OR Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 10.3892/or.2012.2098 or-29-01-0226 Articles Correlation of telomere length shortening with TP53 somatic mutations, polymorphisms and allelic loss in breast tumors and esophageal cancer HAOXIAO-DAN134 YANGYUE57 SONGXIN6 ZHAOXUE-KE6 WANGLI-DONG6 HEJUN-DONG1410 KONGQING-PENG14 TANGNELSON LEUNG SANG489 ZHANGYA-PING124 State Key Laboratory of Genetic Resources and Evolution, and Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming Laboratory for Conservation and Utilization of Bioresources, Yunnan University, Kunming Graduate School of the Chinese Academy of Sciences, Beijing KIZ/CUHK Joint Laboratory of Bioresources and Molecular Research in Common Diseases, Kunming Department of the Breast, First People's Hospital of Kunming, Kunming Henan Key Laboratory for Esophageal Cancer Research, The First Affiliated Hospital of Zhengzhou University, Zhengzhou Affiliated Ganmei Hospital, Kunming Medical University, Kunming Department of Chemical Pathology, Faculty of Medicine, The Chinese University of Hong Kong, Hong Kong, SAR Laboratory of Genetics of Disease Susceptibility, Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong, Hong Kong, SAR School of Life Sciences, University of Science and Technology of China, Hefei, P.R. China Correspondence to: Dr Ya-Ping Zhang, State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, P.R. China, E-mail: zhangyp@mail.kiz.ac.cn. Dr Nelson Leung Sang Tang, Laboratory of Genetics of Disease Susceptibility, Li Ka Shing Institute of Health Sciences and Department of Chemical Pathology, The Chinese University of Hong Kong, Hong Kong, SAR, P.R. China, E-mail: nelsontang@cuhk.edu.hk 22 10 2012 1 2013 29 1 226 236 20 07 2012 07 09 2012 Copyright © 2013, Spandidos Publications 2013 This is an open-access article licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. The article may be redistributed, reproduced, and reused for non-commercial purposes, provided the original source is properly cited.

Genomic instability caused by telomere erosion is an important mechanism of tumorigenesis. p53 plays a key role in cellular senescence and/or apoptosis associated with telomere erosion which positions p53 as a guard against tumorigenesis. The present study was undertaken to investigate the potential interactions between p53 functional mutations, polymorphisms, allelic loss and telomere erosion in 126 breast tumor patients and 68 esophageal cancer patients. Telomere length (TL) was measured by real-time quantitative PCR. Somatic mutations, polymorphisms and allelic loss in the TP53 gene were detected by direct sequencing of both tumor and normal tissue samples. Our results showed that telomeres were significantly shorter in tumors with somatic p53 mutations compared with tumors with wild-type p53 in both breast tumors (P=0.007) and esophageal cancer (P=0.001). Telomeres of patients with minor genotype CC of rs12951053 and GG of rs1042522 were significantly shorter compared to patients with other genotypes of this single nucleotide polymorphism in esophageal cancer tissue. Furthermore, TP53 allelic loss was detected and significantly associated with somatic mutations in both types of tumor tissues. These findings suggest that somatic p53 mutations, rs12951053 genotype CC and rs1042522 genotype GG contribute to erosion of telomeres, and TP53 allelic loss may be one of the representations of chromosomal instability caused by telomere erosion combined with somatic p53 mutations. These results support that the TP53 gene has a strong interaction with TL erosion in tumorigenesis.

 telomere erosion TP53 variations allelic loss breast tumor esophageal cancer Introduction

Telomeres are special structures consisting of a stretch of very simple tandemly repeated sequences and telomere structural proteins at the terminal of chromosomes (1). Their main function is to cap the chromosome ends and prevent chromosomal instability, while the erosion of telomeres can lead to genetic instability, a pivotal mechanism in the neoplastic process (2,3). Because of incomplete replication of the termini of linear DNA molecules, telomeric DNA is progressively lost with each cell division (4,5). Telomere shortening reaching a critically short length can activate DNA damage checkpoints and result in induction of cellular senescence (6). The first checkpoint in response to telomere shortening is a p53-dependent, permanent cell cycle arrest. p53 plays a key role in cellular senescence and/or apoptosis associated with telomere dysfunction (7). It may prevent entry into mitosis with uncapped telomeres (8), and intact p53 signaling could be a prerequisite for induction of senescence and/or apoptosis in response to critical telomere shortening (9). When p53 is mutated or deleted, p53-dependent responses to telomere dysfunction are mitigated and chromosomal fusions are tolerated. This results in chromosome breakage and genomic copy number alterations (CNAs) and drives development of carcinomas (3,10). These all position p53 as the guard against tumorigenesis caused by telomere dysfunction.

TP53 is a tumor-suppressor gene, whose mutations and loss of heterozygosity (LOH) are hallmarks of most human cancers (11,12). Mutations in the coding sequence can cause dramatic defects in p53 function, and some polymorphisms in the TP53 locus might have phenotypic manifestations (13,14). LOH has emerged as the second hit in tumor initiation which serves to inactivate or eliminate the wild-type allele at the tumor-suppressor gene locus (12,15,16). These mutations, polymorphisms or allelic loss (or LOH) that may change p53 function have a relationship with telomere erosion and tumorigenesis.

Both breast and esophageal cancers are the most common tumors. However, no study has previously investigated the relationship between TP53 gene variants and telomere length (TL) in breast tumor and esophageal cancer. The relationships between TP53 mutations, polymorphisms, allelic loss and TL are still largely undefined. The present study, which investigated the TP53 gene and TL from 126 Chinese breast tumor patients and 68 Chinese esophageal cancer patients, was aimed at investigating the potential interaction between p53 functional mutations, polymorphisms, allelic loss and telomere erosion. This study may help us better understand the molecular mechanism of tumorigenesis, which should lead to improved screening and treatment of cancer.

 Materials and methods Study population

A total of 126 breast tumor patients and 68 esophageal cancer patients of Chinese ancestry were included in the present study. All of the breast tumor samples, including 45 malign and 81 benign breast tumor samples, were consecutively collected from the Yunnan Province. Breast tumor tissue and a blood sample from each patient were collected for genomic DNA extraction and genotyping. Sixty-eight esophageal cancer specimens were consecutively collected from the Henan Province. For esophageal cancer patients, each cancer tissue and normal tissue were collected for study. Written consent was obtained from all participants, in accordance with protocols approved by the institutional review board at each contributing center.

 Telomere measurement

Genomic DNA was isolated from whole blood samples and tissues by standard phenol/chloroform method. Relative telomere length was measured on extracted DNA using real-time quantitative PCR (17,18) with minor modifications. Standard curves for TL and single-copy gene (reference gene) were used to transform cycle threshold into nanograms of DNA. Triplicate PCR reactions were performed in 20 μl reactions comprising 8 μl template DNA, 2 μl primer mixture and 10 μl SYBR® Premix Ex Taq™ (Takara, Dalian, China). The final telomere and 36B4 primer concentrations were 0.2 and 0.3 μM. The primer sequences were as previously described (18). The reaction mixture was initially denatured at 95°C for 2 min followed by 40 cycles of 95°C for 5 sec, 58°C for 10 sec, and 72°C for 40 sec for the 36B4 reaction, or 25 cycles of 95°C for 5 sec, 56°C for 10 sec, and 72°C for 60 sec for the telomere reaction. All PCRs were performed using a 96-well formatted LightCycler® 480 Real-Time PCR system (Roche Applied Science), and results were obtained and analyzed using the LightCycler® 480 onboard software (version 1.5).

 Mutational screening and genotyping of TP53

According to the TP53 somatic mutations database (IARC TP53 database, http://www-p53.iarc.fr, R15 release) (11), 96% of somatic mutations are located in exons 3–9 of the gene. Thus, we sequenced parts of the TP53 gene to discover somatic mutations and other variations. Exons 3–9 and respective intron-exon boundaries were included. Primers for PCR and sequencing are listed in Table I. PCR was carried out in 25 μl of reaction containing 1X LA PCR Buffer II (Mg2+ Plus), 20 ng DNA, 0.5 μM each of the primers, 0.4 mM each of deoxynucleotide triphosphate, and 1.25 U of LA Taq DNA polymerase (Takara). The reaction mixture was denatured at 95°C for 5 min followed by 10 cycles of 1 min of denaturation at 94°C, 1 min of reannealing at 60-50°C (decreased by 1°C every cycle), and 4 min of extension at 72°C; 25 cycles of 1 min of denaturation at 94°C, 1 min of reannealing at 50°C and 4 min of extension at 72°C. The PCR was completed by a final extension at 72°C for 10 min. The products were purified with gel extraction kits (Watson BioMedical Inc., Shanghai, China) and were subjected to direct DNA sequencing using the BigDye® Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA). Sequences were aligned and analyzed with DNAStar software package (DNAStar Inc., Madison, WI, USA). For the malign breast tumors and esophageal cancer patients, both tissues for each patient were sequenced. For the benign breast tumor patients that had variations not included in the known polymorphisms, whole blood samples were also sequenced. All somatic mutations found by direct sequencing of PCR products were confirmed by sequencing of a second, independent PCR product. All sequences were submitted to GenBank (accession no. JQ751320-JQ752243).

All polymorphisms in each individual were detected and confirmed by sequencing the corresponding regions in both tissues. Allelic loss was determined by comparing tumor and normal single nucleotide polymorphism (SNP) allele types. Linkage disequilibrium (LD) coefficient (D′ and r2) and Hardy-Weinberg equilibrium P-value were estimated by Haploview software version 4.2 package (http://www.broad.mit.edu/mpg/haploview/). For each polymorphism, Hardy-Weinberg equilibrium (HWE) was tested by comparing the observed to expected genotype frequencies. All SNPs were consistent with HWE (P>0.05). Reconstruction of the TP53 haplotypes incorporating the 7 SNPs was accomplished using Phase software. Four distinct haplotypes were observed in the study population with a frequency >1%. Each individual was assigned the best pair of haplotypes estimated by Phase software.

 Statistical analysis

TL was analyzed as a continuous variable. The Mann-Whitney U test or the Kruskal-Wallis H test was used as appropriate to determine the differences in TL between different groups. Correlation curves between age and TL were estimated by linear regression model. A Chi-squared test or Fisher's exact test was used as appropriate to assess differences in allelic loss frequency between different groups and genotype distribution of each tagSNP between malign and benign breast tumor patients. All statistical analyses were performed using SPSS 13.0 (SPSS Inc., Chicago, IL, USA). Statistical significance was declared at α=0.05.

 Results Breast tumors TL and its association with somatic p53 mutations

In 124 breast tumor samples, TL was determined by real-time PCR. The mean level of TL in breast tumor tissues was 1.346 [standard error (SE) =0.039]. Mean TL of malign patients was shorter than that of benign patients, although no significant difference was observed (P=0.102). The mean TLs were 1.263 (SE=0.067) and 1.391 (SE=0.047) in malign breast tumors and benign breast tumors, respectively. The TLs of the breast tumor tissues were plotted against patient age at sampling (Fig. 1A). The negative slope of the best-fit line for breast tumor tissue indicated a decrease in the TL with age in the breast tumor patients (R=−0.378, P=0.004).

Table II shows the pattern and codon distribution of TP53 somatic mutations in our patients. In the breast tumor patients, we found a total of 11 somatic mutations in 10 patients and 1 patient had double mutations. Therefore, the frequency of TP53 gene somatic mutations in breast cancer was 22.7% (10/44) in our study. The proportions of different mutation types were 1/11 (9.1%) for A:T→G:C, 2/11 (18.2%) for G:C→A:T, 3/11 (27.3%) for G:C→T:A, 1/11 (9.1%) for ins and 4/11 (36.4%) for del, respectively. All the somatic mutations were found in the malign patients and located in the coding region, including 6 missense mutations and 5 frameshift mutations.

TLs were significantly shorter in patients with somatic mutations when compared with patients with no mutation in breast tumor tissues (P=0.007). Mean TLs of patients with and without somatic mutation were 0.965 (SE=0.117) and 1.379 (SE=0.039) respectively. The medians and the 25th, and 75th percentiles of TLs in breast tumor patients with and without somatic mutations are shown in Fig. 2A.

 Relationship between TL and other common p53 variants

Among the germline variants, four variants were observed at low frequencies [minor allele frequency (MAF) <0.01] in breast tumor patients. Variant 1621 (position in PCR product), which was not included in the known SNPs, was detected in five breast tumor patients both in leukocyte and breast tumor tissue. The remnant common SNPs were rs12951053, rs12947788, rs1625895, rs1042522, rs17883323, rs17878362, rs1642785. The locations of polymorphisms ranged from 2-intron to 7-intron. LD coefficient (D′ and r2) and Hardy-Weinberg equilibrium P-value were estimated by Haploview (Table III, Fig. 3A). For complete linkage SNPs, one was selected for subsequent analysis. These were rs12951053, rs1625895, rs1042522, rs17883323 and rs17878362. To obtain accurate results, patients with somatic mutations were excluded of in the association analysis of SNPs, haplotypes and TLs. In the group of breast tumor patients, TLs of the different genotypes did not achieve significant difference for all SNPs in the tumor tissue (Table IV). There was also no significant difference among the TLs of the different haplotypes (data not shown).

 Correlation of allelic loss with somatic mutations and TL

In a comparative analysis of TP53 SNPs in blood and tumor tissues of breast tumor patients, allelic loss was detected in 11.3% (8/71) of tumors from heterozygous patients. Mean TL of patients with allelic loss (1.170, SE=0.173) was shorter than the mean TL of patients with no allelic loss (1.369, SE=0.054) with a non-significant P-value (0.178). TP53 allelic loss was detected in 60.0% (3/5) of breast tumor patients with somatic p53 mutations, which was more in comparison with individuals (7.6%, 5/66) without somatic p53 mutations (P=0.009). This suggests that TP53 allelic loss was associated with TP53 mutations among heterozygous breast tumor patients.

In the patients with TP53 allelic loss, all of the heterozygous TP53 polymorphisms lost one allele, which suggested that the loss type was large fragment loss. With respect to every polymorphism included, the details of allelic loss are shown in Table V. For the famous rs1042522 (codon 72), 6 of 55 patients heterozygous for codon 72 had allelic loss, including 1 (16.7%) loss of G allele (Pro) and 5 (83.3%) loss of C allele (Arg).

 Association of common SNPs and susceptibility to malignant transformation in breast tumor

Associations between common SNPs of TP53 and the susceptibility to tumor maligning in breast tumors were listed in Table VI. No significant difference was observed between malign and benign tumor patients in 5 common tagSNP genotypes and allele frequencies. This result implies that all of the polymorphisms confer no effect on the risk of tumor maligning in our breast tumor patients. The distribution of haplotypes in benign and malign breast tumor patients were not significantly different (data not shown).

 Esophageal cancer TL and its association with somatic p53 mutations

Of the 68 patients with esophageal cancer investigated in this study, 55 TP53 gene somatic mutations were found in 47 patients, and 7 patients had more than one mutation. The frequency of TP53 gene somatic mutations in esophageal cancer was therefore 69.1% (47/68) in our study. All of the 47 patients had at least one mutation causing a amino acid change or located in the splice-site. Among the 55 somatic mutations identified, there were 31 missense mutations, 9 nonsense mutations, 8 frameshift mutations, 5 splice-site mutations, 1 silent mutation and 1 intronic mutation. The proportions of different mutational types were 5/55 (9.1%) for A:T→G:C, 12/55 (21.8%) for G:C→A:T at CpG, 12/55 (21.8%) for G:C→A:T, 2/55 (3.6%) for A:T→T:A, 6/55 (10.9%) for G:C→C:G, 7/55 (12.7%) for G:C→T:A, 3/55 (5.5%) for A:T→C:G, 3/55 (5.5%) for ins and 5/55 (9.1%) for del, respectively. Transitions were predominant (29/55, 52.7%), followed by transversions (18/55, 32.7%).

In 68 esophageal cancer samples, TL was determined by real-time PCR. The mean level of TL in esophageal cancer tissues was 0.923 (SE=0.047). TLs were plotted against patient age at sampling (Fig. 1B). No correlation was found between age and TL in esophageal cancer tissue. TLs were significantly shorter in patients with somatic mutations compared with patients with no mutation in esophageal cancer tissues (P=0.001). Mean TLs of patients with and without somatic mutations were 0.835 (SE=0.057) and 1.120 (SE=0.069), respectively. The medians, the 25th and the 75th percentiles of TLs in the esophageal cancer patients with and without somatic mutations are shown in Fig. 2A.

 Relationship between TL and other common p53 variants

Among the germline variants, two variants were observed at low frequencies (MAF <0.01) in esophageal cancer patients. The remnant common SNPs were rs12951053, rs12947788, rs1625895, rs1042522, rs17883323, rs17878362 and rs1642785. Linkage disequilibrium coefficient (D′ and r2) and Hardy-Weinberg equilibrium P-value were estimated by Haploview (Table III, Fig. 3B). The SNPs selected for subsequent analysis were the same as for the breast tumors.

In the group of esophageal cancer patients, TLs of patients with minor genotype CC of rs12951053 and GG of rs1042522 were significantly shorter than patients with other genotypes of this SNP in esophageal cancer tissue. Mean TLs of patients with genotypes CC and AA&AC of rs12951053 were 0.832 (SE=0.052) and 1.187 (SE=0.076) respectively (P=0.020). Mean TLs of patients with genotypes GG and CC&GC of rs1042522 were 0.889 (SE=0.070) and 1.192 (SE=0.080), respectively (P=0.032). The medians, the 25th and the 75th percentiles of TLs in the esophageal cancer tissues according to genotypes of rs12951053 and rs1042522 are shown in Fig. 2B and C. For other SNPs, TLs of different genotypes did not achieve significant difference (Table IV). Haplotypes of 7 common SNPs were estimated using the Phase software. Patients with haplotype CACGG-G (rs12951053, rs12947788, rs1625895, rs1042522, rs17883323, rs17878362, rs1642785) had a significantly shorter TL than patients with the other haplotypes (P=0.009). Mean TLs of patients with haplotype CACGG-G and the other haplotypes were 0.975 (SE=0.065) and 1.200 (SE=0.061), respectively.

 Correlation of allelic loss with somatic mutations and TL

In a comparative analysis of TP53 SNPs in tumor and normal tissue of esophageal cancer patients, allelic loss was detected in 57.8% (26/45) of tumors from heterozygous patients. The mean TL of patients with allelic loss (0.789, SE=0.063) was shorter than the mean TL of patients with no allelic loss (1.008, SE=0.092) with borderline statistical significance (P=0.056). The frequency of TP53 allelic loss was significantly higher in heterozygous esophageal cancer patients with somatic mutations compared with patients with no mutation (P<0.001). The frequencies of TP53 allelic loss were 74.3% (26/35) for mutation esophageal tumors and 0.00% (0/10) for no-mutation esophageal tumors. These suggest that TP53 allelic loss was associated with TP53 mutations among heterozygous esophageal cancer patients.

In the patients with TP53 allelic loss, all of the heterozygous TP53 polymorphisms lost one allele which was the same as for breast tumors (Table V). For the famous rs1042522 (codon 72), 20 of 36 patients heterozygous for codon 72 had allelic loss, including 9 (45.0%) loss of G allele (Pro) and 11 (55.0%) loss of C allele (Arg).

 Discussion

The most important function of telomeres is the maintenance of genomic integrity and stability (1,2). TL of human somatic cells is a biomarker of cumulative oxidative stress, biologic age and life stress (19,20). It shortens with each cell division (4,5). Oxidative stress (21) and life stress (22) also can accelerate its shortening. We observed an inverse correlation between TL and age in breast tumor tissue, demonstrating a significant age-related telomere loss in these tissues. This correlation was not detected in esophageal cancer tissue, which suggested that other factors, such as oxidative stress and life stress, rather than age mainly influence the TL in these tissues.

Mutation of the tumor suppressor p53 is an almost universal feature of human cancer. In our present study, we detected 11 somatic mutations in 10 breast tumor patients. All of the mutations were located in the coding region and caused amino acid changes. G:C→A:T mutations are very frequent in sporadic breast cancers (IARC TP53 database, http://www-p53.iarc.fr, R15 release) (11). Compared with global TP53 mutations in sporadic breast cancer, mutations in our patients had less G:C→A:T transitions (18.18 vs. 46.56%) and more deletions (36.36 vs. 11.17%) and G:C→T:A transversions (27.27 vs. 8.90%). Of the 68 patients with esophageal cancer investigated in this study, 55 TP53 gene somatic mutations were found in 47 patients. The proportions of different mutational types in our esophageal cancer patients are similar with global TP53 mutation in esophageal cancer (11), with a higher transition followed by transversion.

Previous research has shown that mutant p53 proteins have a dominant negative effect on wild-type p53, and inhibit or activate the function of other p53 family members (13). Inhibition of p53 function enables continuous cell division and critical telomere shortening, a phenomenon known as telomere crisis, which causes telomere fusion and genome instability (3,10,23). Our study showed that telomeres were statistically shorter in tumor/cancer tissue from patients with TP53 somatic mutations than those with wild-type. This finding suggests that mutant p53 enables continuous cell division and critical telomere shortening and combines telomere erosion driving tumor formation.

Chromosomal instability (CIN) is a feature of most human cancers, and one mechanism of CIN is though the loss of telomeres (24). LOH is one of the representations of chromosomal instability, and short telomeres have been reported to contribute to LOH in renal cell carcinoma (25). In our study, patients with allelic loss had a shorter TL than patients with no allelic loss, and TP53 allelic loss was associated with TP53 mutations among heterozygous patients in both tumor types. These results suggest that large fragment TP53 allelic loss may be one of the representations of chromosomal instability caused by telomere dysfunction combined with p53 function inhibition. Notably, the patients with p53 allelic loss had a high proportion of mutant alleles (50–100%). LOH has emerged as the second hit in tumor initiation which serves to inactivate or eliminate the wild-type allele at the tumor-suppressor gene locus (12,15). Thus, LOH at the p53 locus caused by chromosomal instability may constitute one of the major mechanisms for inactivation of the intact allele associated with a p53 mutation (16).

Combined with our results and previous studies, we hypothesize that the mechanisms of tumorigenesis associated with telomere dysfunction and p53 mutations are as follows. i) Telomere DNA is progressively lost with each cell division (4,5). ii) Telomere shortening reaching a critically short length activates DNA damage checkpoints, and results in induction of cellular senescence, and the first checkpoint in response to telomere shortening is a p53-dependent, permanent cell cycle arrest (6). iii) Exogenous carcinogens and endogenous biological processes cause p53 mutations (26). iv) Mutant p53 proteins enable continuous cell division and critical telomere shortening, a phenomenon known as telomere crisis, which causes telomere fusion and genome instability. v) LOH occurring by chromosomal instability inactivates the intact allele associated with p53 mutation. vi) Recurrence of the above steps occurs. vii) Tumorigenesis and malignant transformation transpires.

Rs1042522, viz. codon R72P SNP, is in exon 4, the segment of TP53 that encodes the polyproline domain, which is essential for p53 to mount a full apoptotic response to stress and inhibit tumorigenesis (14). It has been reported that p53-P72 has a weaker apoptotic potential than p53-R72 (27). In esophageal cancer tissue, we detected that patients with a minor genotype GG of rs1042522 had a shorter TL than those with genotypes CC&GC, and patients with minor genotype CC of rs12951053 had a shorter TL than those with genotypes AA&AC. Genotype GG and CC of rs1042522 were corresponded to P72 and R72 in our study. Thus, the minor genotype GG has a weaker apoptotic potential, and may enable critical telomere shortening. Rs12951053 is in intron 7, which has a strong linkage relationship with rs1042522 (Fig. 3). Its significant difference in TL between genotypes may be caused by this. Patients with haplotype CACGG-G have a significantly shorter TL than patients with the other haplotypes. This haplotype exclusively contains C allele of rs12951053 and G allele of rs1042522 simultaneously. The above-mentioned differences did not exist in breast tumor patients, which suggests that the function of SNPs may be tissue- or tumor type-specific. For other SNPs, we found no evidence for an association with TL. Their TLs of different genotypes did not show a significant difference. Our results showed that SNPs of TP53 may, depending on tissue or tumor type, specifically have a very feeble effect on cellular senescence and/or apoptosis associated with telomere dysfunction. Elucidation of this issue requires investigation with a large sample size and the use of more types of cancer.

Although the relationships between TP53 variants and TL in breast tumor and esophageal cancer have not been directly studied previously, several similar studies exist. Two studies found that TLs in the peripheral blood cells of germline p53 mutation carriers of Li-Fraumeni syndrome were shorter than that of normal individuals (28,29). Another similar research by Radpour et al found that TL is inversely correlated with the promoter methylation profile of p53 in breast cancer, which suggests that p53 may function as a gatekeeper to prevent critical telomere shortening and genome instability (30). From the above findings, it is evident that all similar research obtained consistent results consistent with ours suggesting that TL shortening cannot drive tumorigenesis alone; it is combined with defects in cellular senescence and/or apoptosis. p53 plays a key role in this pathway. This may explain the inconsistent results of previous research investigating TL and cancer risk (31–34). Thus, in future research concerning telomere dysfunction and cancer risk, the effects of cellular senescence and apoptosis should also be considered.

In conclusion, our study revealed that telomeres of patients with TP53 somatic mutations were statistically shorter than those with wild-type in both breast tumor tissue and esophageal cancer tissue, and large fragment TP53 allelic loss was significantly associated with somatic mutations. These findings suggest that mutant p53 enables continuous cell division and critical telomere shortening and combines telomere erosion driving tumor formation. Large fragment TP53 allelic loss may be one of the representations of chromosomal instability caused by telomere dysfunction combined with p53 function inhibition. The SNPs of TP53 depending on tissue or tumor-type may have a feeble effect on cellular senescence and/or apoptosis associated with telomere dysfunction. Investigation with a large sample size using more types of cancers may elucidate this issue.

 Acknowledgements

We are greatly indebted to the persons who participated in this research. In addition, we thank Dr Chengye Wang for his help in preparing the study. This study was supported by the National Natural Science Foundation of China (NSFC) and The Bureau of Science and Technology of Yunnan Province.

 References BlackburnEHStructure and function of telomeresNature3505695731991 HackettJAFeldserDMGreiderCWTelomere dysfunction increases mutation rate and genomic instabilityCell1062752862001 RudolphKLMillardMBosenbergMWDePinhoRATelomere dysfunction and evolution of intestinal carcinoma in mice and humansNat Genet281551592001 LevyMZAllsoppRCFutcherABGreiderCWHarleyCBTelomere end-replication problem and cell agingJ Mol Biol2259519601992 HarleyCBFutcherABGreiderCWTelomeres shorten during ageing of human fibroblastsNature3454584601990 von FiguraGHartmannDSongZRudolphKLRole of telomere dysfunction in aging and its detection by biomarkersJ Mol Med87116511712009 Cosme-BlancoWShenMFLazarAJTelomere dysfunction suppresses spontaneous tumorigenesis in vivo by initiating p53-dependent cellular senescenceEMBO Rep84975032007 ThanasoulaMEscandellJMMartinezPp53 prevents entry into mitosis with uncapped telomeresCurr Biol205215262010 BrassatUBalabanovSBaliDFunctional p53 is required for effective execution of telomerase inhibition in BCR-ABL-positive CML cellsExp Hematol396676e122011 ArtandiSEDePinhoRATelomeres and telomerase in cancerCarcinogenesis319182009 PetitjeanAMatheEKatoSImpact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 databaseHum Mutat286226292007 LaskoDCaveneeWNordenskjoldMLoss of constitutional heterozygosity in human cancerAnnu Rev Genet252813141991 GohAMCoffillCRLaneDPThe role of mutant p53 in human cancerJ Pathol2231161262011 WhibleyCPharoahPDHollsteinMp53 polymorphisms: cancer implicationsNat Rev Cancer9951072009 KnudsonAGJrMutation and cancer: statistical study of retinoblastomaProc Natl Acad Sci USA688208231971 SaekiHKitaoHYoshinagaKCopy-neutral loss of heterozygosity at the p53 locus in carcinogenesis of esophageal squamous cell carcinomas associated with p53 mutationsClin Cancer Res17173117402011 CawthonRMTelomere measurement by quantitative PCRNucleic Acids Res30e472002 GilMECoetzerTLReal-time quantitative PCR of telomere lengthMol Biotechnol271691722004 BabizhayevMASavel'yevaELMoskvinaSNYegorovYETelomere length is a biomarker of cumulative oxidative stress, biologic age, and an independent predictor of survival and therapeutic treatment requirement associated with smoking behaviorAm J Ther18e2092262011 BairdDMTelomere dynamics in human cellsBiochimie901161212008 von ZglinickiTOxidative stress shortens telomeresTrends Biochem Sci273393442002 EpelESBlackburnEHLinJAccelerated telomere shortening in response to life stressProc Natl Acad Sci USA10117312173152004 ArtandiSEChangSLeeSLTelomere dysfunction promotes non-reciprocal translocations and epithelial cancers in miceNature4066416452000 MurnaneJPTelomeres and chromosome instabilityDNA Repair5108210922006 ChenMYeYYangHGenome-wide profiling of chromosomal alterations in renal cell carcinoma using high-density single nucleotide polymorphism arraysInt J Cancer125234223482009 GreenblattMSBennettWPHollsteinMHarrisCCMutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesisCancer Res54485548781994 DumontPLeuJIDella PietraACIIIGeorgeDLMurphyMThe codon 72 polymorphic variants of p53 have markedly different apoptotic potentialNat Genet333573652003 TaboriUNandaSDrukerHLeesJMalkinDYounger age of cancer initiation is associated with shorter telomere length in Li-Fraumeni syndromeCancer Res67141514182007 TrkovaMProchazkovaKKrutilkovaVSumerauerDSedlacekZTelomere length in peripheral blood cells of germline TP53 mutation carriers is shorter than that of normal individuals of corresponding ageCancer1106947022007 RadpourRBarekatiZHaghighiMMCorrelation of telomere length shortening with promoter methylation profile of p16/Rb and p53/p21 pathways in breast cancerMod Pathol237637722010 PooleyKASandhuMSTyrerJTelomere length in prospective and retrospective cancer case-control studiesCancer Res70317031762010 GramatgesMMTelliMLBaliseRFordJMLonger relative telomere length in blood from women with sporadic and familial breast cancer compared with healthy controlsCancer Epidemiol Biomarkers Prev196056132010 ZhengYLAmbrosoneCByrneCDavisWNeslineMMcCannSETelomere length in blood cells and breast cancer risk: investigations in two case-control studiesBreast Cancer Res Treat1207697752010 SvensonUNordfjallKStegmayrBBreast cancer survival is associated with telomere length in peripheral blood cellsCancer Res68361836232008

Correlation between telomere length and age (years) as assessed by the linear regression model. (A) Breast tumor tissue; (B) esophageal cancer tissue.

(A) TLs in tumors of breast tumor patients and esophageal cancer patients according to a mutated or wild-type p53 gene. TLs in esophageal cancer tissues according to the (B) rs12951053 and (C) rs1042522 genotypes.

Linkage disequilibrium (LD) plot of 7 common SNPs. The LD plots were constructed using Haploview software. The LD color scheme was D′/LOD(alt). (A) Breast tumor patients; (B) esophageal cancer patients.

Primers for PCR and sequencing.

Primer name Primer sequence 5′-3′ Type Amplified/sequencing fragmenta (locus)
TP53F ACGACGAGTTTATCAGGA Amplifying g.11066-g.14379
TP53R GACCTATGGAAACTGTGAG Amplifying
TP53S1 ACGGCATTTTGAGTGTTAG Sequencing g.13294-g.14084 (exons 7–9)
TP53S2 GGATGGGTAGTAGTATGGAAG Sequencing
TP53R1 CCTGATTTCCTTACTGCCTCTT Sequencing
TP53R2 TGCTTGCCACAGGTCTCC Sequencing
TP53S3 TCAAATAAGCAGCAGGAGA Sequencing g.12338-g.12805 (exons 5–6)
TP53R3 TGCCGTCTTCCAGTTGCT Sequencing
TP53S4 GTGAAGAGGAATCCCAAAG Sequencing g.11114-g.11656 (exons 3–4)
TP53R4 CCTATGGAAACTGTGAGTGGA Sequencing

Nomenclature according to the HGVS standards with the GenBank NC_000017.9 genomic sequence as reference.

Somatic mutations detected in the patients.

Sample name Telomere length Type of cancer Mutation (PCR product) Genomic descriptiona Exon/intron number Mutational type Residue change (Splice site)
5C 1.348 Breast 1856T→C g.12524 5-exon A:T→G:C His179Arg
31C 0.412 Breast 1734G→T g.12646 6-exon G:C→T:A His193Asn
38C 1.009 Breast 1665C→T g.12715 6-exon G:C→A:T Val216Met
39C 0.827 Breast 1941del g.12443 5-exon del Pro152NA
41C 1.559 Breast 2785-2786del g.11596-11597 4-exon del Val122NA
67C 0.958 Breast 2823insCGGA g.11560 4-exon ins Arg110NA
72C 0.688 Breast 547C→T g.13833 8-exon G:C→A:T Glu285Lys
94C 1.371 Breast 1685-1686del g.12694-12695 6-exon del Arg209NA
97C 0.561 Breast 570C→A g.13810 8-exon G:C→T:A Cys277Phe
98C 0.916 Breast 348del g.14032 9-exon del Lys320NA
98C 0.916 Breast 351C→A g.14029 9-exon G:C→T:A Lys319Asn
C085 0.985 Esophageal 1001G→A g.13379 7-exon G:C→A:T at CpG Arg248Trp
C090 0.679 Esophageal 562T→A g.13818 8-exon A:T→T:A Arg280STOP
C091 1.361 Esophageal 582C→T g.13798 8-exon G:C→A:T at CpG Arg273His
C093 0.729 Esophageal 2773C→T g.11607 4-intron G:C→A:T NA (consensus SD)
C094 0.780 Esophageal 582C→G g.13798 8-exon G:C→C:G Arg273Pro
C095 0.880 Esophageal 567G→C g.13813 8-exon G:C→C:G Pro278Arg
C097 2.118 Esophageal 1737G→A g.12643 6-exon G:C→A:T Gln192STOP
C100 0.802 Esophageal 1641C→A g.12739 6-exon G:C→T:A Glu224STOP
C100 0.802 Esophageal 1722C→G g.12658 6-exon G:C→C:G Val197Leu
C101 1.681 Esophageal 1048A→G g.13332 7-exon A:T→G:C Ile232Thr
C102 0.486 Esophageal 1021G→C g.13359 7-exon G:C→C:G Ser241Cys
C104 0.507 Esophageal 1652T→C g.12728 6-exon A:T→G:C Tyr220Cys
C107 0.479 Esophageal 1980C→G g.12400 5-exon G:C→C:G Ala138Pro
C108 1.302 Esophageal 556G→A g.13824 8-exon G:C→A:T at CpG Arg282Trp
C110 0.805 Esophageal 1652T→C g.12728 6-exon A:T→G:C Tyr220Cys
C111 0.714 Esophageal 1652T→G g.12728 6-exon A:T→C:G Tyr220Ser
C112 0.689 Esophageal 982-984del g.13401-13403 7-exon del Ile255NA
C114 1.323 Esophageal 543insTT g.13838 8-exon ins Glu287NA
C114 1.323 Esophageal 583G→A g.13797 8-exon G:C→A:T at CpG Arg273Cys
C115 0.872 Esophageal 1001G→A g.13379 7-exon G:C→A:T at CpG Arg248Trp
C116 1.306 Esophageal 1665C→A g.12715 6-exon G:C→T:A Val216Leu
C120 0.979 Esophageal 2866insA g.11514 4-exon ins Ser95NA
C121 0.481 Esophageal 1990A→C g.12390 5-exon A:T→C:G Phe134Leu
C122 0.526 Esophageal 570C→A g.13810 8-exon G:C→T:A Cys277Phe
C124 0.539 Esophageal 556G→A g.13824 8-exon G:C→A:T at CpG Arg282Trp
C124 0.539 Esophageal 1875C→T g.12505 5-exon G:C→A:T Val173Met
C125 0.916 Esophageal 313A→G g.14067 9-intron A:T→G:C NA (consensus SD)
C127 0.864 Esophageal 561C→A g.13819 8-exon G:C→T:A Arg280Ile
C132 1.890 Esophageal 1865C→A g.12515 5-exon G:C→T:A Cys176Phe
C134 0.432 Esophageal 583G→A g.13797 8-exon G:C→A:T at CpG Arg273Cys
C134 0.432 Esophageal 1737G→A g.12643 6-exon G:C→A:T Gln192STOP
C136 0.528 Esophageal 484G→A g.13896 8-exon G:C→A:T at CpG Arg306STOP
C138 0.562 Esophageal 2955del g.11425 4-exon del Arg65NA
C141 0.410 Esophageal 1868C→T g.12512 5-exon G:C→A:T at CpG Arg175His
C142 1.313 Esophageal 1677-1678del g.12704-12705 6-exon del Phe212NA
C143 0.394 Esophageal 617-637del g.13743-13763 8-exon del7-intron Ser261NA
C143 0.394 Esophageal 1727A→G g.12653 6-exon A:T→G:C Ile195Thr
C144 0.661 Esophageal 2868G→C g.11512 4-exon G:C→C:G Ser94STOP
C145 0.628 Esophageal 2998C→A g.11382 4-exon G:C→T:A Glu51STOP
C146 0.606 Esophageal 1638C→T g.12742 6-intron G:C→A:T NA (consensus SD)
C146 0.606 Esophageal 2871-2872del g.11508-11509 4-exon del Leu93NA
C147 0.581 Esophageal 576C→A g.13804 8-exon G:C→T:A Cys275Phe
C148 0.794 Esophageal 539C→T g.13841 8-exon G:C→A:T Glu287Glu
C148 0.794 Esophageal 547C→T g.13833 8-exon G:C→A:T Glu285Lys
C148 0.794 Esophageal 666C→T g.13714 7-intron G:C→A:T NA
C149 0.550 Esophageal 568G→A g.13812 8-exon G:C→A:T Pro278Ser
C150 0.369 Esophageal 484G→A g.13896 8-exon G:C→A:T at CpG Arg306STOP
C151 0.514 Esophageal 1941G→A g.12439 5-exon G:C→A:T Pro151Ser
C152 0.919 Esophageal 582C→T g.13798 8-exon G:C→A:T at CpG Arg273His
C153 0.854 Esophageal 583G→A g.13797 8-exon G:C→A:T at CpG Arg273Cys
C155 1.253 Esophageal 1041insG g.13339 7-exon ins Asn235NA
C157 1.096 Esophageal 2877C→T g.11503 4-exon G:C→A:T Trp91STOP
C158 0.738 Esophageal 1033A→T g.13347 7-exon A:T→T:A Met237Lys
C159 0.692 Esophageal 1072T→G g.13308 6-intron A:T→C:G NA (consensus SA)
C160 0.674 Esophageal 618C→T g.13762 7-intron G:C→A:T NA (consensus SA)

Mutation nomenclature according to the HGVS standards with the GenBank NC_000017.9 genomic sequence as reference.

NA, not applicable; SD, splice donor site; SA, splice acceptor site.

Seven common SNPs identified by sequencing.

Breast tumor Esophageal cancer
SNP Position (PCR product) Locus HWE P-value MAF HWE P-value MAF Alleles
rs12951053 869 7-intron 0.897 0.381 1 0.353 A:C
rs12947788 889 7-intron 0.897 0.381 1 0.353 G:A
rs1625895 1577 6-intron 1 0.032 1 0.059 C:T
rs1042522 2934 4-exon 0.1973 0.488 0.8499 0.485 C:G
rs17883323 3081 3-intron 0.9608 0.075 0.9501 0.103 G:T
rs17878362 3131 3-intron 1 0.036 1 0.059 −:ccccagccctccaggt
rs1642785 3263 2-intron 0.1973 0.488 0.8499 0.485 C:G

SNP, single-nucleotide polymorphism; HWE, Hardy-Weinberg equilibrium; MAF, minor allele frequency.

Associations of p53 common variants in tumors without p53 somatic mutations and TLs in breast tumors and esophageal cancer.

Breast tumor Esophageal cancer
Genotype N TL (means ± SE) N TL (means ± SE)
rs12951053
 AA 43 1.356±0.062 10 1.221±0.109
 AC 52 1.376±0.057 7 1.139±0.105
 CC 19 1.441±0.109 4 0.832±0.052
 P-value 0.958 0.052
rs1625895
 CC 106 1.366±0.039 20 1.108±0.071
 CT 8 1.551±0.229 1 1.351
 P-value 0.606 0.509
rs1042522
 CC 33 1.377±0.064 7 1.106±0.129
 GC 49 1.360±0.060 9 1.258±0.103
 GG 32 1.411±0.085 5 0.889±0.070
 P-value 0.962 0.079
rs17883323
 GG 99 1.408±0.042 18 1.071±0.071
 GT 15 1.187±0.094 3 1.414±0.160
 P-value 0.108 0.088
rs17878362
 −/− 105 1.361±0.039 20 1.108±0.071
 −/ccccagccctccaggt 9 1.591±0.206 1 1.351
 P-value 0.344 0.509

Details of the patients with allelic loss.

Genotype: blood/normal tissue→tumor
Patient no. Type of tumor LOH type rs12951053 rs12947788 rs1625895 rs1042522 rs17883323 rs17878362 rs1642785 TP53 mutation
20 Breast cancer Partial loss AC→A- AG→G- - - GT→T- - - −
38 Breast cancer Partial loss - - - GC→G- GT→T- - GC→G- +
64 Breast cancer Partial loss AC→A- AG→G- - GC→C- - - GC→C- −
67 Breast cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
94 Breast cancer Partial loss AC→C- AG→A- - GC→G- - - GC→G- +
A18 Breast tumor Complete loss AC→C- AG→A- - GC→G- - - GC→G- −
A71 Breast tumor Complete loss AC→C- AG→A- - - GT→G- - - −
A98 Breast tumor Partial loss AC→C- AG→A- - GC→G- - - GC→G- −
85 Esophageal cancer Complete loss - - CT→C- - GT→T- A1A2→A1- - +
90 Esophageal cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
91 Esophageal cancer Complete loss AC→A- AG→G- CT→T- - - A1A2→A2- - +
93 Esophageal cancer Partial loss AC→A- AG→G- - GC→C- - - GC→C- +
94 Esophageal cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
95 Esophageal cancer Complete loss - - - GC→C- GT→G- - GC→C- +
100 Esophageal cancer Complete loss - - - GC→G- GT→T- - GC→G- +
101 Esophageal cancer Complete loss - - - GC→C- GT→G- - GC→C- +
102 Esophageal cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
104 Esophageal cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
107 Esophageal cancer Complete loss AC→A- AG→G- - GC→C- - - GC→C- +
111 Esophageal cancer Complete loss AC→A- AG→G- - GC→C- - - GC→C- +
112 Esophageal cancer Partial loss AC→A- AG→G- - GC→C- - - GC→C- +
115 Esophageal cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
116 Esophageal cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
127 Esophageal cancer Partial loss AC→C- AG→A- - GC→G- - - GC→G- +
136 Esophageal cancer Partial loss AC→A- AG→G- - GC→C- - - GC→C- +
141 Esophageal cancer Complete loss AC→A- AG→G- - - GT→T- - - +
142 Esophageal cancer Complete loss AC→C- AG→A- - - GT→G- - - +
144 Esophageal cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
145 Esophageal cancer Partial loss AC→A- AG→G- CT→T- - - A1A2→A2- - +
150 Esophageal cancer Complete loss AC→A- AG→G- CT→T- - - A1A2→A2- - +
151 Esophageal cancer Complete loss AC→A- AG→G- - GC→C- - - GC→C- +
153 Esophageal cancer Complete loss AC→C- AG→A- - GC→G- - - GC→G- +
158 Esophageal cancer Complete loss - - - GC→G- GT→T- - GC→G- +
160 Esophageal cancer Complete loss AC→A- AG→G- - GC→C- - - GC→C- +

A1, non-duplicated allele; A2, duplicated allele; −, no LOH and TP53 mutation; +, presence of TP53 mutation.

Genotype frequencies of common SNPs and their association with susceptibility to malignant transformation in breast tumors.

SNP Group Genotype frequency n, (%)
AA AC CC
rs12951053 Benign 27 (33.3) 43 (53.1) 11 (13.6)
Malign 22 (48.9) 15 (33.3) 8 (17.8)
P-value 0.101
CC CT
rs1625895 Benign 77 (95.1) 4 (4.9)
Malign 41 (91.1) 4 (8.9)
P-value 0.455
CC CG GG
rs1042522 Benign 22 (27.2) 38 (46.9) 21 (25.9)
Malign 15 (33.3) 17 (37.8) 13 (28.9)
P-value 0.600
GG GT
rs17883323 Benign 70 (86.4) 11 (13.6)
Malign 37 (82.2) 8 (17.8)
P-value 0.528
−/− −/ccccagccctccaggt
rs17878362 Benign 76 (93.8) 5 (6.2)
Malign 41 (91.1) 4 (8.9)
P-value 0.720

SNP, single-nucleotide polymorphism.