Human tumor tissues and sera were obtained from the Department of Pathology and the Korean National Biobank, Pusan National University Hospital after diagnosis and staging. The tissues were frozen in liquid nitrogen and stored at −80°C until use. The human hepatoma cell lines SNU-354, SNU-398, SNU-423, SNU-449, SNU-475, and HepG2; human colon cancer cell lines SNU-C1, SNU-C2A, SNU-C4, and SNU-C5; and the human ovarian cancer cell lines SNU-8 and SNU-840 were obtained from the Korean Type Culture Collection (KTCC) and the American Type Culture Collection (ATCC). All cell lines were maintained in RPMI-1640 (Gibco-BRL Life Technologies Inc., Grand Island, NY, USA) medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin.

Total RNA was isolated from human tissue samples and human tumor cell lines using the standard TRIzol reagent (Life Technologies, Gaithersburg, MD, USA) and RNA isolation kit (RNeasy Maxi kit, Qiagen) following manufacturer’s instructions. Normal tissue total RNA was purchased from Clontech Laboratories, Inc. (Palo Alto, CA, USA) and Ambion, Inc. (Austin, TX, USA). Total RNA from several cancer cell lines used in this experiment was obtained from the Ludwig Institute for Cancer Research (LICR), New York Branch at the Memorial Sloan-Kettering Cancer Center.

Poly(A)+ RNA from normal testis was purchased from Clontech Laboratories, Inc. Five micrograms of mRNA was used to construct a cDNA library in the ZAP Express vector (Stratagene, La Jolla, CA, USA), following the manufacturer’s instructions. The library contained ~1,000,000 recombinants, and was used for immunoscreening without prior amplification. Sera from 3 HCC patients were pooled and absorbed. The pooled serum was diluted 1:200 (final dilution, 1:600 for each serum) in Tris-buffered saline (TBS) containing 1% BSA. The patients ages ranged from 74–79 years, all 3 were male, and all patients had stage I/II HCC. In addition to this pooled serum, all sera from HCC patients and healthy individuals in this study were diluted 1:200. To remove serum antibodies that react with Escherichia coli/bacteriophage-related antigens, sera were absorbed against E. coli/bacteriophage lysates as described by Lee et al (25).

Immunoscreening of the cDNA library was performed as previously described (15,22). Briefly, E. coli XL1 blue MRF cells were transfected with the recombinant phages, plated at a density of approximately 5,000 pfu/150-mm plate (NZCYM-IPTG agar), incubated for 8 h at 37°C, and then transferred to nitrocellulose filters (PROTRAN BA 85, 0.45 μm; Schleicher & Schuell, Keene, NH, USA). Then the filters were incubated with a 1:200 dilution of patient sera, which had been preabsorbed to E. coli-phage lysate. The serum-reactive clones were detected with an AP-conjugated secondary antibody and visualized by incubation with 5-bromo-4-chloro-3-indolyl-phosphate/nitroblue tetrazolium (BCIP/NBT). After screening, the isolated positive clones were removed from the plate and preserved in suspension medium (SM) buffer with 25 μl of chloroform. Positive phages were mixed with a helper phage to co-infect XL-1 Blue MRF, and they were rescued into pBluescript phagemid forms by in vivo excision. The excised phagemids were transformed into the host bacteria (XLOLR) to multiply for plasmid extraction and stock creation. The size of the inserted cDNA was determined primarily by double restriction enzyme digestion with EcoRI and XhoI. The cDNA was commercially sequenced (Macrogen, Korea).

The cDNA used as templates for RT-PCR reactions was prepared with 1 μg of total RNA using the Superscript first strand synthesis kit (Invitrogen Life Technologies, Carlsbad, CA, USA). The PCR primers specific for AKAP3 and CTp11 were CTAACTTCGGCCTTCCCAGA (forward)/AGTGG GGTTGCCGATTACAG (reverse) and GGCGGGGTGAA GAGGAGCGT (forward)/ACACAGCCATCAGCTTCTC AAACTT (reverse), respectively. The cDNA templates were normalized based on the amplification of GAPDH. For PCR, a 20-μl reaction mixture, including 2 μl of cDNA, 0.2 mM dNTPs, 1.5 mM MgCl₂, 0.25 μM gene-specific forward and reverse primers, and 3 U of Taq DNA polymerase (Solgent, Daejun, Korea), was preheated to 94°C for 5 min, followed by 35 cycles of 94°C for 30 sec, 60°C for 30 sec, and 72°C for 1 min, with a final elongation step of 72°C for 5 min. Amplified PCR products were analyzed on 1.5% agarose gels stained with ethidium bromide.

To determine the immunoreactivity of the isolated clones, a phage plaque assay was performed as described previously (16). Briefly, phage from a positive clone were mixed with -ZAP clone without an insert as an internal negative control at a ratio 1:1, and then transfected into E. coli. Plaques were blotted onto nitrocellulose membranes and washed. Next, they were incubated with sera at 4°C for 16 h. The spots were determined to be positive only if the tested clones were clearly distinguishable from the negative phage.

A testis cDNA expression library of ~2×10⁵ clones was immunoscreened with pooled sera from HCC patients. Three clones representing 4 genes were isolated, and the antigens were AKAP3, CTp11, and UBQLN3. These 3 genes are associated with testis specific expression in the UniGene database. Comparison of the cDNA sequences encoding the antigens to those deposited in cancer immunome database showed that AKAP3 had been previously identified as NY-TLU-37 in lung cancer patients (26), while CTp11 and UBQLN3 had not been previously reported (Table I).

To investigate the restricted expression of the mRNAs of the 3 genes in normal adult tissues, we performed conventional RT-PCR. As shown in Fig. 1, AKAP3 was strongly expressed in testis, but was weakly expressed in brain and kidney. In addition, expression of CTp11 and UBQLN3 mRNAs was restricted to the testis. The AKAP3 gene was expressed broadly and frequently in various cancer cell lines and cancer tissues, including HCC (6/7 and 5/10), colon cancer (3/10 and 5/6), lung cancer (4/7 and 6/13), ovarian cancer (6/8 and 11/16), and breast cancer (3/6 and 6/9), respectively (Fig. 2). In addition, AKAP3 mRNA was detected in melanoma cancer cell lines (1/8), renal cancer cell lines (2/2), leukemia cancer cell lines (2/3), sarcoma cell lines (2/3), and a glioma cell line (1/2), but it was not detected in prostate cancer cell lines and small cell lung cancer cell lines (Table II). In addition, CTp11 was expressed in HCC cell lines and cancer tissues (5/8 and 1/9, respectively) and lung cancer cell lines and cancer tissues (4/10 and 2/13, respectively) (Fig. 3). However, CTp11 was either not expressed or infrequently expressed in various tumors and cancer cell lines, including breast cancer, colon cancer, and ovary cancer (Table II). These results indicate that AKAP3 is a CT antigen that is frequently expressed in a variety of cancers, including HCC.

To determine whether immune recognition of AKAP3, CTp11, and UBQLN3 proteins was cancer-related, allogeneic sera samples obtained from 27 normal blood donors and 27 patients with HCC were tested for reactivity by phage plaque assay. A representative phage plaque assay from the sera of HCC patients is shown in Fig. 4. Fifteen of 27 (63%) sera samples from HCC patients and 8/27 (30%) samples from normal patients were reactive against AKAP3. In contrast, 1 of 27 HCC cancer sera samples reacted with CTp11 and UBQLN3, while none with sera samples from normal individuals reacted with CTp11 and UBQLN3. Although 8/27 heath donors were positive for AKAP3 reactivity, 63% recognition by sera from HCC patients indicates that it may be an immunogenic tumor antigen.