OR Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 10.3892/or.2012.2129 or-29-02-0491 Articles The expression and functional characterization associated with cell apoptosis and proteomic analysis of the novel gene MLAA-34 in U937 cells ZHANGWEN-JUAN ZHANGWANG-GANG ZHANGPENG-YU CAOXING-MEI HEAI-LI CHENYIN-XIA GULIU-FANG Department of Clinical Hematology, Affiliated No. 2 Hospital, Xi’an Jiaotong University College of Medicine, Xi’an, Shaanxi 710004, P.R. China Correspondence to: Professor Wang-Gang Zhang, Department of Clinical Hematology, Affiliated No. 2 Hospital, Xi’an Jiaotong University College of Medicine, 157 West 5 Road, Xi’an, Shaanxi 710004, P.R. China, E-mail: juner0705@163.com 2 2013 07 11 2012 29 2 491 506 12 08 2012 25 09 2012 Copyright © 2013, Spandidos Publications 2013 This is an open-access article licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. The article may be redistributed, reproduced, and reused for non-commercial purposes, provided the original source is properly cited.

MLAA-34 is a novel acute monocytic leukemia (M5)-associated antigen (MLAA) that plays a role in the apoptosis of U937 cells. However, the expression and molecular mechanism of MLAA-34 in U937 cells remain largely unclear. Here, we utilized three strategies to gain insight into the expression and molecular functions of MLAA-34 and to identify its interacting proteins and pathways involved in the fine-tuning of the MLAA-34 response. Western blot analysis was performed to assess the expression of MLAA-34 in 41 cell lines and five mixed cell types, which revealed that MLAA-34 is most strongly expressed in U937 cells. Immunostaining indicated that MLAA-34 is localized in the cytoplasm and cell membrane. Furthermore, lentivirus-mediated overexpression of MLAA-34 in the U937 cell line led to significant suppression of apoptosis and increased the potential of tumorigenicity. Co-immunoprecipitation (Co-IP), shotgun and bioinformatic analysis identified 256 proteins and 225 of them were annotated by gene ontology categories. This analysis revealed 71 proteins involved in cell apoptosis or proliferation of biological processes and signaling pathways. Moreover, the effect of MLAA-34 apoptosis may be through interaction with the Ras, Wnt, calcium and chemokine signaling pathways and thirteen of the annotated proteins may interact with MLAA-34 and participate in carcinogenesis directly. This study provides a basis for a better understanding of the molecular mechanism and proteomics in the inhibition of apoptosis by MLAA-34 in U937 cells and indicates that MLAA-34 may be a potential candidate for the early diagnosis and therapeutic application of M5.

 MLAA-34 U937 acute monocytic leukemia lentivirus anti-apoptosis proteomics Introduction

Leukemia is the leading cause of mortality worldwide in patients with malignant tumors under the age of 35 years. Patients with acute myeloid leukemia (AML) who have relapsed or are refractory to conventional chemotherapy have a poorer prognosis and response to chemotherapy than those with de novo AML, which remains a formidable therapeutic challenge even with the introduction of several new therapeutic strategies (1–3). M5 is largely incurable with high relapse rates, infiltration and a median remission duration of only six months, approximately (4). Moreover, M5 has been reported to have a worse prognosis than other subtypes of AML (5). Thus, a vaccine or a new drug against M5 is required as a strategic tool for the control of this disease, but none are currently available for practical use.

The MLAA-34 gene (GenBank no. AY288977.2) has been confirmed to be a novel splice variant of CAB39L (calcium binding protein 39-like). MLAA-34 was first discovered in M5 in an effort to identify monocytic leukemia-associated antigens by serologic analysis of a recombinant cDNA expression library (SEREX) that reacted exclusively with sera from allogeneic leukemia patients but not with normal donor sera (6,7). The 1671 kb gene is located on 13q14.2 and was initially cloned in our laboratory from U937 cells (7). CAB39L has three alternative transcripts and has been predicted to encode a 337 aa protein. The three alternative transcripts of CAB39L have been recognized to encode the same protein, differing only in their 5′ untranslated regions [GenBank nos. BC010993 (1482 bp), BX647518 (2371 bp) and AY288977.2].

In our previous study, MLAA-34 and CAB39L were identified with RNA interference (RNAi) in the U937 cell line as novel anti-apoptotic factors that are closely related to carcinogenesis or progression of M5 (7). Clinical research has shown that MLAA-34 mRNA expression is upregulated in refractory/relapsed M5 patients compared with newly diagnosed, healthy donors and AML patients in complete remission; high expression of MLAA-34 is more prominent in the M5 subtype than in other AML patients; MLAA-34 overexpression has been found to be associated with unfavorable clinical features at diagnosis and has been shown to be an independent prognostic factor (8). However, for MLAA-34, there are no exact reports regarding its cellular localization and expression in manifold cell lines; the anti-apoptotic mechanism of MLAA-34 remains unclear.

The purpose of this study was to conduct an in-depth search for the expression and anti-apoptotic mechanism of MLAA-34 through the lentivirus-mediated overexpression in the U937 cell line, and to then apply proteomics to identify its correlated proteins or pathways that might perform functions important for the apoptosis and proliferation of U937 cells.

 Materials and methods Cell culture

U937, HL60, K562, RPMI-8226, HepG2, Hep3B, MHCC97-H, RC-K8, SGC-7901, Eca109, BGC823, MKN45, GES-1, BxPC-3, A375, T24, HUVEC, BMSCs, LO2, HeLa, 293T, 293, RD, RT4, 5637, EJ, UM-UC-3, 2537, J82, Tsu-Prl, MAH, LiBr, Hut-78, HCT116+, FBL-3, C6, astrocyte, 3T3-L1, NIH3T3, Vero and MDCK cell lines were all maintained in our laboratory and cultured in RPMI-1640 or DMEM supplemented with 10% fetal calf serum. The medium for cell lines expressing the neomycin resistance gene was supplemented with 0.5 mg/ml G418. Human epithelial tissue, normal human peripheral blood mononuclear cells (PBMCs), M5 patient and non-M5 acute leukemia patient PBMCs were all obtained from over 30 cases of patients or healthy young individuals. Mouse splenocytes were obtained from 30 mice.

 Antibodies and reagents

CAB39L and MLAA-34 share the same open reading frame (ORF), the CAB39L antibody was used in this report. Antibodies specific for CAB39L (sc-100390), β-catenin (sc-133240), Rab-3D (sc-26559), Rap-1B (sc-1481) and PGK1 (sc-130335) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). A monoclonal mouse antibody against β-actin was obtained from Sigma-Aldrich (St. Louis, MO, USA). The SAP kit and AP-Red kit were provided by Zhongshan Co. Beijing, China (SAP-9102, ZLI-9042). The lentivirus packaging system and enhanced infection solution (ENi.S) were purchased from GeneChem Limited Company (Shanghai, China). The SYBR Green PCR kit and SYBR Master Mixture were purchased from Takara Bio, Inc. (Dalian, China). The Endo-free Plasmid Mini kit was purchased from Qiagen, USA (12163). M-PER® Mammalian Protein Extraction Reagent was purchased from Pierce, Rockford, IL, USA (78503).

 Western blot analysis

Cells were collected at a concentration of 2×107/ml. Following sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), the proteins were transferred to polyvinylidene fluoride membranes, which were incubated with the primary antibody CAB39L (1:200). Western blot analyses were performed according to standard methods. The protein bands were visualized by applying SuperSignal West Pico Chemiluminescent Substrate (34079; Pierce). The exposed film was then analyzed using a densitometer.

 Immunohistochemistry and immunofluorescence

For analysis of the subcellular localization of MLAA-34, U937 cells were washed with ice-cold PBS, blocked with 10% normal goat serum and incubated with a primary antibody against CAB39L at a dilution of 1:50 for 2 h at 37°C. Next, the cells were washed again and incubated with the appropriate biotinylated secondary antibody (goat anti-mouse IgG antibody) for 20 min at 37°C. Incubation with serum alkaline phosphatase (SAP; ALP) was then performed at 37°C for 20 min, and the immunolabeling was visualized with a mixture of AP-Red solution. Counterstaining with hematoxylin was performed. For immunofluorescence, the cell samples were incubated with the monoclonal antibody CAB39L (diluted 1:50) and fluorescein isothiocyanate (FITC)-labeled or rhodamine-labeled goat anti-mouse IgG as the primary and secondary antibodies, respectively. The mounted cells were visualized with a fluorescent microscope.

 Construction and identification of the MLAA-34 lentivirus vector and upregulated MLAA-34 stably transfected cell line

The full-length MLAA-34 cDNA sequence was assembled by searching the NCBI database and amplified by RT-PCR from U937 cells. First-strand cDNA synthesis was performed using a commercial kit (Boehringer Mannheim, Milan, Italy). The restriction enzyme site for AgeI (ACCGGT) was introduced into the 5′ and 3′ PCR primers. To generate cDNA coding for full-length MLAA-34 by PCR, the following primers were designed using plasmid MLAA-34 as the template: MLAA-34-Age, I-F, GAGGATCCCCGGGTACCGGTCGCCACCATGAAAAAAATGCCTTTG and MLAA-34-Age, I-R, TCACCATGGTGGCGACCGGAGGGGCCGTTTTCTTCAAG. The PCR conditions consisted of 30 cycles, and the cycle parameters were: 94°C for 5 min, then 30 cycles of 94°C for 30 sec, 55°C for 30 sec, 68°C for 1 min, followed by a final extension of 68°C for 10 min. The PCR product was purified using an Agarose Gel DNA Purification kit (Takara Bio, Inc.). The two recovered products were ligated using an In-Fusion kit (631774; Becton, Dickinson and Co., USA). To confirm that the ligation was correct, MLAA-34-SEQF, GACAGATAGGCACTCGGAG; Ubi-F, GGGTCAATATGTAATTTTCAGTG; and EGFP-N-R, CGTCGCCGTCCAGCTCGACCAG primers were designed. The cycle parameters were: 30 cycles of 94°C for 30 sec, 94°C for 30 sec, 60°C for 30 sec, 72°C for 50 sec, followed by a final extension of 72°C for 6 min. For detection of MLAA-34 expressed by recombinant lentivirus in vitro, purified pGC-FU-MLAA-34 vectors were transfected into 293T cells using Lipofectamine 2000 reagent (11668-019; Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. This vector was termed MLAA-34-Lentivirus, and the vector without MLAA-34 cDNA was pGC-FU-GFP-LV. The titer of the recombinant lentivirus was determined by real-time qPCR on 293T cells. For identification of the recombinant MLAA-34 lentivirus vector, the virus was added to targeted U937 cells at multiplicity of infections (MOIs) of 10, 20, 50, 80, 100, 120 and 200 with ENi.S and 5 μg/ml polybrene. MLAA-34-Lentivirus and pGC-FU-GFP-LV transfected U937 cells were used as the test, and non-transfected cells were used as the control. The expression level of MLAA-34 was detected by western blot analysis and RT-PCR. The best MOI was chosen.

Cells were grown in selective media (containing G418) for two weeks, expanded and grown as independent clones for at least two weeks. Resistant colonies were counted, and the expression of GFP was confirmed by fluorescence microscopy, RT-PCR and western blot analysis.

 Fluorescence microscopy, MTT, flow cytometry and DNA ladder

To determine the effect of upregulation of MLAA-34 by the MLAA-34-Lentivirus, non-transfected cells and cells transfected with pGC-FU-GFP-LV and MLAA-34-Lentivirus were examined. Cells were seeded in 96-well plates at a density of 1×104 cells/well. Cellular proliferation was measured once per day during a seven-day period. In brief, 20 μl of sterile MTT (Sigma) dye (5 mg/ml) was added to the cells, which were then incubated for another 4 h at 37°C. Then, 150 μl of dimethylsulfoxide was added to each well. The spectrophotometric absorbance was measured at a wavelength of 490 nm on an enzyme immunoassay analyzer.

Fixed cells were stained with 2.5 g/ml of DAPI (4′,6-diamidino-2-phenylindole) solution to detect apoptotic nuclei. Quantification of apoptosis was determined by counting the number of apoptotic cells. The cells were stained using an Annexin V-PE/7-AAD apoptosis detection kit (KGA1015; Nanjing KeyGen Biotech. Co., Ltd.) according to the manufacturer’s instructions and were analyzed by flow cytometry using a Beckman Coulter flow cytometer.

For cell cycle analysis, the cells were fixed in 70% ethanol and stained with propidium iodide (PI; Biosea Biotechnology Co., Beijing, China) at a final concentration of 20 μg/ml in Triton X-100 containing 10 mg/ml RNase. Following incubation, the samples were analyzed on a flow cytometer.

Fragmented DNA was isolated using a DNA extraction kit (C0008; Beyotime) according to the manufacturer’s instructions. The eluants containing DNA pellets were electrophoresed on a 1% agarose gel at 80 V for 1.5 h. The gel was examined and photographed using an ultraviolet gel documentation system.

 Co-immunoprecipitation (Co-IP) and SDS-PAGE

Co-IP was performed using a Profound™ Mammalian Co-IP kit (23605; Pierce). Transfected U937 cells (2×107/ml) were washed, centrifuged and resuspended in lysis buffer for incubation. The cell lysates were centrifuged to remove the supernatant material, and the CAB39L antibody was cross-linked to the antibody coupling resin. The lysed cell sample was then applied to the antibody support to form immune complexes. Then, unbound proteins were washed away three times. The samples were then eluted, and coupling buffer was added to obtain the immunoprecipitated protein. Finally, the Co-IP protein concentrations were determined using a BCA Protein Assay kit (23225; Pierce). The proteins were analyzed by SDS-PAGE, and the gel was stained with Coomassie Blue.

 Mass spectrometry analysis (MS, shotgun) and protein identification

After separation by SDS-PAGE, discrete bands were excised from and subjected to in-gel tryptic digestion. The extracted peptides were analyzed using shotgun HPLC-ESI-MS proteomics approach (LTQ; Thermo Finnigan, San Jose, CA, USA). High-performance liquid chromatography (HPLC) separation was performed with a capillary LC pump. The mobile phases used for the reverse phase were i) 0.1% formic acid in water, pH 3.0; ii) 0.1% formic acid in ACN. The collision energy was set automatically by the LTQ system. Following acquisition of full scan mass spectrum, three MS/MS scans were acquired for the next three most intense ions using dynamic exclusion. Peptides and proteins were identified using Bioworks Browser 3.1 software (Thermo Finnigan), which uses the MS and MS/MS spectra of peptide ions to search against the NCBI human protein database. The protein identification criteria that we used were based on Delta CN (≥0.1) and Xcorr (one charge ≥1.9, two charges ≥2.2, three charges ≥3.75). The protein identification results were extracted from the SEQUEST out file with in-house software (BuildSummary). The cellular localization, molecular function and biologic process were determined using the gene ontology annotation DAVID (http://david.abcc.ncifcrf.gov/). For pathway analysis, the KEGG database was searched. To identify the corresponding proteins in mixed protein obtained by Co-IP, western blot analysis was performed as previously described.

 Statistical analysis

The RT-PCR results were analyzed by the self-contained software of iQ5 (Bio-Rad Co.). Statistical analyses were performed using an analysis of variance (ANOVA). All results are expressed as the means ± standard deviations from at least three experiments. P<0.05 was considered to indicate statistically significant differences.

 Results Expression of human MLAA-34 protein

With western blot analysis, a strong specific band of ~39 kDa was observed in U937 and MHCC97-H cells, and reduced expression was observed in other leukemia or lymphoma cell lines and PBMCs from leukemia patients. Much fainter bands were observed in solid tumor cell lines, and no expression was detected in normal human cell lines or primary animal cells (Fig. 1).

 Identification and cellular localization of MLAA-34

Immunohistochemical staining confirmed the presence of MLAA-34 in U937 cells and the subcellular localization was detected primarily in the cytomembrane and cytoplasm (Fig. 2).

 MLAA-34 is upregulated by the lentiviral vector

A human MLAA-34 lentivirus gene transfer vector encoding the green fluorescent protein (GFP) sequence was constructed. The pGC-FU-MLAA-34-GFP plasmid has an insert of ~771 bp, which is in accord with the MLAA-34 cDNA [identities, 1009/1012 (99%)]. The pilot experiments showed that 293T cells could be successfully infected by the packaged virus; the virus titer reached higher than 2×108 TU/ml, indicating that a high-titer lentiviral packaging platform was preliminarily established. The pGC-FU-MLAA-34-GFP plasmid was confirmed by western blot analysis. MLAA-34-Lentivirus and control pGC-FU-GFP-LV virus were produced. After obtaining ideal U937 cells, we transfected the cells with the MLAA-34-Lentivirus and pGC-FU-GFP-LV viruses at different MOIs. The transfection efficiency was ~95% or higher on Day 5 or later at the MOI of 50 (Fig. 3A). Five days after transfection, the recombinant MLAA-34-Lentivirus caused a pronounced increase in the expression of MLAA-34 compared with non-transfected U937 cells (Fig. 3B).

 Establishment of U937 cell line stably overexpressing MLAA-34

In preliminary studies, 400 μg/ml of G418 were found to maintain adequate selection pressure. The expression of GFP and MLAA-34 were observed. After the cells had been frozen in liquid nitrogen for six months and revived monthly, the U937 cells expressed higher levels of MLAA-34 in ~400 μg/ml of G418, and ~95% of the lentivirus-transfected U937 cells overexpressed MLAA-34. These results suggested that the stably transfected U937 cell line was successfully established by lentivirus and that the expression of MLAA-34 can be long lasting even after passage.

 Effect of upregulating MLAA-34 on apoptosis and growth of U937 cells

Observations of morphology revealed increasing cell shrinkage, nuclear condensation and fragmentation in non-transfected and pGC-FU-GFP-LV transfected cells. By contrast, cells transfected with MLAA-34-Lentivirus predominantly appeared uniformly stained without condensation (Fig. 3C). These results further support the findings that anti-apoptotic changes in the cell and nuclear morphology are induced by MLAA-34 overexpression. MTT assays suggested that the lentiviral overexpression of MLAA-34 induces anti-apoptotic effects that result in a promotion effect on U937 cells; these data suggest that MLAA-34 might accelerate cell proliferation (Fig. 3D). In agreement with the anti-apoptotic effects of MLAA-34, cells overexpressing MLAA-34 accumulated in the S-phase (~67.63% compared with ~49.6% of cells in the S-phase in the control) and showed a corresponding increase in cell numbers in the G2/M phase. The percentages of early (lower right) and late apoptotic (upper right) cells were markedly reduced in U937 cells after transfection with MLAA-34-Lentivirus (Fig. 3E). These results are in agreement with the DNA ladder assay and are even more evident at the MOI=50, in which the cells transfected with MLAA-34-Lentivirus showed a further increase. All of these results suggest that MLAA-34 inhibits apoptosis in U937 cells.

 Co-IP, shotgun and western blot analysis

Protein extracts with Co-IP were separated by SDS-PAGE and the gel was cut into four pieces for shotgun ESI-MS analysis (Fig. 4A). A total of 256 proteins were identified by the LC ESI-MS analysis and BIOWORKS in the NCBI HUMAN protein databases, of which 225 (87.9%) proteins were annotated by DAVID and the remaining 31 (12.1%) proteins have no DAVID terms (Table I). The expression of Rap-1B, Rab-3D, β-catenin and PGK1 was verified by western blot analysis (Fig. 4B).

Classification of the 225 annotated proteins in terms of molecular function, biological process and cellular localization was performed according to the DAVID. Molecular function was clustered and the protein binding (140, 41.8%) and nucleotide binding (60, 17.9%) groups were the majority (Fig. 4C). For biological processes, annotated proteins are particularly involved in the cell process (167, 27.5%) and the multicellular organismal process (75, 12.4%) (Fig. 4D). Most (172, 18.6%) of the annotated proteins were localized in the intracellular (Fig. 4E). Distribution of molecular mass and isoelectric points (PI) of the annotated proteins was analyzed. Molecular mass ranged between 10.19 and 620.42 kDa in size, most of them were between 10 and 60 kDa (Fig. 4F). PI of the proteins ranged between 4.35 and 11.05 with the most PIs between four and ten (Fig. 4G). To uncover the signaling pathways of the 225 annotated proteins, the protein sequences were searched against the KEGG reference pathway database. The pathways were ascribed to metabolism, genetic information processing, environmental information processing, cellular processes, organismal systems and human diseases (Fig. 5). Among them, the immune system, cancer and signal transduction were more than others. On the other hand, the specific expressed proteins related pathways displayed more differences and 71 proteins were involved in cell apoptosis or proliferation biological processes and KEGG pathways (Table I).

 Discussion

In this study, to evaluate the function of MLAA-34 in M5 cells, we used the well-characterized cell line U937. In our previous research, we reported that the MLAA-34 protein is probably a cytoplasmic protein predicted by the amino acid sequence analysis of the encoded protein (7). Here, we verified that MLAA-34 is localized in the cytoplasm and cell membrane. Western blot analysis showed that the expression of MLAA-34 differed between different cell types and was observed to be stronger in U937. Although U937 cells are generally difficult to transfect, the U937 cells were transfected with MLAA-34-Lentivirus and pGC-FU-GFP-LV. A stably transfected U937 cell line was successfully established and expressed MLAA-34 at a high level, which aided in the study exploring the effect of MLAA-34 on M5 and will be critical for further research using U937 cells and animal models. In addition, an analysis of the cell morphology, apoptosis, proliferation and cell cycle revealed that the overexpression of MLAA-34 markedly inhibited apoptosis of U937 cells. These results suggested that MLAA-34 maybe a novel anti-apoptotic factor of M5, which is consistent with the RNAi in our previous study.

The proteins that interact with MLAA-34 or CAB39L remain unclear. To analyze complex mixtures of proteins, shotgun is considered the most powerful (9,10). Using the MLAA-34 protein as bait, 256 proteins were identified and 225 of them have DAVID terms. Among these proteins, 71 proteins correlated with cell apoptosis or proliferation biological processes and KEGG pathways. Twenty-eight proteins are involved in cell apoptosis or proliferation; nine proteins are associated with the calcium signaling pathway and seven proteins participate in the chemokine signaling pathway; 17 proteins are concerned with the Ras signaling transduction pathway and 8 proteins are concerned with Wnt signaling pathway. The Ras, Wnt, calcium and chemokine signaling pathways may be involved in anti-apoptosis with MLAA-34 in U937 cells. As is known, the Ras family plays an important role in the molecular pathogenesis of myeloid leukemia, and Ras mutations have been preferentially associated with monocytic subtypes in AML (11). The Ras and Wnt signaling pathways are known to be key anti-apoptosis pathways in AML-M5 (12). Understanding the molecular genetics of leukemia has led to an appreciation that particular molecular abnormalities give rise to specific subtypes of the disease. For example, in myeloid leukemogenesis, PML-RAR-α and BCR-ABL are defining features of acute promyelocytic leukemia and chronic myeloid leukemia, respectively (13). In this case, MLAA-34 may either play an important role in leukemogenesis or play a dual role in subsequent differentiation, as in the case of PML/RAR. The results suggest that MLAA-34 might be an important agent for subtype diagnosis in AML. However, an understanding of how these identified proteins or pathways interact with MLAA-34 requires further study.

In addition to the typical pathways such as pathways in cancer and apoptosis, there were several notable pathways such as the GPCR signaling, the insulin signaling pathway, the ErbB signaling pathway, the NOD-like receptor signaling pathway, the Ahr signal transduction pathway, the AKT signaling pathway, the Toll-like receptor signaling pathway, the RIG-I-like receptor signaling pathway, the ubiquitin mediated proteolysis, the hedgehog signaling pathway, the phosphatidylinositol signaling system, the PPAR signaling pathway, the VEGF signaling pathway and the TGF-β signaling pathway worthy of further validation (Table I). Otherwise, there are some proteins mainly involved in tumorigenesis concerned with MLAA-34 as discussed below. PGK1 is secreted by tumor cells and may play a role in inhibiting tumor angiogenesis (14). GAPDH has been shown to be upregulated in several types of cancer and downregulated by chemotherapeutic drugs, and could be considered a potential target to observe the effects of bisphosphonates on cancer cells (15). In addition, GAPDH was the best control gene in the apoptosis pattern on the myeloid cell lines (16). CRMP1 is a suppressor of tumor cell invasion of the local stroma and might be a functional modulator of the Wnt signaling pathway in vivo(17,18). As the trigger of TBK-1 pathway, TBK1 is important for tumor angiogenesis and tumor-associated microvascular inflammation and expressed at significant levels in many solid tumors (19,20). A recent study has demonstrated that SEPT7 could function in gliomagenesis and in the suppression of glioma cell proliferation (21).

Markedly, some p53 or caspase-related proteins were also identified, such as CLTC, PPP2CA, SOD2, PARK7, HSPA9, TXN, ESR1 and YWHAE. CLTC associates with p53 not only in nuclei but also in cytosol, and co-localizes with p53 at the plasma membrane in human cancer cells (22). CLTC expression enhances p53-dependent transactivation (23). As a downstream mediator of the antiproliferative effects of PPP2CA, p53 plays an important role in PPP2CA-directed cell cycle arrest and apoptosis (24). The SOD2 growth-retarding functions are at least partially due to triggering of a p53-dependent cellular senescence program (25). DJ-1 (PARK7) bound to p53 in vitro and in vivo and they were found colocalized. DJ-1 positively regulates p53 through Topors-mediated sumoylation (26). Previous studies indicated that HSPA9 could bind to p53 and sequesters it in the cytoplasm, thus providing a mechanism of inactivation of wild-type p53 and contributing to human carcinogenesis (27,28). Additional studies have shown that TXN induces p53 DNA binding activity in vitro and enhances p53-dependent expression of its target gene p21 and DNA repair genes (29). Additional studies also indicated that caspases could be activated by TXN due to its disulfide reducing properties (30). ESR1 might activate caspases-8, −9 and −3 and induce tumor cell apoptosis, it also showed the downregulation of β-catenin signaling implicating the suppression of proliferation and metastasis of tumor cells (31,32). The cleavage of YWHAE by caspase-3 during apoptosis might contribute to cell death by preventing the association of YWHAE with Bad (33). The key event during apoptosis that is common to all pathways is the activation of caspases. P53 is a well-known tumor suppressor gene, and mutational inactivation of p53 function or deletion of the gene increases susceptibility to cancer (34–37). On the basis of these findings, we will further study the interaction between MLAA-34 and caspases or p53 to investigate the anti-apoptotic mechanisms of MLAA-34 in U937 cells.

To our knowledge, this is the first report showing the cellular localization and expression of MLAA-34 in U937 cells. We have demonstrated for the first time that the overexpression of MLAA-34 by lentivirus can significantly suppress the apoptosis of U937 cells, and a cell line stably overexpressing MLAA-34 was successfully established. Another key finding of this study is the information from proteomics evidence that MLAA-34 may be a tumor-correlated gene, and this is the first time it is revealed that the preliminary framework of proteins and pathways interlink with MLAA-34 in U937. Furthermore, it will be essential to integrate data from many different sources to obtain an accurate understanding of MLAA-34 protein networks.

Gene therapy remains the most promising, if not the only, approach to treating genetic diseases. An example of this is the use of rituximab for the treatment of lymphoma and other types of cancer. Rituximab is a mouse/human chimeric IgG(1)-κ monoclonal antibody that targets the CD20 antigen found on the surface of malignant and normal B lymphocytes (38). Most cellular processes are performed by multiprotein complexes. The identification and analysis of their components provides insight into how the ensemble of expressed proteins (the proteome) is organized into functional units (39). Nevertheless, for a viable clinical approach, extensive research is needed in the future to regulate the expression of the target gene and improve its safety.

In conclusion, our current results provide new evidence that MLAA-34 may be a novel anti-apoptotic factor in vitro, and the data presented here show a strong correlation between anti-apoptosis with the upregulation of MLAA-34. In addition, preliminary proteomic analysis suggests that a number of genes belonging to different signaling pathways may be involved in apoptosis in U937 cells in association with MLAA-34, which would disclose a novel cross-link between MLAA-34 and the Ras, Wnt, calcium and chemokine signaling pathways. Findings of the present study will lead to a better understanding of the mechanisms involved in M5, and MLAA-34 may serve as a potential novel marker for the early diagnosis and gene therapy of M5.

 Acknowledgements

This study was supported by the National Natural Science Foundation of China under award nos. 30971284, 81000219 and 18110021.

 References OssenkoppeleGJGravelandWJSonneveldPDaenenSMBiesmaDHVerdonckLFSchaafsmaMRWestveerPHPetersGJNoordhuisPMuusPSelleslagDvan der HoltBDelforgeMLowenbergBVerhoefGEThe value of fludarabine in addition to ARA-C and G-CSF in the treatment of patients with high-risk myelodysplastic syndromes and AML in elderly patientsBlood103290829132004 FaderlSGandhiVO’BrienSBonatePCortesJEsteyEBeranMWierdaWGarcia-ManeroGFerrajoliAEstrovZGilesFJDuMKwariMKeatingMPlunkettWKantarjianHResults of a phase 1–2 study of clofarabine in combination with cytarabine (ara-C) in relapsed and refractory acute leukemiasBlood1059409472005 FiedlerWServeHDöhnerHSchwittayMOttmannOGO’FarrellAMBelloCLAllredRManningWCCherringtonJMLouieSGHongWBregaNMMassiminiGScigallaPBerdelWEHossfeldDKA phase 1 study of SU11248 in the treatment of patients with refractory or resistant acute myeloid leukemia (AML) or not amenable to conventional therapy for the diseaseBlood1059869932005 NiitsuNYamamoto-YamaguchiYKasukabeTOkabe-KadoJUmedaMHonmaYAntileukemic efficacy of 2-deoxycoformycin in monocytic leukemia cellsBlood96151215162000 TallmanMSKimHTPaiettaEBennettJMDewaldGCassilethPAWiernikPHRoweJMAcute monocytic leukemia (French-American-British classification M5) does not have a worse prognosis than other subtypes of acute myeloid leukemia: a report from the Eastern Cooperative Oncology GroupJ Clin Oncol22127612862004 ChenGZhangWCaoXLiFLiuXYaoLSerological identification of immunogenic antigens in acute monocytic leukemiaLeuk Res295035092005 ZhangPYZhangWGHeALWangJLLiWBIdentification and functional characterization of the novel acute monocytic leukemia associated antigen MLAA-34Cancer Immunol Immunother582812902009 ZhaoJHeAZhangWMengXGuLQuantitative assessment of MLAA-34 expression in diagnosis and prognosis of acute monocytic leukemiaCancer Immunol Immunother605875972011 LuBMcClatchyDBKimJYYatesJRIIIStrategies for shotgun identification of integral membrane proteins by tandem mass spectrometryProteomics8394739552008 HePHeHZDaiJWangYShengQHZhouLPZhangZSSunYLLiuFWangKZhangJSWangHXSongZMZhangHRZengRZhaoXThe human plasma proteome: analysis of Chinese serum using shotgun strategyProteomics5344234532005 BowenDTFrewMEHillsRGaleREWheatleyKGrovesMJLangabeerSEKottaridisPDMoormanAVBurnettAKLinchDCRAS mutation in acute myeloid leukemia is associated with distinct cytogenetic subgroups but does not influence outcome in patients younger than 60 yearsBlood106211321192005 MorganMADolpOReuterCWCell-cycle-dependent activation of mitogen-activated protein kinase kinase (MEK-1/2) in myeloid leukemia cell lines and induction of growth inhibition and apoptosis by inhibitors of RAS signalingBlood97182318342001 PearnLFisherJBurnettAKDarleyRLThe role of PKC and PDK1 in monocyte lineage specification by RasBlood109446144692007 LayAJJiangXMKiskerOFlynnEUnderwoodACondronRHoggPJPhosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductaseNature4088698732000 ValentiMTBertoldoFDalle CarbonareLAzzarelloGZenariSZanattaMBalducciEVinanteOLo CascioVThe effect of bisphosphonates on gene expression: GAPDH as a housekeeping or a new target gene?BMC Cancer6492006 UllmannováVHaskovecCThe use of housekeeping genes (HKG) as an internal control for the detection of gene expression by quantitative real-time RT-PCRFolia Biol (Praha)492112162003 PanSHChaoYCHungPFChenHYYangSCChangYLWuCTChangCCWangWLChanWKWuYYCheTFWangLKLinCYLeeYCKuoMLLeeCHChenJJHongTMYangPCThe ability of LCRMP-1 to promote cancer invasion by enhancing filopodia formation is antagonized by CRMP-1J Clin Invest121318932052011 StelzlUWormULalowskiMHaenigCBrembeckFHGoehlerHStroedickeMZenknerMSchoenherrAKoeppenSTimmJMintzlaffSAbrahamCBockNKietzmannSGoeddeAToksözEDroegeAKrobitschSKornBBirchmeierWLehrachHWankerEEA human protein-protein interaction network: a resource for annotating the proteomeCell1229579682005 KorherrCGilleHSchäferRKoenig-HoffmannKDixeliusJEglandKAPastanIBrinkmannUIdentification of proangiogenic genes and pathways by high-throughput functional genomics: TBK1 and the IRF3 pathwayProc Natl Acad Sci USA103424042452006 CzabankaMKorherrCBrinkmannUVajkoczyPInfluence of TBK-1 on tumor angiogenesis and microvascular inflammationFront Biosci13724372492008 JiaZFHuangQKangCSYangWDWangGXYuSZJiangHPuPYOverexpression of septin 7 suppresses glioma cell growthJ Neurooncol983293402010 EndoYSugiyamaALiSAOhmoriKOhataHYoshidaYShibuyaMTakeiKEnariMTayaYRegulation of clathrin-mediated endocytosis by p53Genes Cells133753862008 EnariMOhmoriKKitabayashiITayaYRequirement of clathrin heavy chain for p53-mediated transcriptionGenes Dev20108710992006 OfekPBen-MeirDKariv-InbalZOrenMLaviSCell cycle regulation and p53 activation by protein phosphatase 2C alphaJ Biol Chem27814299143052003 BehrendLMohrADickTZwackaRMManganese superoxide dismutase induces p53-dependent senescence in colorectal cancer cellsMol Cell Biol25775877692005 ShinboYTairaTNikiTIguchi-ArigaSMArigaHDJ-1 restores p53 transcription activity inhibited by Topors/p53BP3Int J Oncol266416482005 GroverAPriyandokoDGaoRShandilyaAWidodoNBisariaVSKaulSCWadhwaRSundarDWithanone binds to mortalin and abrogates mortalin-p53 complex: Computational and experimental evidenceInt J Biochem Cell Biol444965042012 WadhwaRYaguchiTHasanMKMitsuiYReddelRRKaulSCHsp70 family member, mot-2/mthsp70/GRP75, binds to the cytoplasmic sequestration domain of the p53 proteinExp Cell Res2742462532002 UenoMMasutaniHAraiRJYamauchiAHirotaKSakaiTInamotoTYamaokaYYodoiJNikaidoTThioredoxin-dependent redox regulation of p53-mediated p21 activationJ Biol Chem27435809358151999 UedaSNakamuraHMasutaniHSasadaTYoneharaSTakabayashiAYamaokaYYodoiJRedox regulation of caspase-3(-like) protease activity: regulatory roles of thioredoxin and cytochrome cJ Immunol161668966951998 HsuHHChengSFChenLMLiuJYChuCHWengYJLiZYLinCSLeeSDKuoWWHuangCYOver-expressed estrogen receptor-α upregulates hTNF-α gene expression and downregulates β-catenin signaling activity to induce the apoptosis and inhibit proliferation of LoVo colon cancer cellsMol Cell Biochem2891011092006 KouzmenkoAPTakeyamaKItoSFurutaniTSawatsubashiSMakiASuzukiEKawasakiYAkiyamaTTabataTKatoSWnt/β-catenin and estrogen signaling converge in vivoJ Biol Chem27940255402582004 WonJKimDYLaMKimDMeadowsGGJoeCOCleavage of 14–3–3 protein by caspase-3 facilitates bad interaction with Bcl-x(L) during apoptosisJ Biol Chem27819347193512003 VousdenKHPrivesCP53 and prognosis: new insights and further complexityCell1207102005 VousdenKHLaneDPp53 in health and diseaseNat Rev Mol Cell Biol82752832007 PietschECSykesSMMcMahonSBMurphyMEThe p53 family and programmed cell deathOncogene27650765212008 KruseJPGuWModes of p53 regulationCell1376096222009 PloskerGLFiggittDPRituximab: a review of its use in non-Hodgkin’s lymphoma and chronic lymphocytic leukaemiaDrugs638038432003 GavinACBöscheMKrauseRGrandiPMarziochMBauerASchultzJRickJMMichonAMCruciatCMRemorMHöfertCSchelderMBrajenovicMRuffnerHMerinoAKleinKHudakMDicksonDRudiTGnauVBauchABastuckSHuhseBLeutweinCHeurtierMACopleyRREdelmannAQuerfurthERybinVDrewesGRaidaMBouwmeesterTBorkPSeraphinBKusterBNeubauerGSuperti-FurgaGFunctional organization of the yeast proteome by systematic analysis of protein complexesNature4151411472002

Expression of MLAA-34 by western blot analysis. A, commixture of M5 patient PBMCs; B, commixture of non-M5 acute leukemia patient PBMCs; C, normal human PBMCs; D, human epithelial tissue.

The subcellular localization of MLAA-34 protein in U937 cells (x40). The MLAA-34 protein was distributed predominantly in the cytomembrane and cytoplasm (red or green). The nuclei were stained by DAPI (x40).

Lentivirus-mediated gene transfer system for overexpression of MLAA-34 was constructed successfully and markedly decreases apoptosis and promotes proliferation in U937 cells. (A) Morphological observation of MLAA-34-Lentivirus transfected U937 cells at different MOIs. The transfection efficiency was higher at MOI=50 and 80, but the growth condition was the best at MOI=50. (B) MLAA-34-Lentivirus upregulated the expression of MLAA-34 in U937 cells, estimated by western blot analysis (left) and RT-PCR (right). (C) Morphological changes in the morphology of the cell nucleus were observed by DAPI staining (blue). (D) Cell viability was measured by MTT assays. (E) The cells were stained with Annexin V-PE and 7-AAD for flow cytometry analysis.

Proteomics analysis of MLAA-34 in stably transfected U937 cells. (A) SDS-PAGE gel images after Co-IP and the cutting sites in the gel band. Four spaced sections were excised. From left to right were cell lysate, elutriant after Co-IP, sediment after Co-IP and marker. (B) Western blot analysis. The major bands that migrated at ~21, 25, 92 and 45 kDa corresponding to Rap-1B, Rab-3D, β-catenin and PGK1. (C-E) Numbers and percentages of the annotated proteins with molecular function, biological process and cellular localization. (F and G) Distributions of theoretical molecular mass and PI for all of the annotated proteins.

Categories of related pathways in 225 annotated proteins according to KEGG pathway taxonomy.

The 225 annotated proteins identified by the shotgun approach.

No. Accession no. Protein description Biological processes (partly) KEGG pathways (partly)
1 IPI00022434 ALB albumin Apoptosis
2 IPI00023598 TUBB4 tubulin β-4 chain
3 IPI00013475 TUBB2A tubulin β-2A chain
4 IPI00180675 TUBA1A tubulin α-1A chain
5 IPI00387144 TUBA1B tubulin α-1B chain
6 IPI00013683 TUBB3 tubulin β-3 chain
7 IPI00007752 TUBB2C tubulin β-2C chain Apoptosis
8 IPI00218343 TUBA1C tubulin α-1C chain
9 IPI00021439 ACTB actin, cytoplasmic 1
10 IPI00646909 TUBA8 tubulin α-8 chain
11 IPI00646779 TUBB6 tubulin β-6 chain
12 IPI00257508 DPYSL2 dihydropyrimidinase-related protein 2
13 IPI00908469 cDNA FLJ52712, highly similar to Tubulin β-6 chain
14 IPI00410714 HBA1; HBA2 hemoglobin, α-2; hemoglobin, α-1
15 IPI00021428 ACTA1 actin, α skeletal muscle
16 IPI00026268 GNB1 guanine nucleotide-binding proteinG(I)/G(S)/G(T) subunit β-1 Cell proliferation, Ras protein signal transduction Chemokine signaling pathway, Attenuation of GPCR signaling, Erk1/Erk2 MAPK signaling pathway, CXCR4 signaling pathway
17 IPI00220281 GNAO1 isoform A-1 of Guanine nucleotide-binding protein G(o) subunit α Regulation of calcium ion transport, G-protein coupled receptor protein signaling pathway
18 IPI00021907 MBP myelin basic protein
19 IPI00024067 CLTC clathrin heavy chain 1
20 IPI00216171 ENO2 enolase 2 (γ, neuronal)
21 IPI00465248 ENO1 isoform α-enolase of A-enolase
22 IPI00220706 HBG1 hemoglobin subunit γ-1
23 IPI00219018 GAPDH glyceraldehyde-3-phosphate dehydrogenase
24 IPI00398700 GNAO1 isoform A-2 of Guanine nucleotide-binding protein G(o) subunit α Regulation of calcium ion transport, G-protein coupled receptor protein signaling pathway
25 IPI00025363 GFAP glial fibrillary acidic protein
26 IPI00303476 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, β polypeptide
27 IPI00022977 CKB creatine kinase B-type
28 IPI00413140 DNM1 dynamin 1
29 IPI00154742 IGL λ protein
30 IPI00022463 TF serotransferrin
31 IPI00220737 NCAM1 neural cell adhesion molecule 1 Regulation of calcium-mediated signaling
32 IPI00022891 SLC25A4 ADP/ATP translocase 1 Calcium signaling pathway
33 IPI00007188 SLC25A5 ADP/ATP translocase 2 Calcium signaling pathway
34 IPI00009532 ABAT 4-aminobutyrate aminotransferase, mitochondrial
35 IPI00012451 GNB4 guanine nucleotide-binding protein subunit β-4 Chemokine signaling pathway
36 IPI00291006 MDH2 malate dehydrogenase 2, NAD (mitochondrial)
37 IPI00298497 FGB fibrinogen β chain
38 IPI00220993 CNP 2′,3′-cyclic nucleotide 3′ phosphodiesterase
39 IPI00027547 DCD dermcidin
40 IPI00219446 PEBP1 phosphatidylethanolamine-binding protein 1 Regulation of cAMP-mediated signaling, regulation of MAPKKK cascade Calcium signaling pathway
41 IPI00414123 CRMP1 collapsin response mediator protein 1
42 IPI00217507 NEFM neurofilament, medium polypeptide
43 IPI00465439 ALDOA aldolase A, fructose-bisphosphate
44 IPI00029111 DPYSL3 dihydropyrimidinase-like 3
45 IPI00219813 RTN1 reticulon-1
46 IPI00001453 INA α-internexin
47 IPI00237671 NEFL neurofilament light polypeptide Apoptosis
48 IPI00743576 ATP6V0A1 ATPase, H+ transporting, lysosomal V0 subunit a1
49 IPI00418262 ALDOC fructose-bisphosphate aldolase C Apoptosis
50 IPI00029751 CNTN1 contactin-1 Notch signaling pathway
51 IPI00549543 NCDN neurochondrin
52 IPI00024975 KIF15 kinesin family member 15
53 IPI00027497 GPI glucose-6-phosphate isomerase
54 IPI00010154 GDI1 GDP dissociation inhibitor 1 Small GTPase mediated signal transduction
55 IPI00554752 PRKAR2B protein kinase, cAMP-dependent, regulatory, type II, β Apoptosis, Insulin signaling pathway
56 IPI00028888 HNRNPD heterogeneous nuclear ribonucleoprotein D0
57 IPI00033025 SEPT7 septin 7
58 IPI00784156 AP2B1 adaptor-related protein complex 2, β1 subunit
59 IPI00026272 HIST1H2AB; HIST1H2AE histone cluster 1, H2ae; histone cluster 1, H2ab
60 IPI00219661 PLP1 proteolipid protein 1
61 IPI00015671 TUBAL3 tubulin α chain-like 3
62 IPI00216298 TXN thioredoxin Cell proliferation
63 IPI00215715 CAMK2A calcium/calmodulin-dependent protein kinase II α Regulation of NF-κB transcription factor activity ErbB signaling pathway, Calcium signaling pathway, Wnt signaling pathway
64 IPI00020926 HOXA4 homeobox A4
65 IPI00022314 SOD2 superoxide dismutase 2, mitochondrial Cell proliferation, apoptosis
66 IPI00024266 MGST3 microsomal glutathione S-transferase 3
67 IPI00382470 HSP90AA1 heat shock protein 90 kDa α (cytosolic), class A member 1 isoform 1 NOD-like receptor signaling pathway, pathways in cancer, Ahr signal transduction pathway, AKT signaling pathway
68 IPI00019971 STXBP2 syntaxin-binding protein 2
69 IPI00289861 ZCCHC11 zinc finger CCHC domain-containing protein 11
70 IPI00013508 ACTN1 α-actinin-1
71 IPI00007682 ATP6V1A V-type proton ATPase catalytic subunit A
72 IPI00003925 PDHB pyruvate dehydrogenase E1 component subunit β, mitochondrial
73 IPI00910290 Aryl hydrocarbon receptor nuclear translocator Cell proliferation Pathways in cancer, Ahr signal transduction pathway
74 IPI00022488 HPX hemopexin Regulation of protein kinase cascade, interferon-γ-mediated signaling pathway, regulation of JAK-STAT cascade
75 IPI00023302 SYN2 synapsin-2
76 IPI00902614 USP24 ubiquitin carboxyl-terminal hydrolase 24
77 IPI00220644 PKM2 pyruvate kinase isozymes M1/M2
78 IPI00414676 HSP90AB1 heat shock protein HSP 90-β Interferon-γ-mediated signaling pathway, type I interferon-mediated signaling pathway NOD-like receptor signaling pathway, pathways in cancer
79 IPI00647704 IGHA1 immunoglobulin heavy constant α 1
80 IPI00215747 FABP7 fatty acid-binding protein, brain Cell proliferation PPAR signaling pathway
81 IPI00026053 CLDN11 claudin-11
82 IPI00025447 EEF1A1 elongation factor 1-α
83 IPI00182944 CAMK2B calcium/calmodulin-dependent protein kinase type II β chain ErbB signaling pathway, Calcium signaling pathway, Wnt signaling pathway
84 IPI00411486 OPALIN opalin
85 IPI00299608 PSMD1 proteasome (prosome, macropain)26S subunit, non-ATPase, 1
86 IPI00299399 S100B protein S100-B Cell proliferation Calcium signaling pathway
87 IPI00175169 ARFGAP1 ADP-ribosylation factorGTPase-activating protein 1 Small GTPase mediated signal transduction, Ras protein signal transduction
88 IPI00005614 SPTBN1 spectrin β chain, brain 1
89 IPI00017597 MAPRE3 microtubule-associated proteinRP/EB family member 3
90 IPI00175092 RNF149 ring finger protein 149
91 IPI00293613 TBK1 TANK-binding kinase 1 Regulation of protein kinase cascade, regulation of I-κB kinase/NF-κB cascade Toll-like receptor signaling pathway, RIG-I-like receptor signaling pathway
92 IPI00015029 PTGES3 prostaglandin E synthase 3
93 IPI00169383 PGK1 phosphoglycerate kinase 1
94 IPI00015148 RAP1B ras-related protein Rap-1b Cell proliferation, small GTPase mediated signal transduction MAPK signaling pathway, Chemokine signaling pathway
95 IPI00028946 RTN3 reticulon-3 Apoptosis
96 IPI00163849 EPS15L1 epidermal growth factor receptor substrate 15-like 1 Calcium ion binding
97 IPI00645078 UBA1 ubiquitin-like modifier-activating enzyme 1 Ubiquitin mediated proteolysis
98 IPI00005705 PPP1CC γ-1 of serine/threonine-protein phosphatase PP1-γ catalytic subunit Insulin signaling pathway
99 IPI00159927 NCAN neurocan core protein Calcium ion binding
100 IPI00003420 MAPRE2 microtubule-associated protein, RP/EB family, member 2 Cell proliferation
101 IPI00017566 FBXL7 F-box/LRR-repeat protein 7
102 IPI00027252 PHB2 prohibitin-2
103 IPI00015141 CKMT2 creatine kinase, sarcomeric mitochondrial
104 IPI00027770 SYP synaptophysin
105 IPI00290035 PCDH15 protocadherin-15 Calcium ion binding
106 IPI00027462 S100A9 S100 calcium binding protein A9 Calcium ion binding
107 IPI00022462 TFRC transferrin receptor protein 1
108 IPI00300020 SLC1A2 excitatory amino acid transporter 2
109 IPI00019884 ACTN2 α-actinin-2 Apoptosis
110 IPI00000875 EEF1G cDNA FLJ56389, highly similar to Elongation factor 1-γ
111 IPI00435928 RASGRF1 Ras protein-specific guanine nucleotide-releasing factor 1 Ras signaling pathway
112 IPI00790581 MPRIP protein
113 IPI00383660 ZNF530 zinc finger protein 530
114 IPI00218896 ADH1A alcohol dehydrogenase 1A
115 IPI00300341 TCEB1 transcription elongation factor B polypeptide 1 Ubiquitin mediated proteolysis, pathways in cancer
116 IPI00021891 FGG Γ-B of Fibrinogen γ chain
117 IPI00747180 WDR52 WD repeat protein 52
118 IPI00642126 KIAA1618 isoform 1 of protein ALO17
119 IPI00164441 UNC13A unc-13 homolog A
120 IPI00027820 ESPN isoform 1 of Espin
121 IPI00185659 CCDC62 isoform 2 of Coiled-coil domain-containing protein 60
122 IPI00000816 YWHAE 14-3-3 protein epsilon Apoptosis
123 IPI00160552 TNR isoform 1 of Tenascin-R
124 IPI00164347 CNGB1 cyclic nucleotide gated channel β 1 isoform b
125 IPI00166979 KIAA1239 Leucine-rich repeat and WD repeat-containing protein KIAA1239
126 IPI00217240 WDR75 WD repeat-containing protein 75
127 IPI00017704 COTL1 coactosin-like protein
128 IPI00008305 HPCAL4 hippocalcin-like protein 4
129 IPI00440493 ATP5A1 ATP synthase subunit α, mitochondrial Cell proliferation
130 IPI00024547 C2orf25 chromosome 2 open reading frame 25
131 IPI00074962 ANK2 isoform 4 of Ankyrin-2
132 IPI00395663 ANKS1A ankyrin repeat and SAM domain-containing protein 1A
133 IPI00029769 HCK isoform p59-HCK of Tyrosine-protein kinase HCK Chemokine signaling pathway, GPCR signaling
134 IPI00216592 HNRNPC isoform C1 of Heterogeneous nuclear ribonucleoproteins C1/C2
135 IPI00000792 CRYZ quinone oxidoreductase
136 IPI00219806 S100A7 S100 calcium binding protein A7 S100/CaBP-9k-type, calcium binding
137 IPI00216856 ANKMY2 ankyrin repeat and MYND domain-containing protein 2
138 IPI00027434 RHOC rho-related GTP-binding protein RhoC Small GTPase mediated signal transduction, regulation of I-κB kinase/NF-κB cascade Ras signaling pathway
139 IPI00396341 C2orf67 chromosome 2 open reading frame 67
140 IPI00015785 CRB1 crumbs homolog 1 Calcium ion binding
141 IPI00893234 OBSL1 obscurin-like 1
142 IPI00028277 FTO isoform 1 of Protein fto
143 IPI00060800 LOC124220 uncharacterized protein UNQ773/PRO1567
144 IPI00007765 HSPA9 stress-70 protein, mitochondrial Anti-apoptosis
145 IPI00852669 ZNF516 zinc finger protein 516
146 IPI00024994 TULP4 tubby-related protein 4
147 IPI00010466 PRKCB isoform B-I of protein kinase C β type MAPK signaling pathway, ErbB signaling pathway, Calcium signaling pathway, Chemokine signaling pathway, Phosphatidylinositol signaling system, Wnt signaling pathway, VEGF signaling pathway, pathways in cancer
148 IPI00815811 ZNF235 zinc finger protein 235
149 IPI00163187 FSCN1 fascin homolog 1 Cell proliferation
150 IPI00793780 TMCO5B transmembrane and coiled-coil domain-containing protein 5B
151 IPI00011088 CLDN12 claudin-12
152 IPI00011986 C5orf42 chromosome 5 open reading frame 42
153 IPI00061780 ITCH itchy E3 ubiquitin protein ligase homolog Cell proliferation Ubiquitin mediated proteolysis
154 IPI00152653 DNAH5 dynein heavy chain 5, axonemal
155 IPI00175416 PLCH11-phosphatidylinositol-4,5-bisphosphate phosphodiesterase β-1 Calcium ion binding
156 IPI00218352 ESR1 estrogen receptor1 Estrogen receptor signaling pathway
157 IPI00791536 MCF.2 cell line derived transforming sequence-like 2 Regulation of Rho protein signal transduction, regulation of Ras protein signal transduction, regulation of small GTPase mediated signal transduction
158 IPI00009619 CADM3 isoform 2 of cell adhesion molecule 3
159 IPI00179330 UBC; RPS27A; UBB ubiquitin and ribosomal protein S27a precursor Apoptosis
160 IPI00217776 ICK intestinal cell (MAK-like) kinase
161 IPI00009439 SYT1 synaptotagmin-1 Calcium ion binding
162 IPI00784869 DNAH10 isoform 1 of Dynein heavy chain 10, axonemal
163 IPI00020265 ANKRD20A1 ankyrin repeat domain-containing protein 20A1
164 IPI00007189 CDC42 isoform 1 of cell division control protein 42 homolog MAPK signaling pathway, Chemokine signaling pathway, VEGF signaling pathway, Pathways in cancer, Ras signaling pathway
165 IPI00032325 CSTA cystatin-A
166 IPI00032808 RAB3D ras-related protein Rab-3D Small GTPase mediated signal transduction Ras signaling pathway
167 IPI00216308 VDAC1 voltage-dependent anion-selective channel protein 1 Apoptosis Calcium signaling pathway
168 IPI00021841 APOA1 apolipoprotein A-I Cell proliferation, small GTPase mediated signal transduction, Ras protein signal transduction, Rho protein signal transduction, Cdc42 protein signal transduction, G-protein coupled receptor protein signaling pathway PPAR signaling pathway
169 IPI00645906 CXorf39 isoform 1 of uncharacterized protein CXorf39
170 IPI00220032 CTNND2 isoform 2 of Catenin δ-2
171 IPI00002459 ANXA6 Annexin VI isoform 2 Calcium ion transport
172 IPI00184119 DNAJC6 isoform 2 of putative tyrosine-protein phosphatase auxilin
173 IPI00152949 TMEM168 transmembrane protein 168
174 IPI00032402 ATP8A1 isoform long of probable phospholipid-transporting ATPase IA
175 IPI00008380 PPP2CA serine/threonine-protein phosphatase 2A catalytic subunit α isoform Apoptosis, MAPKKK cascade, second-messenger-mediated signaling, regulation of JAK-STAT cascade Wnt signaling pathway, TGF-β signaling pathway, AKT signaling pathway, Erk1/Erk2 MAPK signaling pathway
176 IPI00219217 LDHB L-lactate dehydrogenase B chain
177 IPI00394855 C12orf63 chromosome 12 open reading frame 63
178 IPI00025366 CS citrate synthase, mitochondrial
179 IPI00218570 PGAM2 phosphoglycerate mutase 2
180 IPI00303484 OR52K2 olfactory receptor 52K2 G-protein coupled receptor protein signaling pathway
181 IPI00005565 DGKQ diacylglycerol kinase θ G-protein coupled receptor protein signaling pathway, activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway Phosphatidylinositol signaling system
182 IPI00168218 DOK7 isoform 2 of protein Dok-7
183 IPI00154645 TBC1D15 isoform 1 of TBC1 domain family member 15 Rab protein signal transduction, Ras protein signal transduction, small GTPase mediated signal transduction
184 IPI00386494 SPPL2B isoform 1 of signal peptide peptidase-like 2B
185 IPI00465436 CAT catalase Apoptosis, regulation of protein kinase cascade, regulation of phosphoinositide 3-kinase cascade, regulation of NF-κB transcription factor activity
186 IPI00007612 KCNJ1 isoform 1 of ATP-sensitive inward rectifier potassium channel 1
187 IPI00020153 BSN protein bassoon
188 IPI00298547 PARK7 protein DJ-1 Small GTPase mediated signal transduction, Ras protein signal transduction
189 IPI00456969 DYNC1H1 cytoplasmic dynein 1 heavy chain 1
190 IPI00030144 PPIAL4C; PPIAL4A; PPIAL4G; PPIAL4B Peptidylprolyl cis-trans isomerase A-like 4B
191 IPI00376119 PRKACB isoform 2 of cAMP-dependent protein kinase catalytic subunit β G-protein coupled receptor protein signaling pathway, second-messenger-mediated signaling, cAMP-mediated signaling MAPK signaling pathway, Calcium signaling pathway, Chemokine signaling pathway, Apoptosis, Wnt signaling pathway, Hedgehog signaling pathway, Insulin signaling pathway
192 IPI00025753 DSG1 desmoglein-1 Calcium ion binding
193 IPI00292934 USP53 inactive ubiquitin carboxyl-terminal hydrolase 53
194 IPI00024684 MX2 interferon-induced GTP-binding protein Mx2
195 IPI00384998 NFASC isoform 7 of Neurofascin
196 IPI00217494 SMG7 smg-7 homolog, nonsense mediatedmRNA decay factor (C. elegans)
197 IPI00171594 DACT1 dapper homolog 1 Wnt receptor signaling pathway
198 IPI00006612 SNAP91 isoform 1 of Clathrin coat assembly protein AP180
199 IPI00291922 PSMA5 proteasome subunit α type-5
200 IPI00056040 NRN1L neuritin-like protein
201 IPI00013421 GPM6B isoform 1 of neuronal membrane glycoprotein M6-b
202 IPI00738216 KIAA0947 isoform 1 of uncharacterized protein KIAA0947
203 IPI00022133 EPB41L2 4.1G protein
204 IPI00853219 RAPGEF2 rap guanine nucleotide exchange factor 2 Small GTPase mediated signal transduction, cAMP-mediated signaling MAPK signaling pathway
205 IPI00375609 JAKMIP3 janus kinase and microtubule-interacting protein 3
206 IPI00178185 BICD2 isoform 1 of protein bicaudal D homolog 2
207 IPI00006146 SAA2 serum amyloid A2
208 IPI00014843 LRRC16A isoform 1 of Leucine-rich repeat-containing protein 16A
209 IPI00183368 SMG1 phosphatidylinositol 3-kinase-related kinase (C. elegans)
210 IPI00019038 LYZ lysozyme C
211 IPI00397801 FLG2 filaggrin-2 Calcium ion binding
212 IPI00186290 EEF2 elongation factor 2
213 IPI00783097 GARS glycyl-tRNA synthetase
214 IPI00029468 ACTR1A α-centractin
215 IPI00010845 NDUFS8 NADH dehydrogenase (ubiquinone) iron-sulfur protein 8, mitochondrial
216 IPI00256861 MACF1 microtubule-actin crosslinking factor 1 Wnt receptor signaling pathway, calcium ion binding
217 IPI00017292 CTNNB1 Catenin β-1 Apoptosis, cell proliferation, regulation of MAPKKK cascade Wnt signaling pathway, pathways in cancer
218 IPI00005966 NDUFA12 13 kDa differentiation-associated protein variant (Fragment)
219 IPI00022229 APOB apolipoprotein B-100
220 IPI00307259 DNAJC13 dnaJ homolog subfamily C member 13
221 IPI00216085 COX6B1 cytochrome c oxidase subunit VIb isoform 1
222 IPI00022774 VCP valosin-containing protein Apoptosis, ER-nuclear signaling pathway
223 IPI00479640 C1orf113 chromosome 1 open reading frame 113
224 IPI00033019 KCNB1 potassium voltage-gated channel subfamily B member 1
225 IPI00455876 RING1 isoform 2 of E3 ubiquitin-protein ligase RING1

Seventy-one of the proteins are correlated with cell proliferation or apoptosis according to biological processes and KEGG pathways (in the right two tiers). PEBP1, GNB1, ARFGAP1, RAP1B, RASGRF1, RHOC, PRKCB, MCF.2, CDC42, RAB3D, APOA1, PPP2CA, TBC1D15, PARK7, PRKACB, RAPGEF2 and CTNNB1 are concerned with the Ras signaling pathway; CAMK2A, CAMK2B, PRKCB, PPP2CA, PRKACB, CTNNB1, MACF1 and DACT1 are concerned with the Wnt signaling pathway; SLC25A4, SLC25A5, PEBP1, CAMK2A, CAMK2B, S100B, PRKCB, VDAC1 and PRKACB participate in the Calcium signaling pathway; GNB1, GNB4, RAP1B, HCK, PRKCB, CDC42 and PRKACB are involved in the Chemokine signaling pathway; 15 proteins are concerned with calcium-mediated biological processes; 10 proteins are concerned with small GTPase mediated signal transduction and 8 proteins are concerned with the G-protein coupled receptor protein signaling pathway.