Murine type II alveolar epithelial cells (MLE-12) were isolated from female C57BL/6 mice (purchased from the Shanghai Institutes for Biological Sciences Shanghai, China) as described by Corti et al (35). siRNA control and siRNA Malat1 were obtained from Ribo (cat. no. stQ0019997-1; siR-Ribo, lnc., Guangzhou, China). Transfection reagent Lipofectamine 3000 reagent (cat. no. L3000-015; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and transfection media opti-MEM (cat. no. 31985062; Gibco; Thermo Fisher Scientific, Inc.) were purchased from Thermo Fisher Scientific, Inc. MLE-12 cells were seeded at 1×104/cm2 one day before transfection to reach 60–70% density the next day. For one well of 6-well plate, medium was changed to 1 ml empty medium without antibiotics or fetal bovine serum (FBS; cat. no. 10099141; Gibco; Thermo Fisher Scientific, Inc.) approximately 20 min before the transfection. In final experiments, mix A (50 µl opti-MEM/well+ 0.5 µl siRNA/well) and mix B (50 µl opti-MEM/well+2 µl RNAi Max/well) was prepared. The final concentration of siRNA was 50 nM.

BMDCs were generated from C57BL/6 mice as previously described (36). All animal experiments were performed according to protocols approved by the Institutional Committee for Use and Care of Laboratory Animals. In brief, femurs and tibia of mice were resected and washed with phosphate buffered saline (PBS; GNM-20012; GENOM., Ltd., Hangzhou, Zhejiang, China) to obtain bone marrow cells. After incubation with NH4Cl lysing buffer to remove red blood cell (RBC), bone marrow cells were placed in 6-well plates in RPMI-1640 (GNM-31800; GENOM., Ltd.). The cell layer was then gently washed by medium 2 h later to remove non-adhering cells. Adherent cells were incubated in the complete media (RPMI-1640 containing 2 mM L-glutamine (cat. no. 1294808-100MG; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with 10% FBS, 1% of nonessential amino acids (cat. no. 11140050; Gibco; Thermo Fisher Scientific, Inc.), 1% of sodium pyruvate, 20 ng/ml rmGM-CSF (cat. no. 415-ML-010/CF) and 10 ng/ml rmIL-4 (cat. no. 404-ML-010/CF; both R&D Systems, Inc., Minneapolis, MN, USA) for 6 days. Medium was changed every 2 days. On the sixth day, floating adherent cells were collected and used as BMDCs. To induce DCs mature, cells were stimulated with 100 ng/ml LPS (Escherichia coli 055B5; Sigma-Aldrich; Merck KGaA).

The AECs-DCs co-culture model was established as described before (37). In brief, the Malat1 treated MLE-12 cells were incubated for 48 h before cultured on the top of the inverted filter inserts, which were made of polyethylene terephthalate (cat. no. 353092; BD Pharmingen; Franklin Lakes, USA) with pore size of 3 µm, The filters were then reverted and placed into wells with RPMI-based culture media, and DCs suspended in RPMI-based culture media were added to the basal side within the insert well. DCs were harvest after 72 h.

Total RNA was extracted using TRIzol (cat. no. 12183555; Invitrogen; Thermo Fisher Scientific, Inc.) and then reversely transcribed into first-strand cDNA using PrimeScript RT reagent kit with gDNA Eraser (cat. no. RR047A; Takara Biomedical Technology Co., Ltd., Beijing, China) according to manufacturers' instructions. Real-time PCR was performed with Takara premix Ex Taq II (cat. no. DRR820A; Takara Biomedical Technology Co., Ltd.) and was run on CFX96TM Real-Time System (cat. no. 1855195.; Bio-Rad Laboratories, Inc., Hercules, CA, USA) in a total volume of 10 µl containing 5 ul Takara premix Ex Taq II and 5 ng cDNA template. The PCR thermal cycle parameters were as follows: 2 min at 50°C, 30 sec at 95°C and 40 cycles of 95°C for 5 sec and 60°C for 34 sec. Expression of mRNA was normalized to the expression of mouse GAPDH (mGAPDH) and quantified using the 2^−ΔΔCq method (38). Primer pairs for qPCR are listed as follows: mmu F-malat1, 5′GGGCATTTCCATTCCTCTC 3′ and mmu R-malat1, 5′GTCTCTACGGGCACATTAC 3′; mmuF-CD80, 5′ACCCCCAACATAACTGAGTCT3′ and mmuR-CD80, 5′TTCCAACCAAGAGAAGCGAGG3′; mmuF-CD86, 5′TGTTTCCGTGGAGACGCAAG3′ and mmuR-CD86, 5′TTGAGCCTTTGTAAATGGGCA3′; mmuF-IL4, 5′GTTGTCATCCTGCTCTTC3′ and mmuR-IL4, 5′GTTTGGCACATCCATCTC3′; mmuF-IL6, 5′TGGAGCCCACCAAGAACGATAG3′ and mmuR-IL6, 5′TGTCACCAGCATCAGTCCCAAG3′; mmuF-INF-γ, 5′TCAAGTGGCATAGATGTG3′ and mmuR-INF-γ, 5′TGTTGCTGAAGAAGGTAG3′; mmuF-CCL2, 5′TTAAAAACCTGGATCGGAACCAA3′ and mmuR-CCL2, 5′GCATTAGCTTCAGATTTACGGGT3′; mmuF-CCL5, 5′GCTGCTTTGCCTACCTCTCC3′ and mmuR-CCL5, 5′TCGAGTGACAAACACGACTGC3′; mmuF-CXCR4, 5′GACTGGCATAGTCGGCAATG3′ and mmuR-CXCR4, 5′AGAAGGGGAGTGTGATGACAAA3′; mmuF-CXCR2, 5′ATGCCCTCTATTCTGCCAGAT3′ and mmuR-CXCR2, 5′GTGCTCCGGTTGTATAAGATGAC3′; mmuF-GAPDH, 5′CTGCCCAGAACATCATCC3′ and mmuR-GAPDH, 5′CTCAGATGCCTGCTTCAC3′.

Migration chemotaxis assay was performed by applying 24-well Boyden chambers with 8 µm pore size polycarbonate membranes (cat. no. 662638; Greiner Bio-One, Ltd., Frickenhausen, Germany) as described previously. After co-culturing with MEL-12 cells transfected with siRNA control or Malat1 siRNA, DC were seeded onto the upper chamber at 1×105 cells. The bottom chamber contained 600 µl 10% FBS medium with or without 200 ng/ml Chemokine ligand 19 (CCL19). After incubation for 6 h at 37°C, the cells remained on the upper side of the filters were removed by a cotton swab. The migrated cells on the underside of the membrane were fixed with 4% paraformaldehyde (PFA) prior to staining with 0.1% crystal violet solution for 15 min.

DCs were co-cultured for 6 h with MLE-12 cells interfered with siRNA control or Malat1 siRNA, followed by stimulation with LPS and further incubation for 72 h. DCs were detached from the flasks by trypsin (GNM-15050; GENOM., Ltd.), and cell numbers were counted. Cells were then fixed with 4% paraformaldehyde for 15 min at room temperature. After washing with PBS, cells were re-suspended in 5% swine serum and blocked with Fc Receptor Blocking Solution (cat. no. 422301; Biolegend, Inc., San Diego, CA, USA) for 5 min. Aliquots of about 2×105 cells were then incubated with specific antibodies (mouse CD80; cat. no. 561954), CD86 (cat. no. 561962; both BD Biosciences, Franklin Lakes, NJ, USA), MHC-II (cat. no. bs-4107R; Bioss Antibodies, Inc., Woburn, MA, USA), Annexin-V-FITC antibody (cat. no. 70-AP101-100; Multiscience, Hangzhou, Zhejiang, China) and IgG control for 1 h at 4°C. Cells were then washed three times and analyzed with the flow cytometer (BD FACS Canto™ II system). Further analysis was done with Flow Jo. Gating set as less than 1% of marker expression in IgG control group.

DCs were co-cultured with siRNA control or Malat1 siRNA interfered MLE-12 for 6 h, LPS was added and the cells were incubated for another 72 h. To detect the secretion of tumor necrosis factor-α (TNF-α), IL-4, INF-r and IL-6, the cell supernatant was harvest and analyzed by Sandwich Enzyme Immunoassay kits (R&D Systems Europe Ltd., Abingdon, UK) according to the manufacturer's protocol.

DCs were co-cultured with siRNA control or Malat1 siRNA interfered MLE-12 for 6 h, followed by stimulation with LPS and further incubation for 72 h. MTT (cat. no. c0009; Beyotime Institute of Biotechnology, Shanghai, China) of 0.5 mg/ml were then added to each well. After 4 h of incubation at 37°C, cells were treated with 1 ml of dimethyl sulfoxide (cat. no. D2650-5*5ML; Sigma-Aldrich; Merck KGaA) followed by incubation at 37°C overnight. Finally, optical densities were measured at 570 nm, and the growth inhibitory rate was calculated.

10–50 µg of the protein was mixed with a ¼ volume of the boiled 5X SDS loading buffer (cat. no. p0015) and then adjusted to the same volume with 1X SDS loading buffer (cat. no. P0015A; both Beyotime Institute of Biotechnology). The mix was then boiled at 95°C for 10 min before loaded to the NuPage 4–12% Tris-Glycine gel (cat. no. EC60249BOX) immersed in NuPage MOPS SDS running buffer (cat. no. NP0001; both Invitrogen; Thermo Fisher Scientific, Inc.) in a XCell SureLock Mini-Cell (cat. no. NP0335BOX; Thermo Fisher Scientific, Inc.). The gel was run at 160 V for about 75 min until the marker with lowest molecular weight was at the bottom of the gel. Protein was then transferred from the gel to the membrane in 1X transfer buffer for 45 min. The membrane was then blocked with 5% milk in PBS-Tween and incubated with primary antibody diluted in 5% milk at 4°C overnight. After being washed with PBS-Tween for three times with 10 min each, the membrane was incubated with secondary antibody for 1 h at room temperature. Secondary antibodies were HRP-conjugated and purchased from Dako (Polyclonal Rabbit anti-goat, cat. no. 103P0449; Polyclonal Rabbit anti-mouse, cat. no. P0260; Polyclonal Swine anti-rabbit, cat. no. P0217; Dako; Agilent Technologies, Inc., Santa Clara, CA, USA). Further 3 washes were performed before addition of ECL detection solutions. After incubation with the detection solution for 2 min, exposure of the films was carried out with the Compact X4 in the dark room. The bound primary antibodies: Rabbit-anti-mouse-caspase-3 (Ab44976), anti-mouse-Bax (Sc-493), anti-rabbit-Bcl2 (Sc-492), anti-mouse-GAPDH (CST-5174) diluted 1:1,000 in PBST.

Data between two groups with normal distribution were analyzed with unpaired and ungrouped t-tests, and data not normally distributed were analyzed with unpaired and nonparametric Mann-Whitney U test. Data across multiple groups were analyzed with one-way ANOVA test, followed by Bonferroni post-hoc analysis if P<0.05. Data were shown as the mean ± standard error of mean (SEM) and graphs were generated using GraphPad Prism 6 software. P<0.05 was considered to indicate a statistically significant difference (*P<0.05; **P<0.01 and ***P<0.001).

The tracheal epithelial cells have been found to regulate the gene expression in BMDCs (39), but whether these respiratory epithelial cell could modulate the long-non coding RNA expression is unclear. To contact the DCs with alveolar epithelial cells (MLE-12), MLE-12 cells were cultured on top of inverted filter inserts. The filters were then reverted and placed into wells containing RPMI-1640 media. The DCs stimulated with or without LPS were suspended in media and added to the basal side of the insert well (Fig. 1A), We term this system as AECs-conditioned DCs system. After 48 h, the expression of Malat1 in AECs was detected. The Malat1 expression was significantly enhanced in this co-culture system regardless of LPS addition (Fig. 1B and C). Furthermore, to elucidate the regulatory role of Malat1 in AECs-conditioned DCs, we used a chemically synthesized Malat1 inhibitor (Malat1 siRNA) to suppress the Malat1 expression. Fig. 1D revealed the significant diminution of Malat1 expression after the Malat1 knockdown in MLE-12 cells.

Immature DCs can assimilate antigens efficiently but express low levels of costimulatory molecules. Upon maturation, DCs dramatically augment their ability to stimulate naive T cells through the surface exposure of antigen-MHC complexes and increased expression of costimulatory molecule. Following co-culture for 48 h with AECs that had been treated with Malat1 silencing, the DCs were harvested to detect the specific maturity surface marker by real-time PCR and FACS. Our results showed that some surface molecules (CD80, CD86, and MHCII) of the AECs-conditioned DCs were upregulated in response to incubation with Malat1 inhibitor, both at the protein (Fig. 2A-F) and mRNA levels (Fig. 2G), implying Malat1 can partly induce the maturation of DCs cultured in AECs-conditioned system.

The cytokine secreted by DCs plays a vital role during T cell polarization. To investigate the functional role of Malat1 in AECs-conditioned DCs, levels of certain inflammatory cytokines were analyzed. The Malat1 inhibitor increased the secretion of some inflammatory cytokines by DCs such as TNF-alpha, IL-6, and IFN-γ significantly (more than 3–5 fold at the RNA level and approximately 2 fold at the protein level) (Fig. 3). By contrast, IL-4 expression was slightly downregulated by Malat1 inhibitor (50% off) (Fig. 3). These results indicated that Malat1 could affect the inflammatory response of AECs-conditioned DCs.

We also detected the expression of chemokines in the AECs-conditioned DCs. The Malat1 siRNA dramatically increased the secretion of chemokines, such as CXCR2 and CXCR4, in AECs-conditioned DCs, both at the mRNA and protein levels (Fig. 4A-D). Given that Malat1 siRNA-treated MLE-12 significantly increased the chemokine expression of DCs, we further performed Transwell assay to confirm the effect of Malat1 on the chemotaxis of co-cultured DCs. As expected, the Malat1 siRNA-treated MLE-12 also remarkably induced DC chemotaxis (Fig. 4E). All these results suggested that Malat1 could affect the chemokine secretion and chemotaxis of AECs-conditioned DCs.

To explore the effect of Malat1 knockdown on the apoptosis of AECs-conditioned DCs, the apoptosis marker Annexin V in the DCs was detected by flow cytometry. Compared with siRNA control group, the mean apoptotic cell fractions (early apoptotic + late apoptotic) were significantly decreased, and viable cell populations were significantly decreased upon Malat1 inhibition (P=0.04) (Fig. 5A-D). Expression of apoptotic markers, such as caspase-3, Bax, and Bcl2, in the co-cultured DCs was decreased after transfection with Malat1 siRNA (Fig. 5E). Meanwhile, we detected the effect of Malat1 on the viability of AECs-conditioned DCs by using MTT assay, Our results found that the Malat1 siRNA slightly induced cell viability (18.2±1.3%) as compared to the control group at 72 h (Fig. 5F), indicating an apoptotic-inducing role of Malat1 in AECs-conditioned DCs.