. The MTT assay was performed in accordance with the aforementioned criteria.</p>
<p>In this study, we imitated low oxygen conditions using cobalt chloride to evaluate the cell survival (<xref rid="b18-or-27-04-1266" ref-type="bibr">18</xref>). After cells were seeded and allowed to attach to a 96-well plate, the medium with cobalt chloride (final concentration of 100 &#x003BC;mol/l) was added. When each time point arrived, an MTT assay was performed in accordance with the afore-mentioned criteria.</p></sec>
<sec>
<title>Flow cytometry for cell cycle analysis</title>
<p>Stable transfectants were seeded into 60-mm dishes. After 24 h of culture, to allow cells to attach, cells were treated with 5-FU, at 200 mg/l for 48 h. Cells were harvested. After washing with PBS, the cells were fixed with 80&#x00025; ice-cold ethanol at 4&#x000B0;C overnight. After fixation, the cells were stained with 4&#x00025; propidium iodide (PI) and 10&#x00025; RNase A in PBS for 30 min at 37&#x000B0;C. A total of 2&#x000D7;10<sup>4</sup> events were analyzed per assay by FACScan analysis using the CellQuest software (Becton-Dickinson, Franklin, NJ, USA).</p></sec>
<sec>
<title>Statistical analysis</title>
<p>Data are presented as means &#x000B1; SD from at least three separate experiments. Statistical analysis was performed by the Student&#x02019;s t-test at a significance level of P&lt;0.05. The &#x003C7;<sup>2</sup> test was used to show differences in categorical variables. All statistical analyses were conducted using SPSS version 11.0.</p></sec></sec>
<sec sec-type="results">
<title>Results</title>
<sec>
<title>Expression of CDK10 is downregulated in biliary tract cancer</title>
<p>To determine the clinical relevance of CDK10 in human BTC, quantitative real-time PCR was performed to determine the expression of CDK10 mRNA in human cancer and normal tissue samples. The average expression of 18 normal samples was defined as the basic expression of normal tissues. Forty-seven tumor samples (including ICC, PCC, DECC, GBC and metastasis) were examined and showed that decreased CDK10 mRNA occurred in 36 of the 47 samples (76.6&#x00025;), compared with normal tissue (<xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1A</xref>). The mRNA levels of CDK10 were significantly different between tumors and normal tissues (P&#x0003D;0.00075). We also determined the protein levels of CDK10 by western blotting in 27 clinical samples (including normal tissues, ICC, PCC, DECC, GBC and metastasis). As shown in <xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1B</xref>, decreased CDK10 protein occurred in 15 of 18 (83.3&#x00025;) tumors, compared with normal tissues (<xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1B</xref>). Statistical analysis indicated that CDK10 protein was significantly different between tumors and normal tissues (P&#x0003D;0.004). In subtypes of BTC, ICC and GBC had a significantly downregulated CDK10 expression, compared with normal tissues (P&#x0003D;0.01 and 0.048, respectively; <xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1C</xref>). In PCC and DECC specimens, the expression of CDK10 had a tendency to decrease, but was not marked (P&#x0003D;0.123 and 0.119, respectively). However, the difference between ECC (including PCC and DECC) and normal specimens was marked (P&#x0003D;0.04, <xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1C</xref>).</p>
<p>Patients were divided into three groups according to the expression of CDK10 at the mRNA level. The clinical characteristics were compared in these groups. Lower expression of CDK10 was significantly associated with worse TNM staging, increased lymph node invasion, and higher serum carbohydrate antigen (CA)19-9 level in BTC (<xref rid="tII-or-27-04-1266" ref-type="table">Table II</xref>; P&lt;0.05), but not with age, gender, histology type, tumor location, differentiation grade, serum carcinoembryonic antigen (CEA) level, hepatitis B virus (HBV) infection, metastasis, and 1-year survival (<xref rid="tII-or-27-04-1266" ref-type="table">Table II</xref>).</p>
<p>We also compared the expression of CDK10 between four different tumor cell lines (GBC-SD, HCCC-9180, SSP25 and RBE) and normal BECs. Real-time PCR analysis revealed that three cell lines (GBC-SD, HCCC-9180 and SSP25) expressed lower levels of CDK10 compared to BECs; the difference was significant (<xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1D</xref>). Western blot analysis was also performed and revealed a similar result to that of real-time PCR analysis (<xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1E</xref>).</p></sec>
<sec>
<title>Overexpression of CDK10 inhibits proliferation of biliary tract cancer cells</title>
<p>Three cell lines (GBC-SD, HCCC-9180 and SSP25) that expressed lower levels of CDK10 were transfected with pCMV6-Entry-CDK10 or empty vectors. After 3 weeks, stable transfectants were obtained and named as H-CDK10 (HCCC-9180), G-CDK10 (GBC-SD) and S-CDK10 (SSP25). The control clones expressing empty vector (Mock) were named as H-M (HCCC-9180), G-M (GBC-SD) and S-M (SSP25), respectively. Western blotting was performed to confirm positive clones (<xref rid="f2-or-27-04-1266" ref-type="fig">Fig. 2A</xref>).</p>
<p>Three siRNAs targeting CDK10 were designed and transfected into cells. Real-time PCR was performed to confirm which one was the most effective. As shown in <xref rid="f2-or-27-04-1266" ref-type="fig">Fig. 2B</xref>, si-3 was used for further experiments because this siRNA was most effective in suppressing CDK10 expression. Seventy-two hours after transfection with si-3, total protein was extracted from cells, and western blotting was performed to confirm the effect of RNAi (<xref rid="f2-or-27-04-1266" ref-type="fig">Fig. 2C</xref>).</p>
<p>Given that CDK10 is downregulated in clinical specimens and that it may act as a tumor suppressor, we decided to examine whether CDK10 had anti-oncogenic functions in BTC cells <italic>in vitro</italic>. To determine whether CDK10 regulated tumor growth, we performed cell proliferation assays with GBC-SD and HCCC-9180 cells. MTT assays were performed at the indicated time points after transfection. Overexpression of CDK10 significantly inhibited the proliferation of GBC-SD and HCCC-9180 cells (P&lt;0.001; <xref rid="f2-or-27-04-1266" ref-type="fig">Fig. 2D and E</xref>). Conversely, silencing of CDK10 clearly promoted the proliferation of HCCC-9180 and GBC-SD cells (P&lt;0.001 and 0.05, respectively; <xref rid="f2-or-27-04-1266" ref-type="fig">Fig. 2D and E</xref>). Total proteins were extracted from stable cell lines and the cells that were transfected with siRNA after 72 h. Western blot analysis was performed and proliferating cell nuclear antigen (PCNA) was employed as a reporter of proliferation. The results demonstrate that the lack of CDK10 increased proliferation. Conversely, the proliferation was inhibited in CDK10-overexpressing cells (<xref rid="f2-or-27-04-1266" ref-type="fig">Fig. 2F and G</xref>).</p></sec>
<sec>
<title>Silencing of CDK10 promotes colony formation and migration of cells</title>
<p>As shown in <xref rid="f3-or-27-04-1266" ref-type="fig">Fig. 3A</xref>, overexpression or knockdown of CDK10, respectively, attenuated or promoted colony formation of GBC-SD and HCCC-9180 cells (<xref rid="f3-or-27-04-1266" ref-type="fig">Fig. 3A and B</xref>; P&lt;0.05). Greater numbers of colonies of larger size were formed by knockdown of CDK10 as compared with control RNA, whereas CDK10-overexpressing cells formed only a few small colonies (<xref rid="f3-or-27-04-1266" ref-type="fig">Fig. 3A and B</xref>).</p>
<p>We next investigated the function of CDK10 in the migration of GBC-SD and HCCC-9180 cells. CDK10 knockdown resulted in a significant increase in cell migration, compared to cells transfected with control RNA (<xref rid="f3-or-27-04-1266" ref-type="fig">Fig. 3C</xref>). As expected, CDK10 overexpression induced a significant decrease in cell migration (<xref rid="f3-or-27-04-1266" ref-type="fig">Fig. 3C</xref>). These observations suggest that CDK10 inhibited the migration of tumor cells.</p></sec>
<sec>
<title>Overexpression of CDK10 reverses the resistance to chemotherapy for biliary tract cancer and decreases survivability of biliary tract cancer cells</title>
<p>Given that CDK10 has been identified as an important determinant of resistance to endocrine therapy for breast cancer (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>), we decided to examine whether CDK10 influenced resistance of BTC cells to chemotherapy. 5-FU was used as the major drug and the GBC-SD, HCCC-9180 and SSP25 cell lines were examined. As shown in the dose-response curves (<xref rid="f4-or-27-04-1266" ref-type="fig">Fig. 4A</xref>), CDK10 silencing significantly decreased sensitivity to 5-FU for all three cell lines, and overexpression of CDK10 increased sensitivity to 5-FU, conversely. To confirm whether the influence of CDK10 was specific to 5-FU or common to other chemotherapeutic drugs, EADM, CDDP and HCPT were used as additional drugs, and GBC-SD and HCCC-9180 cell lines were tested. For both GBC-SD and HCCC-9180 cells, after overexpression or silencing of CDK10, EADM, CDDP and HCPT showed similar alteration as 5-FU (<xref rid="f4-or-27-04-1266" ref-type="fig">Fig. 4B</xref>). The result indicated that expression of CDK10 influenced resistance to chemotherapy rather than specifically to 5-FU.</p>
<p>To obtain more evidence, we performed colony-forming assays with chemotherapy in 24-well plates (100 cells/well). After 24-h culture, to allow cells to attach, cells were treated with 5-FU, at 200 mg/l for 48 h. Cells were fed with fresh medium without 5-FU after washing with PBS and the other procedures were the same as for the ordinary colony-forming assay. Overexpression of CDK10 induced potentiation of the inhibitory effect of 5-FU on the colony-forming ability. Furthermore, the inhibitory effect of 5-FU was relieved because of silencing of CDK10 (<xref rid="f4-or-27-04-1266" ref-type="fig">Fig. 4C and D</xref>).</p>
<p>We investigated the survivability of CDK10-overexpressed cells by serum-dependence growth assays and hypoxia-tolerant assays. The serum-dependence growth assays showed that CDK10-overexpressed cells were much more independent of serum (<xref rid="f4-or-27-04-1266" ref-type="fig">Fig. 4E</xref>). In hypoxia-tolerant assays, CDK10-overexpressed HCCC-9180 cells showed a significantly smaller decrease in survival, compared with Mock group. However, GBC-SD was not sensitive to cobalt chloride (<xref rid="f4-or-27-04-1266" ref-type="fig">Fig. 4F</xref>). Taken together, these results suggest that CDK10 regulates the survivability of BTC cells.</p></sec>
<sec>
<title>An increase in CDK10 expression induces G<sub>0</sub>/G<sub>1</sub> cell cycle arrest and potentiates the cell cycle arrest induced by 5-FU</title>
<p>In colon cancer cells, the antiproliferative effect of 5-FU results in induction of cell cycle arrest at the G<sub>1</sub> phase, and is characterized by an increase in the number of cells in the S phase (<xref rid="b19-or-27-04-1266" ref-type="bibr">19</xref>). To investigate the possibility that an increase in CDK10 expression enhances the 5-FU-induced cell cycle arrest, cell cycle profiles were assessed. Compared with Mock cells, CDK10-overexpressed cells showed a significant increase in the number of G<sub>1</sub> phase cells and a simultaneous significant decrease in G<sub>2</sub>/M phase cells (<xref rid="f5-or-27-04-1266" ref-type="fig">Fig. 5A and B</xref>). Mock cells (G-M and H-M) treated with 5-FU displayed the expected increase in S phase populations (<xref rid="f5-or-27-04-1266" ref-type="fig">Fig. 5A and B</xref>). In contrast, 5-FU-treated, CDK10-overexpressing cells (G-CDK10 and H-CDK10) showed a significant increase in the number of G<sub>1</sub> phase cells and a significant decrease in S phase cells compared with Mock cells (<xref rid="f5-or-27-04-1266" ref-type="fig">Fig. 5</xref>). More interesting, G-M cells showed an increase in the number of G<sub>2</sub>/M phase cells after treatment with 5-FU, while the number of G-CDK10 cells in G<sub>2</sub>/M phase showed a significant decrease (<xref rid="f5-or-27-04-1266" ref-type="fig">Fig. 5C</xref>).</p></sec>
<sec>
<title>CDK10 is a negative regulator of expression of c-RAF in biliary tract cancer</title>
<p>To investigate the mechanism for the alteration of resistance to chemotherapy, we examined five genes involved in mechanisms of resistance (<xref rid="b20-or-27-04-1266" ref-type="bibr">20</xref>) including TP53 (p53), BID, ABCC2, ABCB1 and ABCB11. Given that c-RAF has been identified as a target protein regulated by CDK10 and influences resistance to endocrine therapy for breast cancer, c-RAF was also examined (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). The result of quantitative real-time PCR showed that CDK10-overexpressing cells (G-CDK10 and H-CDK10) had decreased c-RAF mRNA levels, compared with Mock cells (P&lt;0.01; <xref rid="f6-or-27-04-1266" ref-type="fig">Fig. 6A and B</xref>). In contrast, CDK10-silenced cells showed increased c-RAF mRNA, compared with cells transfected with control RNA (P&lt;0.01; <xref rid="f6-or-27-04-1266" ref-type="fig">Fig. 6A and B</xref>). Among the other five candidate genes, only ABCB11 showed an expected alteration of expression in HCCC-9180 cells, but not in GBC-SD cells (<xref rid="f6-or-27-04-1266" ref-type="fig">Fig. 6A and B</xref>). The protein levels of c-RAF were examined in transfected cells by western blotting. The results of western blotting corresponded to those of real-time PCR (<xref rid="f6-or-27-04-1266" ref-type="fig">Fig. 6C</xref>), and demonstrated that c-RAF was regulated by CDK10 in both GBC-SD and HCCC-9180 cells.</p>
<p>We supposed that c-RAF was regulated by CDK10 in BTC in the same manner as described for breast cancer (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). Thus, we investigated the expression of c-RAF mRNA in human cancer samples and normal samples by real-time PCR. Increased c-RAF mRNA occurred in 42 of 47 (89.4&#x00025;) cancer samples, compared with normal tissues (<xref rid="f6-or-27-04-1266" ref-type="fig">Fig. 6D</xref>). The mRNA levels of c-RAF were significantly different between tumors and normal tissues (P&#x0003D;0.0363). Furthermore, we also investigated the correlation between the expression level of c-RAF and clinical characteristics. As shown in <xref rid="tII-or-27-04-1266" ref-type="table">Table II</xref>, higher expression of c-RAF was significantly associated with worse TNM staging, increased lymph node invasion and poorer differentiation grade, but not with age, gender, serum CA19-9 level, and 1-year survival (<xref rid="tII-or-27-04-1266" ref-type="table">Table II</xref>). More interesting, an increase in c-RAF mRNA with a simultaneous decrease in CDK10 mRNA occurred in 33 of 47 (70.2&#x00025;) cancer samples. Statistical analysis indicated that decreased CDK10 was correlated with increased c-RAF (<xref rid="f6-or-27-04-1266" ref-type="fig">Fig. 6E</xref>). These data indicate that CDK10 is a negative regulator of expression of c-RAF in BTC.</p></sec></sec>
<sec sec-type="discussion">
<title>Discussion</title>
<p>A previous study has reported that CDK10 expression is reduced in breast cancer and CDK10 silencing induces resistance to endocrine therapy (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). The reason why CDK10 is downregulated in breast cancer with aberrant DNA methylation is still controversial (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>,<xref rid="b21-or-27-04-1266" ref-type="bibr">21</xref>), CDK10 is being investigated as a tumor suppressor (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>,<xref rid="b11-or-27-04-1266" ref-type="bibr">11</xref>). However, little is known about the expression and function of CDK10 in BTC.</p>
<p>We showed that CDK10 was aberrantly expressed in BTC samples and cell lines, which demonstrates that expression of CDK10 is downregulated in BTC, and that it functions as a tumor suppressor to influence the cellular processes of BTC cells. Although biliary cancers include ICC, ECC and GBC, CDK10 was downregulated in all of them (<xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1C</xref>). Inhibition of CDK10 expression induced aberrant activation of growth, migration and survivability (including resistance to chemotherapy, serum starvation and hypoxia tolerance) of BTC cells. More interesting, lower expression of CDK10 and higher expression of c-RAF were significantly associated with clinical characteristics, such as worse TNM staging and more lymph node invasion. The results suggested that expression of CDK10 could be used as a candidate index to evaluate BTC.</p>
<p>Resistance to chemotherapy is one of the major limiting factors for the application of chemotherapeutic drugs in BTC (<xref rid="b1-or-27-04-1266" ref-type="bibr">1</xref>,<xref rid="b5-or-27-04-1266" ref-type="bibr">5</xref>). Based on CDK10-silencing-induced resistance to endocrine therapy (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>), we investigated the correlation between CDK10 and chemotherapy. We found that increased CDK10 was correlated with decreased resistance to chemotherapy. These findings may contribute to improving the effect of chemotherapy in the future.</p>
<p>To explain the alteration in resistance to chemotherapy induced by CDK10, we investigated the expression of several candidate genes. The results confirmed that the expression of c-RAF is regulated by CDK10 in BTC cells similarly to breast cancer cells (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). Overexpression of c-RAF has been reported to induce MAPK pathway activation (<xref rid="b22-or-27-04-1266" ref-type="bibr">22</xref>,<xref rid="b23-or-27-04-1266" ref-type="bibr">23</xref>). Aberrant activation of the MAPK pathway induces aberrant growth and increases the threshold for cell death (<xref rid="b24-or-27-04-1266" ref-type="bibr">24</xref>,<xref rid="b25-or-27-04-1266" ref-type="bibr">25</xref>), resulting in increased survivability of tumor cells. We examined the correlation between CDK10 and c-RAF in clinical samples, which was not confirmed in previous research. The results indicated that CDK10 was a negative regulator of c-RAF in cells and clinical samples. Our results indicate that CDK10 may function in cellular processes, at least partially, through c-RAF.</p>
<p>Inactive CDK10 has been shown to lead to a G<sub>2</sub>/M arrest in mammalian cells, but wild-type CDK10 only shows a modest effect (<xref rid="b8-or-27-04-1266" ref-type="bibr">8</xref>). However, in our study, we investigated two malignant cell lines, and showed CDK10-overexpressing cells had an increase in the G<sub>1</sub> phase of the cycle, compared with the control group. Coincidentally, in MCF-7 breast cancer cells, it has been reported that there is a significant decrease in the number of G<sub>1</sub> phase cells, in the absence of tamoxifen treatment, because of CDK10 silencing (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). CDK10 is not only a kinase but also a negative regulator of Ets2 transcription factor (<xref rid="b9-or-27-04-1266" ref-type="bibr">9</xref>,<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>). Ets2 has been found to play a role in controlling the cell cycle though regulating Cdc2 expression (<xref rid="b26-or-27-04-1266" ref-type="bibr">26</xref>). The expression of c-RAF is the more noteworthy factor, because it is regulated by CDK10 and plays an important role in the cell cycle (<xref rid="b10-or-27-04-1266" ref-type="bibr">10</xref>,<xref rid="b27-or-27-04-1266" ref-type="bibr">27</xref>). Taken together, the CDK10/Ets2/c-RAF signaling may help explain why such an unusual event occur ed in the G<sub>1</sub> phase. More interestingly, after treatment with 5-FU, CDK10-overexpressing cells showed a significantly increase in the G<sub>1</sub> phase cells in both the GBC-SD and HCCC-9180 cell lines, and a significant decrease in the G<sub>2</sub>/M phase cells in GBC-SD. We suggest that the overexpression of CDK10 induces more cells to remain at a resting stage and makes cells sensitive to chemotherapy in BTC.</p>
<p>In conclusion, we report that expression of CDK10 is downregulated in biliary tract cancer and that it functions as a tumor suppressor. CDK10 restoration inhibits tumor growth, cell migration and survivability, and induces malignant cells to become sensitive to chemotherapy in the biliary tract cancer. These functions are at least partially mediated via a negative regulation of c-RAF, thus offering a potential therapeutic approach for treatment of biliary tract cancer with low expression of CDK10.</p></sec></body>
<back>
<ack>
<title>Acknowledgements</title>
<p>This study was supported by the National Natural Science Foundation of China (no. 81170426) and the Heilongjiang Provincial Natural Science Foundation of China (no. ZJY0704-01 and no. QC2010103).</p></ack>
<glossary id="GL">
<title>Abbreviations</title>
<def-list>
<def-item>
<term id="G1">CDK10</term>
<def>
<p>cyclin-dependent kinase 10</p></def></def-item>
<def-item>
<term id="G2">BTC</term>
<def>
<p>biliary tract cancer</p></def></def-item>
<def-item>
<term id="G3">CCA</term>
<def>
<p>cholangiocarcinoma</p></def></def-item>
<def-item>
<term id="G4">GBC</term>
<def>
<p>gallbladder cancer</p></def></def-item>
<def-item>
<term id="G5">ICC</term>
<def>
<p>intrahepatic cholangiocarcinoma</p></def></def-item>
<def-item>
<term id="G6">ECC</term>
<def>
<p>extrahepatic cholangiocarcinoma</p></def></def-item>
<def-item>
<term id="G7">PCC</term>
<def>
<p>perihilar cholangiocarcinoma</p></def></def-item>
<def-item>
<term id="G8">DECC</term>
<def>
<p>distal extrahepatic cholangiocarcinoma</p></def></def-item>
<def-item>
<term id="G9">MAPK</term>
<def>
<p>mitogen-activated protein kinase</p></def></def-item>
<def-item>
<term id="G10">PCNA</term>
<def>
<p>proliferating cell nuclear antigen</p></def></def-item></def-list></glossary>
<ref-list>
<title>References</title>
<ref id="b1-or-27-04-1266"><label>1</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>de Groen</surname><given-names>PC</given-names></name><name><surname>Gores</surname><given-names>GJ</given-names></name><name><surname>LaRusso</surname><given-names>NF</given-names></name><name><surname>Gunderson</surname><given-names>LL</given-names></name><name><surname>Nagorney</surname><given-names>DM</given-names></name></person-group><article-title>Biliary tract cancers</article-title><source>N Engl J Med</source><volume>341</volume><fpage>1368</fpage><lpage>1378</lpage><year>1999</year></element-citation></ref>
<ref id="b2-or-27-04-1266"><label>2</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shaib</surname><given-names>Y</given-names></name><name><surname>El-Serag</surname><given-names>HB</given-names></name></person-group><article-title>The epidemiology of cholangiocarcinoma</article-title><source>Semin Liver Dis</source><volume>24</volume><fpage>115</fpage><lpage>125</lpage><year>2004</year></element-citation></ref>
<ref id="b3-or-27-04-1266"><label>3</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Khan</surname><given-names>SA</given-names></name><name><surname>Thomas</surname><given-names>HC</given-names></name><name><surname>Davidson</surname><given-names>BR</given-names></name><name><surname>Taylor-Robinson</surname><given-names>SD</given-names></name></person-group><article-title>Cholangiocarcinoma</article-title><source>Lancet</source><volume>366</volume><fpage>1303</fpage><lpage>1314</lpage><year>2005</year></element-citation></ref>
<ref id="b4-or-27-04-1266"><label>4</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nakeeb</surname><given-names>A</given-names></name><name><surname>Pitt</surname><given-names>HA</given-names></name><name><surname>Sohn</surname><given-names>TA</given-names></name><etal/></person-group><article-title>Cholangiocarcinoma. A spectrum of intrahepatic, perihilar, and distal tumors</article-title><source>Ann Surg</source><volume>224</volume><fpage>463</fpage><lpage>475</lpage><year>1996</year></element-citation></ref>
<ref id="b5-or-27-04-1266"><label>5</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Blechacz</surname><given-names>B</given-names></name><name><surname>Gores</surname><given-names>GJ</given-names></name></person-group><article-title>Cholangiocarcinoma: advances in pathogenesis, diagnosis, and treatment</article-title><source>Hepatology</source><volume>48</volume><fpage>308</fpage><lpage>321</lpage><year>2008</year></element-citation></ref>
<ref id="b6-or-27-04-1266"><label>6</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Malhi</surname><given-names>H</given-names></name><name><surname>Gores</surname><given-names>GJ</given-names></name></person-group><article-title>Cholangiocarcinoma: modern advances in understanding a deadly old disease</article-title><source>J Hepatol</source><volume>45</volume><fpage>856</fpage><lpage>867</lpage><year>2006</year></element-citation></ref>
<ref id="b7-or-27-04-1266"><label>7</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jarnagin</surname><given-names>WR</given-names></name><name><surname>Shoup</surname><given-names>M</given-names></name></person-group><article-title>Surgical management of cholangiocarcinoma</article-title><source>Semin Liver Dis</source><volume>24</volume><fpage>189</fpage><lpage>199</lpage><year>2004</year></element-citation></ref>
<ref id="b8-or-27-04-1266"><label>8</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname><given-names>S</given-names></name><name><surname>MacLachlan</surname><given-names>TK</given-names></name><name><surname>De Luca</surname><given-names>A</given-names></name><name><surname>Claudio</surname><given-names>PP</given-names></name><name><surname>Condorelli</surname><given-names>G</given-names></name><name><surname>Giordano</surname><given-names>A</given-names></name></person-group><article-title>The cdc-2-related kinase, PISSLRE, is essential for cell growth and acts in G2 phase of the cell cycle</article-title><source>Cancer Res</source><volume>55</volume><fpage>3992</fpage><lpage>3995</lpage><year>1995</year></element-citation></ref>
<ref id="b9-or-27-04-1266"><label>9</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kasten</surname><given-names>M</given-names></name><name><surname>Giordano</surname><given-names>A</given-names></name></person-group><article-title>Cdk10, a Cdc2-related kinase, associates with the Ets2 transcription factor and modulates its transactivation activity</article-title><source>Oncogene</source><volume>20</volume><fpage>1832</fpage><lpage>1838</lpage><year>2001</year></element-citation></ref>
<ref id="b10-or-27-04-1266"><label>10</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Iorns</surname><given-names>E</given-names></name><name><surname>Turner</surname><given-names>NC</given-names></name><name><surname>Elliott</surname><given-names>R</given-names></name><etal/></person-group><article-title>Identification of CDK10 as an important determinant of resistance to endocrine therapy for breast cancer</article-title><source>Cancer Cell</source><volume>13</volume><fpage>91</fpage><lpage>104</lpage><year>2008</year></element-citation></ref>
<ref id="b11-or-27-04-1266"><label>11</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Leman</surname><given-names>ES</given-names></name><name><surname>Magheli</surname><given-names>A</given-names></name><name><surname>Yong</surname><given-names>KM</given-names></name><name><surname>Netto</surname><given-names>G</given-names></name><name><surname>Hinz</surname><given-names>S</given-names></name><name><surname>Getzenberg</surname><given-names>RH</given-names></name></person-group><article-title>Identification of nuclear structural protein alterations associated with seminomas</article-title><source>J Cell Biochem</source><volume>108</volume><fpage>1274</fpage><lpage>1279</lpage><year>2009</year></element-citation></ref>
<ref id="b12-or-27-04-1266"><label>12</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kanno</surname><given-names>N</given-names></name><name><surname>Lesage</surname><given-names>G</given-names></name><name><surname>Phinizy</surname><given-names>JL</given-names></name><name><surname>Glaser</surname><given-names>S</given-names></name><name><surname>Francis</surname><given-names>H</given-names></name><name><surname>Alpini</surname><given-names>G</given-names></name></person-group><article-title>Stimulation of alpha2-adrenergic receptor inhibits cholangiocarcinoma growth through modulation of Raf-1 and B-Raf activities</article-title><source>Hepatology</source><volume>35</volume><fpage>1329</fpage><lpage>1340</lpage><year>2002</year></element-citation></ref>
<ref id="b13-or-27-04-1266"><label>13</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gorunova</surname><given-names>L</given-names></name><name><surname>Parada</surname><given-names>LA</given-names></name><name><surname>Limon</surname><given-names>J</given-names></name><etal/></person-group><article-title>Non random chromosomal aberrations and cytogenetic heterogeneity in gallbladder carcinomas</article-title><source>Genes Chromosomes Cancer</source><volume>26</volume><fpage>312</fpage><lpage>321</lpage><year>1999</year></element-citation></ref>
<ref id="b14-or-27-04-1266"><label>14</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rijken</surname><given-names>AM</given-names></name><name><surname>Hu</surname><given-names>J</given-names></name><name><surname>Perlman</surname><given-names>EJ</given-names></name><etal/></person-group><article-title>Genomic alterations in distal bile duct carcinoma by comparative genomic hybridization and karyotype analysis</article-title><source>Genes Chromosomes Cancer</source><volume>26</volume><fpage>185</fpage><lpage>191</lpage><year>1999</year></element-citation></ref>
<ref id="b15-or-27-04-1266"><label>15</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bullrich</surname><given-names>F</given-names></name><name><surname>MacLachlan</surname><given-names>TK</given-names></name><name><surname>Sang</surname><given-names>N</given-names></name><etal/></person-group><article-title>Chromosomal mapping of members of the cdc2 family of protein kinases, cdk3, cdk6, PISSLRE, and PITALRE, and a cdk inhibitor, p27Kip1, to regions involved in human cancer</article-title><source>Cancer Res</source><volume>55</volume><fpage>1199</fpage><lpage>1205</lpage><year>1995</year></element-citation></ref>
<ref id="b16-or-27-04-1266"><label>16</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Livak</surname><given-names>KJ</given-names></name><name><surname>Schmittgen</surname><given-names>TD</given-names></name></person-group><article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(&#x02212;Delta Delta C(T)) method</article-title><source>Methods</source><volume>25</volume><fpage>402</fpage><lpage>408</lpage><year>2001</year></element-citation></ref>
<ref id="b17-or-27-04-1266"><label>17</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dong</surname><given-names>Z</given-names></name><name><surname>Cmarik</surname><given-names>JL</given-names></name></person-group><article-title>Harvesting cells under anchorage-independent cell transformation conditions for biochemical analyses</article-title><source>Sci STKE</source><volume>2002</volume><fpage>pl7</fpage><year>2002</year></element-citation></ref>
<ref id="b18-or-27-04-1266"><label>18</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Scherbakov</surname><given-names>AM</given-names></name><name><surname>Lobanova</surname><given-names>YS</given-names></name><name><surname>Shatskaya</surname><given-names>VA</given-names></name><name><surname>Krasil&#x02019;nikov</surname><given-names>MA</given-names></name></person-group><article-title>The breast cancer cells response to chronic hypoxia involves the opposite regulation of NF-kB and estrogen receptor signaling</article-title><source>Steroids</source><volume>74</volume><fpage>535</fpage><lpage>542</lpage><year>2009</year></element-citation></ref>
<ref id="b19-or-27-04-1266"><label>19</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sasaki</surname><given-names>K</given-names></name><name><surname>Tsuno</surname><given-names>NH</given-names></name><name><surname>Sunami</surname><given-names>E</given-names></name><etal/></person-group><article-title>Chloroquine potentiates the anti-cancer effect of 5-fluorouracil on colon cancer cells</article-title><source>BMC Cancer</source><volume>10</volume><fpage>370</fpage><year>2010</year></element-citation></ref>
<ref id="b20-or-27-04-1266"><label>20</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Marin</surname><given-names>JJ</given-names></name><name><surname>Romero</surname><given-names>MR</given-names></name><name><surname>Briz</surname><given-names>O</given-names></name></person-group><article-title>Molecular bases of liver cancer refractoriness to pharmacological treatment</article-title><source>Curr Med Chem</source><volume>17</volume><fpage>709</fpage><lpage>740</lpage><year>2010</year></element-citation></ref>
<ref id="b21-or-27-04-1266"><label>21</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heller</surname><given-names>G</given-names></name><name><surname>Ziegler</surname><given-names>B</given-names></name><name><surname>Brandstetter</surname><given-names>A</given-names></name><etal/></person-group><article-title>CDK10 is not a target for aberrant DNA methylation in breast cancer</article-title><source>Anticancer Res</source><volume>29</volume><fpage>3939</fpage><lpage>3944</lpage><year>2009</year></element-citation></ref>
<ref id="b22-or-27-04-1266"><label>22</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kolch</surname><given-names>W</given-names></name></person-group><article-title>Coordinating ERK/MAPK signalling through scaffolds and inhibitors</article-title><source>Nat Rev Mol Cell Biol</source><volume>6</volume><fpage>827</fpage><lpage>837</lpage><year>2005</year></element-citation></ref>
<ref id="b23-or-27-04-1266"><label>23</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Beeram</surname><given-names>M</given-names></name><name><surname>Patnaik</surname><given-names>A</given-names></name><name><surname>Rowinsky</surname><given-names>EK</given-names></name></person-group><article-title>Raf: a strategic target for therapeutic development against cancer</article-title><source>J Clin Oncol</source><volume>23</volume><fpage>6771</fpage><lpage>6790</lpage><year>2005</year></element-citation></ref>
<ref id="b24-or-27-04-1266"><label>24</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Small</surname><given-names>GW</given-names></name><name><surname>Somasundaram</surname><given-names>S</given-names></name><name><surname>Moore</surname><given-names>DT</given-names></name><name><surname>Shi</surname><given-names>YY</given-names></name><name><surname>Orlowski</surname><given-names>RZ</given-names></name></person-group><article-title>Repression of mitogen-activated protein kinase (MAPK) phosphatase-1 by anthracyclines contributes to their antiapoptotic activation of p44/42-MAPK</article-title><source>J Pharmacol Exp Ther</source><volume>307</volume><fpage>861</fpage><lpage>869</lpage><year>2003</year></element-citation></ref>
<ref id="b25-or-27-04-1266"><label>25</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dent</surname><given-names>P</given-names></name><name><surname>Grant</surname><given-names>S</given-names></name></person-group><article-title>Pharmacologic interruption of the mitogen-activated extracellular-regulated kinase/mitogen-activated protein kinase signal transduction pathway: potential role in promoting cytotoxic drug action</article-title><source>Clin Cancer Res</source><volume>7</volume><fpage>775</fpage><lpage>783</lpage><year>2001</year></element-citation></ref>
<ref id="b26-or-27-04-1266"><label>26</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wen</surname><given-names>SC</given-names></name><name><surname>Ku</surname><given-names>DH</given-names></name><name><surname>De Luca</surname><given-names>A</given-names></name><name><surname>Claudio</surname><given-names>PP</given-names></name><name><surname>Giordano</surname><given-names>A</given-names></name><name><surname>Calabretta</surname><given-names>B</given-names></name></person-group><article-title>ets-2 regulates cdc2 kinase activity in mammalian cells: coordinated expression of cdc2 and cyclin A</article-title><source>Exp Cell Res</source><volume>217</volume><fpage>8</fpage><lpage>14</lpage><year>1995</year></element-citation></ref>
<ref id="b27-or-27-04-1266"><label>27</label><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chang</surname><given-names>F</given-names></name><name><surname>Steelman</surname><given-names>LS</given-names></name><name><surname>Shelton</surname><given-names>JG</given-names></name><etal/></person-group><article-title>Regulation of cell cycle progression and apoptosis by the Ras/Raf/MEK/ERK pathway (Review)</article-title><source>Int J Oncol</source><volume>22</volume><fpage>469</fpage><lpage>480</lpage><year>2003</year></element-citation></ref></ref-list></back>
<floats-group>
<fig id="f1-or-27-04-1266" position="float">
<label>Figure 1</label>
<caption>
<p>Expression of CDK10 is downregulated in BTC. (A) Real-time PCR of the expression levels of CDK10 in BTC and normal samples. &#x00394;Ct(Na), Ct value of &#x003B2;-actin was subtracted from that of CDK10 of every normal tissue, and the average value of the differences of all normal samples was defined as &#x00394;Ct(Na). &#x00394;Ct(C), Ct value of &#x003B2;-actin was subtracted from that of CDK10 of tumor. Bar value represents CDK10 mRNA level of tumor samples. Bar values &lt;-1 indicate that the expression of CDK10 is decreased in tumors. Bar values &gt;1 indicate that the expression of CDK10 is increased in tumors. (B) Determination of relative CDK10 protein level in 27 different samples (including 9 normal bile duct, 3 ICC, 6 PCC, 3 DECC, 3 GBC and 3 metastasis). Representative data are shown. (C) Expression level of CDK10 protein in different subtypes of BTC and normal bile duct. Student&#x02019;s t-test was used to analyze the difference between the two groups. <sup>&#x0002A;</sup>P&lt;0.05. (D) Real-time PCR of the expression level of CDK10 in tumor cell lines. <sup>&#x0002A;</sup>P&lt;0.05 compared with BEC. (E) Western blot analysis of CDK10 expression in BEC and tumor cell lines. BTC, biliary tract cancer; ICC, intrahepatic cholangiocarcinoma; NBD, normal bile duct; GBC, gallbladder cancer; PCC, perihilar cholangiocarcinoma; DECC, distal extrahepatic cholangiocarcinoma; M, metastases; BEC, biliary epithelial cells. &#x003B2;-actin was employed as an internal control for western blot analysis or real-time PCR.</p></caption>
<graphic xlink:href="OR-27-04-1266-g0.gif"/></fig>
<fig id="f2-or-27-04-1266" position="float">
<label>Figure 2</label>
<caption>
<p>Overexpression of CDK10 inhibits BTC cell proliferation. (A) Western blot analysis of CDK10 expression levels in stable transfectants (G-CDK10, H-CDK10 and S-CDK10) and mock (G-M, H-M and S-M) of three different cell lines (GBC-SD, HCCC-9180 and SSP25). (B) Real-time PCR analysis of CDK10 mRNA level in HCCC-9180 transfected with different siRNA or control RNA. <sup>&#x0002A;</sup>P&lt;0.05 vs. the cells transfected with control RNA. (C) Three different cells lines were transfected with siRNA (si-3) or control RNA, respectively. Seventy-two hours after transfection, western blot analysis was performed confirm the effect of transfection. (D and E) The proliferation of GBC-SD and HCCC-9180 were examined by MTT assays at different time points after transfection with RNA oligonucleotide (CDK10-siRNA or si-control) or plasmid DNA (CDK10 or Mock). The data are presented as mean &#x000B1; SD. <sup>&#x0002A;&#x0002A;&#x0002A;</sup>P&lt;0.001 vs. mock cells. <sup>&#x00023;</sup>P&lt;0.05; <sup>&#x00023;&#x00023;&#x00023;</sup>P&lt;0.001 vs. cells transfected with si-control RNA. (F and G) The protein expression levels of PCNA in GBC-SD and HCCC-9180 were examined by western blot analysis at 72 h after transfection. BTC, biliary tract cancer. &#x003B2;-actin was employed as an internal control for western blot analysis or real-time PCR.</p></caption>
<graphic xlink:href="OR-27-04-1266-g1.gif"/></fig>
<fig id="f3-or-27-04-1266" position="float">
<label>Figure 3</label>
<caption>
<p>CDK10 inhibits colony formation and migration of BTC cells. (A and B) Overexpression or knockdown of CDK10, respectively, inhibited or promoted colony formation. Colonies were counted only if a single clone contained &gt;50 cells in the 21 days after seeding. <sup>&#x0002A;</sup>P&lt;0.05. (C) Wound healing assay was used to identify the role of CDK10 in migration. Both GBC-SD and HCCC-9180 were used in this analysis. BTC, biliary tract cancer.</p></caption>
<graphic xlink:href="OR-27-04-1266-g2.gif"/></fig>
<fig id="f4-or-27-04-1266" position="float">
<label>Figure 4</label>
<caption>
<p>Overexpression of CDK10 decreases the survivability of BTC cells to chemotherapy, serum starving and hypoxia. (A and B) The cell viability assay was performed in both CDK10-overexpressing and CDK10-silenced cells in the 48 h after treated with chemotherapeutic drugs. GBC-SD, HCCC-9180 and SSP25 were treated with 5-FU. GBC-SD, HCCC-9180 were treated with EADM, CDDP and HCPT. All the data are presented as mean &#x000B1; SD of four determinations/experiment from three separate experiments. <sup>&#x0002A;</sup>P&lt;0.05 compared with mock cells; <sup>&#x00023;</sup>P&lt;0.05 vs. the cells transfected with control RNA. (C and D) Forty-eight hours after exposed to 5-FU (200 mg/l), the colony forming assay was performed to confirm the result of cell viability assay. Colonies were counted in accordance with aforementioned criteria. <sup>&#x0002A;&#x0002A;</sup>P&lt;0.01; <sup>&#x0002A;&#x0002A;&#x0002A;</sup>P&lt;0.001. (E and F) Serum-dependence growth assays and hypoxia-tolerant assays were performed in CDK10-overexpressed cells (G-CDK10 and H-CDK10) and mock cells. (G-M and H-M). MTT assays were used to examine viable cells. Data shown are the mean &#x000B1; SD of three independent experiments. <sup>&#x0002A;&#x0002A;&#x0002A;</sup>P&lt;0.001 vs. G-M cells; <sup>&#x00023;&#x00023;&#x00023;</sup>P&lt;0.001 vs. H-M cells. BTC, biliary tract cancer; 5-FU, 5-fluorouracil; EADM, epidoxorubicin; CDDP, cisplatin; HCPT, hydroxycamptothecin.</p></caption>
<graphic xlink:href="OR-27-04-1266-g3.gif"/></fig>
<fig id="f5-or-27-04-1266" position="float">
<label>Figure 5</label>
<caption>
<p>Resistance to 5-FU in CDK10-overexpressed cells is characterized by increased 5-FU-induced G<sub>1</sub> arrest. (A and B) Stable transfectants of both GBC-SD (A) and HCCC-9180 (B) were used in the analysis. Cell cycle profiles were assessed by propidium iodide (PI) staining and fluorescence-activated cell scanning (FACScan) from cell aliquots taken both before and after treatment with 5-FU. (C) Absolute differences were calculated by subtracting the percentage of cells in each phase of the cell cycle before 5-FU treatment from the percentage of cells in each phase after 5-FU treatment. Significant differences in G<sub>1</sub> and S phases after 5-FU treatment were observed in two kinds of CDK10-overexpressing cells, indicating increased 5-FU-induced G<sub>1</sub> arrest. Data shown are the mean &#x000B1; SD of three independent experiments. Data shown are the mean &#x000B1; SD. <sup>&#x0002A;</sup>P&lt;0.05 vs. mock cells (G-M and H-M, respectively).</p></caption>
<graphic xlink:href="OR-27-04-1266-g4.gif"/></fig>
<fig id="f6-or-27-04-1266" position="float">
<label>Figure 6</label>
<caption>
<p>CDK10 is a negative regulator of expression of c-RAF in BTC. (A and B) Real-time PCR was performed to examine the expression level of six genes which were supposed to be regulated by CDK10. <sup>&#x0002A;</sup>P&lt;0.05 vs. mock cells; <sup>&#x00023;</sup>P&lt;0.05 vs. cells transfected with si-control RNA. (C) Western blot analysis of CDK10 expression levels in CDK10-overexpressed and CDK10-silenced cells. (D) Real-time PCR showed the expression level of c-RAF in BTC samples and normal samples. The data are presented as &#x00394;Ct(Na)-&#x00394;Ct(C) in accordance with the defined in <xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1A</xref>. (E) Increased c-RAF is correlated with decreased CDK10 in BTC. Both CDK10 and c-RAF mRNA expression levels of all clinical samples were shown in the panel. Inversely correlated samples were counted only if CDK10 value was &lt;-1 and c-RAF value was &gt;1 at the same time (second quadrant). Correlation coefficient (R) between c-RAF and CDK10 mRNA levels was calculated in inversely correlated samples. BTC, biliary tract cancer. &#x003B2;-actin was employed as an internal control for western blotting or real-time PCR.</p></caption>
<graphic xlink:href="OR-27-04-1266-g5.gif"/></fig>
<table-wrap id="tI-or-27-04-1266" position="float">
<label>Table I</label>
<caption>
<p>Primer sequences.</p></caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="bottom">Symbol</th>
<th align="center" valign="bottom">Forward (5&#x02032;-3&#x02032;)</th>
<th align="center" valign="bottom">Reverse (5&#x02032;-3&#x02032;)</th></tr></thead>
<tbody>
<tr>
<td align="left" valign="top">CDK10</td>
<td align="left" valign="top">TGGACAAGGAGAAGGATG</td>
<td align="left" valign="top">CTGCTCACAGTAACCCATC</td></tr>
<tr>
<td align="left" valign="top">ACTB</td>
<td align="left" valign="top">CAGCACAATGAAGATCAAGATC</td>
<td align="left" valign="top">GTGTAACGCAACTAAGTCATAG</td></tr>
<tr>
<td align="left" valign="top">RAF1</td>
<td align="left" valign="top">TCAGGAATGAGGTGGCTGTTCTG</td>
<td align="left" valign="top">CTCGCACCACTGGGTCACAATT</td></tr>
<tr>
<td align="left" valign="top">TP53</td>
<td align="left" valign="top">CCTCAGCATCTTATCCGAGTGG</td>
<td align="left" valign="top">TGGATGGTGGTACAGTCAGAGC</td></tr>
<tr>
<td align="left" valign="top">BID</td>
<td align="left" valign="top">TGGGACACTGTGAACCAGGAGT</td>
<td align="left" valign="top">GAGGAAGCCAAACACCAGTAGG</td></tr>
<tr>
<td align="left" valign="top">ABCC2</td>
<td align="left" valign="top">GCCAACTTGTGGCTGTGATAGG</td>
<td align="left" valign="top">ATCCAGGACTGCTGTGGGACAT</td></tr>
<tr>
<td align="left" valign="top">ABCB1</td>
<td align="left" valign="top">GCTGTCAAGGAAGCCAATGCCT</td>
<td align="left" valign="top">TGCAATGGCGATCCTCTGCTTC</td></tr>
<tr>
<td align="left" valign="top">ABCB11</td>
<td align="left" valign="top">TTACAAGAACTCCAGATTCC</td>
<td align="left" valign="top">TGATAAGTACTGCGACAGC</td></tr></tbody></table></table-wrap>
<table-wrap id="tII-or-27-04-1266" position="float">
<label>Table II</label>
<caption>
<p>Relationship between CDK10 or c-RAF expression and clinicopathological features of biliary tract cancer.</p></caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="bottom"/>
<th align="center" valign="bottom"/>
<th colspan="4" align="center" valign="bottom">CDK10</th>
<th colspan="4" align="center" valign="bottom">c-RAF</th></tr>
<tr>
<th align="left" valign="bottom"/>
<th align="center" valign="bottom"/>
<th colspan="4" align="left" valign="bottom">
<hr/></th>
<th colspan="4" align="left" valign="bottom">
<hr/></th></tr>
<tr>
<th align="left" valign="bottom">Variables</th>
<th align="center" valign="bottom">N</th>
<th align="center" valign="bottom">Low</th>
<th align="center" valign="bottom">Moderate</th>
<th align="center" valign="bottom">High</th>
<th align="center" valign="bottom">P-value</th>
<th align="center" valign="bottom">Low</th>
<th align="center" valign="bottom">Moderate</th>
<th align="center" valign="bottom">High</th>
<th align="center" valign="bottom">P-value</th></tr></thead>
<tbody>
<tr>
<td colspan="10" align="left" valign="top">Gender</td></tr>
<tr>
<td align="left" valign="top">&#x02003;Male</td>
<td align="right" valign="top">34</td>
<td align="right" valign="top">28</td>
<td align="center" valign="top">4</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">0.311</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">1</td>
<td align="right" valign="top">32</td>
<td align="center" valign="top">0.213</td></tr>
<tr>
<td align="left" valign="top">&#x02003;Female</td>
<td align="right" valign="top">13</td>
<td align="right" valign="top">8</td>
<td align="center" valign="top">3</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top"/>
<td align="center" valign="top">1</td>
<td align="center" valign="top">2</td>
<td align="right" valign="top">10</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Age (years)</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&#x02265;60</td>
<td align="right" valign="top">17</td>
<td align="right" valign="top">14</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0.776</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">1</td>
<td align="right" valign="top">14</td>
<td align="center" valign="top">0.158</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&lt;60</td>
<td align="right" valign="top">30</td>
<td align="right" valign="top">22</td>
<td align="center" valign="top">5</td>
<td align="center" valign="top">3</td>
<td align="center" valign="top"/>
<td align="center" valign="top">0</td>
<td align="center" valign="top">2</td>
<td align="right" valign="top">28</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Tumor location</td></tr>
<tr>
<td align="left" valign="top">&#x02003;ICC</td>
<td align="right" valign="top">6</td>
<td align="right" valign="top">6</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0.711</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">6</td>
<td align="center" valign="top">0.695</td></tr>
<tr>
<td align="left" valign="top">&#x02003;PCC</td>
<td align="right" valign="top">20</td>
<td align="right" valign="top">15</td>
<td align="center" valign="top">4</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top"/>
<td align="center" valign="top">1</td>
<td align="center" valign="top">3</td>
<td align="right" valign="top">16</td>
<td align="center" valign="top"/></tr>
<tr>
<td align="left" valign="top">&#x02003;DECC</td>
<td align="right" valign="top">12</td>
<td align="right" valign="top">9</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top"/>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">11</td>
<td align="center" valign="top"/></tr>
<tr>
<td align="left" valign="top">&#x02003;GBC</td>
<td align="right" valign="top">5</td>
<td align="right" valign="top">3</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top"/>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">5</td>
<td align="center" valign="top"/></tr>
<tr>
<td align="left" valign="top">&#x02003;Metastases</td>
<td align="right" valign="top">4</td>
<td align="right" valign="top">3</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top"/>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">4</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Histology type</td></tr>
<tr>
<td align="left" valign="top">&#x02003;Adenoma</td>
<td align="right" valign="top">42</td>
<td align="right" valign="top">34</td>
<td align="center" valign="top">5</td>
<td align="center" valign="top">3</td>
<td align="center" valign="top">0.122</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">3</td>
<td align="right" valign="top">38</td>
<td align="center" valign="top">0.159</td></tr>
<tr>
<td align="left" valign="top">&#x02003;Non-adenoma</td>
<td align="right" valign="top">5</td>
<td align="right" valign="top">2</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top"/>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">4</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Lymph node invasion</td></tr>
<tr>
<td align="left" valign="top">&#x02003;Present</td>
<td align="right" valign="top">26</td>
<td align="right" valign="top">25</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top"><bold>0.002</bold></td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">26</td>
<td align="center" valign="top"><bold>0.031</bold></td></tr>
<tr>
<td align="left" valign="top">&#x02003;Absent</td>
<td align="right" valign="top">21</td>
<td align="right" valign="top">11</td>
<td align="center" valign="top">6</td>
<td align="center" valign="top">4</td>
<td align="center" valign="top"/>
<td align="center" valign="top">2</td>
<td align="center" valign="top">3</td>
<td align="right" valign="top">16</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">TNM staging</td></tr>
<tr>
<td align="left" valign="top">&#x02003;I&#x02013;II</td>
<td align="right" valign="top">15</td>
<td align="right" valign="top">6</td>
<td align="center" valign="top">6</td>
<td align="center" valign="top">3</td>
<td align="center" valign="top"><bold>&lt;0.001</bold></td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">3</td>
<td align="right" valign="top">12</td>
<td align="center" valign="top"><bold>0.023</bold></td></tr>
<tr>
<td align="left" valign="top">&#x02003;II&#x02013;IV</td>
<td align="right" valign="top">32</td>
<td align="right" valign="top">30</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top"/>
<td align="center" valign="top">2</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">30</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Serum CEA level (ng/ml)</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&gt;5</td>
<td align="right" valign="top">10</td>
<td align="right" valign="top">10</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0.144</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">9</td>
<td align="center" valign="top">0.407</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&#x02264;5</td>
<td align="right" valign="top">37</td>
<td align="right" valign="top">26</td>
<td align="center" valign="top">7</td>
<td align="center" valign="top">4</td>
<td align="center" valign="top"/>
<td align="center" valign="top">1</td>
<td align="center" valign="top">3</td>
<td align="right" valign="top">33</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Serum CA19-9 level (U/ml)</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&gt;37</td>
<td align="right" valign="top">31</td>
<td align="right" valign="top">28</td>
<td align="center" valign="top">3</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top"><bold>0.003</bold></td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">1</td>
<td align="right" valign="top">28</td>
<td align="center" valign="top">0.292</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&#x02264;37</td>
<td align="right" valign="top">16</td>
<td align="right" valign="top">8</td>
<td align="center" valign="top">4</td>
<td align="center" valign="top">4</td>
<td align="center" valign="top"/>
<td align="center" valign="top">0</td>
<td align="center" valign="top">2</td>
<td align="right" valign="top">14</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Differentiation</td></tr>
<tr>
<td align="left" valign="top">&#x02003;G1</td>
<td align="right" valign="top">9</td>
<td align="right" valign="top">6</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0.182</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">3</td>
<td align="right" valign="top">5</td>
<td align="center" valign="top"><bold>0.003</bold></td></tr>
<tr>
<td align="left" valign="top">&#x02003;G2</td>
<td align="right" valign="top">19</td>
<td align="right" valign="top">12</td>
<td align="center" valign="top">4</td>
<td align="center" valign="top">3</td>
<td align="center" valign="top"/>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">19</td>
<td align="center" valign="top"/></tr>
<tr>
<td align="left" valign="top">&#x02003;G3</td>
<td align="right" valign="top">19</td>
<td align="right" valign="top">18</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top"/>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">18</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">HBV infection</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&#x0002B;</td>
<td align="right" valign="top">23</td>
<td align="right" valign="top">17</td>
<td align="center" valign="top">4</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">0.890</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">23</td>
<td align="center" valign="top">0.068</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&#x02212;</td>
<td align="right" valign="top">24</td>
<td align="right" valign="top">19</td>
<td align="center" valign="top">3</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top"/>
<td align="center" valign="top">2</td>
<td align="center" valign="top">3</td>
<td align="right" valign="top">19</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Metastasis after surgery</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&#x0002B;</td>
<td align="right" valign="top">13</td>
<td align="right" valign="top">11</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0.712</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">11</td>
<td align="center" valign="top">0.135</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&#x02212;</td>
<td align="right" valign="top">14</td>
<td align="right" valign="top">10</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top"/>
<td align="center" valign="top">0</td>
<td align="center" valign="top">2</td>
<td align="right" valign="top">12</td>
<td align="center" valign="top"/></tr>
<tr>
<td colspan="10" align="left" valign="top">Survival (year)</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&gt;1</td>
<td align="right" valign="top">16</td>
<td align="right" valign="top">11</td>
<td align="center" valign="top">2</td>
<td align="center" valign="top">3</td>
<td align="center" valign="top">0.281</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top">2</td>
<td align="right" valign="top">14</td>
<td align="center" valign="top">0.116</td></tr>
<tr>
<td align="left" valign="top">&#x02003;&#x02264;1</td>
<td align="right" valign="top">11</td>
<td align="right" valign="top">10</td>
<td align="center" valign="top">1</td>
<td align="center" valign="top">0</td>
<td align="center" valign="top"/>
<td align="center" valign="top">2</td>
<td align="center" valign="top">0</td>
<td align="right" valign="top">9</td>
<td align="center" valign="top"/></tr></tbody></table>
<table-wrap-foot><fn id="tfn1-or-27-04-1266">
<p>The CDK10 or c-RAF expression level of clinical samples was defined in accordance with the criteria mentioned in <xref rid="f1-or-27-04-1266" ref-type="fig">Fig. 1A</xref>. ICC, intrahepatic cholangiocarcinoma; PCC, perihilar cholangiocarcinoma; DECC, distal extrahepatic cholangiocarcinoma; GBC, gallbladder cancer; TNM, tumor-node-metastasis classification according to the AJCC/UICC 7th edition; CEA, carcinoembryonic antigen; CA, carbohydrate antigen; G1, well differentiated; G2, moderately-differentiated; G3, poorly-differentiated; HBV, hepatitis B virus. The &#x003C7;<sup>2</sup> test was used to show differences of categorical variables. P-values in bold show statistically significant differences.</p></fn></table-wrap-foot></table-wrap></floats-group></article>
