OR Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 10.3892/or.2012.2170 or-29-02-0613 Articles Triptolide induced DNA damage in A375.S2 human malignant melanoma cells is mediated via reduction of DNA repair genes CHUEHFU-SHIN1* CHENYUNG-LIANG2* HSUSHU-CHUN3 YANGJAI-SING4 HSUEHSHU-CHING5 JIBIN-CHUAN6 LUHSU-FENG78 CHUNGJING-GUNG910 Departments of Health and Nutrition Biotechnology, Asia University, Taichung 413 Department of Medical Laboratory Science and Biotechnology, Yuanpei University, Hsinchu 300 Departments of Nutrition, China Medical University, Taichung 404 Departments of Pharmacology, China Medical University, Taichung 404, Taiwan, R.O.C. Department of Clinical Pathology, Cheng Hsin General Hospital, Taipei 112, Taiwan, R.O.C. Division of Chest Medicine, Department of Internal Medicine, Changhua Christian Hospital, Changhua 500, Taiwan, R.O.C. Department of Clinical Pathology, Cheng Hsin General Hospital, Taipei 112, Taiwan, R.O.C. Department of Restaurant, Hotel and Institutional Management, Fu-Jen Catholic University, Taipei 510, Taiwan, R.O.C. Departments of Biological Science and Technology, China Medical University, Taichung 404, Taiwan, R.O.C. Departments of Biotechnology, Asia University, Taichung 413, Taiwan, R.O.C. Correspondence to: Professor Jing-Gung Chung, Department of Biological Science and Technology, China Medical University, No. 91 Hsueh-Shih Road, Taichung 404, Taiwan, R.O.C., E-mail: jgchung@mail.cmu.edu.tw. Dr Hsu-Feng Lu, Department of Clinical Pathology, Cheng-Hsin General Hospital, No. 45 Cheng Hsin Street, Taipei 112, Taiwan, R.O.C., E-mail: ch1835@chgh.org.tw

Contributed equally

 2 2013 07 12 2012 29 2 613 618 01 09 2012 14 11 2012 Copyright © 2013, Spandidos Publications 2013 This is an open-access article licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. The article may be redistributed, reproduced, and reused for non-commercial purposes, provided the original source is properly cited.

Numerous studies have demonstrated that triptolide induces cell cycle arrest and apoptosis in human cancer cell lines. However, triptolide-induced DNA damage and inhibition of DNA repair gene expression in human skin cancer cells has not previously been reported. We sought the effects of triptolide on DNA damage and associated gene expression in A375.S2 human malignant melanoma cells in vitro. Comet assay, DAPI staining and DNA gel electrophoresis were used for examining DNA damage and results indicated that triptolide induced a longer DNA migration smear based on single cell electrophoresis and DNA condensation and damage occurred based on the examination of DAPI straining and DNA gel electrophoresis. The real-time PCR technique was used to examine DNA damage and repair gene expression (mRNA) and results indicated that triptolide led to a decrease in the ataxia telangiectasia mutated (ATM), ataxia-telangiectasia and Rad3-related (ATR), breast cancer 1, early onset (BRCA-1), p53, DNA-dependent serine/threonine protein kinase (DNA-PK) and O6-methylguanine-DNA methyltransferase (MGMT) mRNA expression. Thus, these observations indicated that triptolide induced DNA damage and inhibited DNA damage and repair-associated gene expression (mRNA) that may be factors for triptolide-mediated inhibition of cell growth in vitro in A375.S2 cells.

 triptolide DNA damage Comet assay DNA repair A375.S2 cells Introduction

Of the skin cancers, melanoma is the leading cause of death and the mortality rate is increasing (1–3). Thus, for all ages, melanoma is the primary focus of early detection campaigns. Sun UV has been recognized to cause skin cancer (4–6). UV can cause DNA damage of skin cells (4–6). DNA damage is involved in neurodegeneration in age-related disease, cerebral ischemia, and brain trauma including DNA damage (7–9). It was reported that in anticancer therapy, irradiation and DNA-damaging chemotherapeutic drugs play an important key role based on their ability to induce DNA double-strand breaks leading to cancer cell death (10–12). Thus, if agents can block DNA repair proteins it may lead to increase in the sensitivity of DNA damaging chemotherapeutic agents (13–16).

Triptolide (diterpenoid triepoxide; PG490) extracted from Tripterygium wilfordii Hook F (TWHF) has been shown to present anti-fertility function (17), anti-neoplastic activity such as anti-leukemia (18–25), anti-human hepatocellular carcinoma cells (25), colon cancer cells (23,26,27) and cervical cancer cells (28). Furthermore, evidence has been shown that triptolide inhibited the growth and metastasis of various solid tumors and has been suggested capable of acting synergistically with conventional chemotherapeutic drugs (29,30).

Substantial evidence has been demonstrated that triptolide induced cytotoxic effects in many human cancer cell lines but no available information exists to show triptolide-induced DNA damage in human skin cancer cells. Therefore, we investigated the effects of triptolide on DNA damage associated DNA repair genes expression (mRNA) in A375.S2 human malignant melanoma cells in vitro. Our findings demonstrated that triptolide induced DNA damage and also inhibited the expression of DNA repair genes in A375.S2 cells.

 Materials and methods Chemicals and reagents

Triptolide, dimethyl sulfoxide (DMSO), ethidium bromide, propidium iodide (PI), Tris-HCl and Triton X-100 were purchased from Sigma-Aldrich. RPMI-1640 medium, fetal bovine serum (FBS), L-glutamine, penicillin-streptomycin and trypsin-EDTA were purchased from Gibco®/Invitrogen (Grand Island, NY, USA).

 Cell culture and chemical treatment

The human malignant melanoma cell line (A375.S2) was purchased from the Food Industry Research and Development Institute (Hsinchu, Taiwan). Cells were cultured with minimum essential medium (MEM) supplemented with 10% fetal bovine serum, 100 U/ml of penicillin, 100 μg/ml of streptomycin, and 2 mmol/l of L-glutamine in 75 cm2 tissue culture flasks and grown in a humidified 5% CO2 and 95% air at 37°C (31,32).

 Flow cytometric assay for percentage of viable cells

Equal numbers of cells (2×105 cells/well) were seeded in 12-well plates and allowed to attach overnight. The cells were treated with 0.1% DMSO or triptolide (0, 15, 20, 25 and 30 nM) diluted in MEM with 5% FBS for 24 h. Cells from each treatment were stained with PI (5 μg/ml) and were analyzed for percentage of viable cells by using flow cytometry (Becton-Dickinson, San Jose, CA, USA) and cell viability was calculated as previously described (33,34).

 Comet assay and DAPI staining for DNA damage

A375.S2 cells at the density of 2×105 cells/well in 12-well plates were incubated with triptolide at final concentrations of 0, 15, 20, 25 and 30 nM, vehicle (1 μl DMSO) and 0.1% of H2O2 (positive control) for 24 h or the cells were treated with 20 nM triptolide for 0, 6, 12, 24 and 48 h in MEM medium grown at 37°C in 5% CO2 and 95% air. Cells were harvested for the measurement of DNA damage using the Comet assay as described previously (33,35,36). Comet tail length was calculated and quantified by using the TriTek CometScore™ software image analysis system (TriTek Corp., Sumerduck, VA, USA) as described previously (33,35,36). Harvested cells were stained by DAPI then examined and photographed by using fluorescence microscopy as described elsewhere (33,35,37).

 DNA gel electrophoresis for DNA damage

A375.S2 cells at the density of 2×105 cells/well in 12-well plates were incubated with triptolide at final concentrations of 0, 15, 20, 25 and 30 nM for 48 h in MEM medium grown in 5% CO2 and 95% air at 37°C. Cells in each well were individually isolated by using DNA isolation kit. The isolated DNA (2 μg) from each treatment was examined for DNA damage by using DNA electrophoresis which was carried out in 0.5% agarose gel in Tris/acetate buffer at 15 V for 2 h. At the end of electrophoresis the DNA was stained with ethidium bromide then examined and photographed under a fluorescence microscope as previously described (38–40).

 Real-time PCR assay for examining the expression of DNA repair genes

A375.S2 cells at the density of 1×106 cells/well in 6-well plates were incubated with or without 20 nM of triptolide for 24 h in MEM medium grown at 37°C in 5% CO2 and 95% air. The cells from each treatment were collected and total RNA was individually extracted by using the Qiagen RNeasy mini kit (Qiagen, Inc, Valencia, CA, USA) as previously described (41–43). Isolated RNA samples were individually reverse-transcribed for 30 min at 42°C with High Capacity cDNA Reverse Transcription kit according to the standard protocol of the supplier (Applied Biosystems, Carlsbad, CA, USA). Quantitative PCR from each sample was conducted as follows: 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 sec at 95°C, 1 min at 60°C using 1 μl of the cDNA reverse-transcribed as described above, 2X SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM of forward and reverse primers as shown in Table I, and previously described (41,43,44). Each assay was run on an Applied Biosystems 7300 Real-time PCR system in triplicate. The expression fold-changes were performed by using the comparative CT method.

 Statistical analysis

All studies were performed in duplicate. Results are presented as mean ± standard deviation. One-tailed Student’s t-test was used to analyze the difference between control and triptolide treated groups. Significance was defined as p<0.05.

 Results Effect of triptolide on the percentage of viable A375.S2 cells

A375.S2 cells were incubated with 15, 20, 25 and 30 nM of triptolide for 24 h. At the end of incubation, all samples were collected for determining the percentage of viable cells and the results are presented in Fig. 1, which indicated that triptolide decreased the percentage of viable cells at the concentration of 15–30 nM.

 Effects of triptolide on DNA in A375.S2 cells examined by Comet assay and DAPI staining

To confirm whether triptolide can induce DNA damage in A375.S2 cells, after cells were treated with triptolide DNA damage was examined by Comet assay and the results are presented in Fig. 2. Triptolide induced DNA damage in A375.S2 cells and these effects were dose-dependent (Fig. 2B) and time-dependent (Fig. 2D). The higher concentration of triptolide led to a longer DNA migration smear (Comet tail). H2O2 is known to be a highly reactive oxygen species, in the present studies, 0.1% H2O2 induced Comet tails. Fig. 3 shows DNA damage by DAPI stain and the effects based on the mean fluorescence intensity (Fig. 3A) are dose-dependent (Fig. 3B).

 Effects of triptolide on DNA in A375.S2 cells examined by DNA gel electrophoresis

To confirm whether or not triptolide can induced DNA damage in A375.S2 cells, DNA gel electrophoresis was used and results are shown in Fig. 4. The results show that triptolide induced DNA damage and fragments in A375.S2 cells (Fig. 4). The higher dose of triptolide (30 nM) led to more DNA damage and fragments than that of low dose (15 nM) incubation in A375.S2 cells.

 Effects of triptolide on DNA damage and of repair gene expression in A375.S2 cells measured by real-time PCR

Figs. 2 and 3 results show that triptolide induced DNA damage and fragments in A375.S2 cells. We investigated whether or not triptolide affects the gene expression of DNA damage and repair in A375.S2 cells. We used DNA agarose gel electrophoresis for examining the products from real-time PCR and results are shown in Fig. 5. The results indicated that all examined gene expression including ATM, ATR, BRCA-1, DNA-PK, MGMT and p53 mRNA were decreased in 24 h treatment with triptolide. ATM and BRCA-1 gene were more sensitive than the other genes (ATR, DNA-PK, MGMT and p53). P53 was the least sensitive compared to the other genes.

 Discussion

Numerous experiments have shown that triptolide induces cell death via induction of apoptosis in human cancer cell lines (26,45,46), but no available information exists to demonstrate triptolide induced DNA damage and affected DNA repair gene expression in human skin cancer cells. We found that A375.S2 cells treated with various concentrations of triptolide led to decreased percentage of viable cells (Fig. 1) and it also induced DNA damage (Figs. 2 and 3) and inhibited gene expression of DNA repair genes (Fig. 5) in A375.S2 cells. These findings are based on the observations from i) flow cytometric assay showing the decrease of percentage of viable cells (Fig. 1); ii) Comet assay and DAPI staining, the longer comet tail means higher DNA damage (Fig. 2); the light of fluorescence means higher DNA condensation (Fig. 3); iii) DNA fragments in DNA gel electrophoresis indicate high dose of triptolide treatment led to high DNA damage and fragments (Fig. 4) and iv) RT-PCR showed that triptolide inhibited the gene expression (mRNA) of DNA associated repair genes (Fig. 5).

It is well documented that Comet assay is a highly sensitive technique for DNA damage examination (47,48) and trend-break formation during the process of excision repair of DNA in cells (49,50). Herein, our results showed triptolide-induced DNA damage, which was examined by Comet assay and DAPI staining. The DNA damage of A375.S2 cells from triptolide treatment was also confirmed by DNA gel electophoresis (Fig. 4).

It was reported that agent-induced DNA damage can be reduced in cells via the DNA repair system through eliminating DNA lesions (49,50). Thus, we further investigated whether or not triptolide can affect the DNA repair gene expression in A375.S2 cells and results indicated that triptolide inhibit the expression of mRNA such as ataxia telangiectasia mutated (ATM), ataxia-telangiectasia (ATR), breast cancer gene 1 (BRCA-1), p53, DNA-dependent protein kinase (DNA-PK) and O6-methylguanine DNA methyltransferase (MGMT) in the examined A375.S2 cells. The results in Fig. 5 indicate that p53 gene has the lowest sensitivity to triptolide when compared to the other examined genes.

It was reported that DNA damage responses of cells could lead to p53 activation and activated p53 regulates the cell cycle arrest, DNA repair and apoptosis (51,52). The role of p53 in skin cancer cell response to triptolide-induced DNA damage and repair is unclear. Our results show that triptolide inhibited p53 gene expression in A375.S2 cells. In response to DNA damage, DNA damage checkpoints associate with cell cycle for maintaining genomic integrity (53–55). It was reported that both ATM and ATR are master checkpoint kinases which can be activated by double-stranded DNA breaks (52,56). Our results also show that triptolide inhibited the ATM and ATR gene expression in A375.S2 cells.

DNA-PK plays an important role in DNA damage repair (52) and the deficiency in DNA-PK activity of human glioblastoma cells can lead to a slow, error prone repair process causing increased formation of chromosome aberrations (52). BRCA1 plays and important roles in DNA damage and repair response, homologous recombination, cell cycle regulation, protein ubiquitination and apoptosis (57,58) and loss of BRCA1 causes a defective DNA repair response and G2/M cell cycle checkpoint in breast cancer cells (57,59). MGMT reduces cytotoxicity of therapeutic or environmental alkylating agents (60,61). Our results showed that triptolide inhibited the gene expression (mRNA) of DNA-PK, MGMT and BRCA-1.

In conclusion, A375.S2 cells were exposed to various concentrations of triptolide and DNA damage occurred. Moreover, the proposed flow chart for triptolide effect on DNA in A375.S2 human malignant melanoma cells is summarized in Fig. 6. Triptolide induces DNA damage in a dose response followed by inhibition of DNA repair-associated gene expression including ATM, ATR, BRCA-1, p53, DNA-PK and MGMT, then leading to DNA damage (Fig. 6).

 Acknowledgements

This study was supported by the grant CMU-100-ASIA-4 from China Medical University.

 References PangJAssaadDBreenDExtramammary Paget disease: review of patients seen in a non-melanoma skin cancer clinicCurr Oncol1743452010 MartinezJCOtleyCCThe management of melanoma and nonmelanoma skin cancer: a review for the primary care physicianMayo Clin Proc76125312652001 RigelDSEpidemiology of melanomaSemin Cutan Med Surg292042092010 BerwickMHow do solar UV irradiance and smoking impact the diagnosis of second cancers after diagnosis of melanoma?: No answer yetDermatoendocrinology418192012 PfeiferGPBesaratiniaAUV wavelength-dependent DNA damage and human non-melanoma and melanoma skin cancerPhotochem Photobiol Sci1190972012 Aceituno-MaderaPBuendia-EismanAOlmoFJJimenez-MoleonJJSerrano-OrtegaSMelanoma, altitude, and UV-B radiationActas Dermosifiliogr1021992052011(In Spanish) MathewALindsleyTASheridanADegraded mitochondrial DNA is a newly identified subtype of the damage associated molecular pattern (DAMP) family and possible trigger of neurodegenerationJ Alzheimers Dis306176272012 BaltanasFCCasafontIWeruagaEAlonsoJRBercianoMTLafargaMNucleolar disruption and cajal body disassembly are nuclear hallmarks of DNA damage-induced neurodegeneration in purkinje cellsBrain Pathol213743882011 BarzilaiADNA damage, neuronal and glial cell death and neurodegenerationApoptosis15137113812010 EngelmannDPutzerBMTranslating DNA damage into cancer cell death-A roadmap for E2F1 apoptotic signalling and opportunities for new drug combinations to overcome chemoresistanceDrug Resist Updat131191312010 YeYXiaoYWangWInhibition of expression of the chromatin remodeling gene, SNF2L, selectively leads to DNA damage, growth inhibition, and cancer cell deathMol Cancer Res7198419992009 SuganumaMKawabeTHoriHFunabikiTOkamotoTSensitization of cancer cells to DNA damage-induced cell death by specific cell cycle G2 checkpoint abrogationCancer Res59588758911999 PotterAJRabinovitchPSThe cell cycle phases of DNA damage and repair initiated by topoisomerase II-targeting chemotherapeutic drugsMutat Res57227442005 FriedmannBCaplinMHartleyJAHochhauserDModulation of DNA repair in vitro after treatment with chemotherapeutic agents by the epidermal growth factor receptor inhibitor gefitinib (ZD1839)Clin Cancer Res10647664862004 KerklaanPRBouterSvan ElburgPEMohnGREvaluation of the DNA repair host-mediated assay. II Presence of genotoxic factors in various organs of mice treated with chemotherapeutic agentsMutat Res16419291986 NorinAJGoldschmidtEPEffect of mutagens, chemotherapeutic agents and defects in DNA repair genes on recombination in F′ partial diploid Escherichia coliMutat Res5915261979 HikimAPLueYHWangCReutrakulVSangsuwanRSwerdloffRSPosttesticular antifertility action of triptolide in the male rat: Evidence for severe impairment of cauda epididymal sperm ultrastructureJ Androl214314372000 ZhouGSHuZFangHTBiologic activity of triptolide in t(8;21) acute myeloid leukemia cellsLeuk Res352142182011 MakDHSchoberWDChenWTriptolide induces cell death independent of cellular responses to imatinib in blast crisis chronic myelogenous leukemia cells including quiescent CD34+ primitive progenitor cellsMol Cancer Ther8250925162009 ShiXJinYChengCTriptolide inhibits Bcr-Abl transcription and induces apoptosis in STI571-resistant chronic myelogenous leukemia cells harboring T315I mutationClin Cancer Res15168616972009 PigneuxAMahonFXUhaldeMTriptolide cooperates with chemotherapy to induce apoptosis in acute myeloid leukemia cellsExp Hematol36164816592008 YaoGHLuanJFYeDEffects of triptolide on proliferation and apoptosis of Jurkat cell line in acute T lymphocytic leukemiaZhongguo Shi Yan Xue Ye Xue Za Zhi165065092008(In Chinese) TongXZhengSJinJZhuLLouYYaoHTriptolide inhibits cyclooxygenase-2 and inducible nitric oxide synthase expression in human colon cancer and leukemia cellsActa Biochim Biophys Sin3989952007 LouYJJinJTriptolide down-regulates bcr-abl expression and induces apoptosis in chronic myelogenous leukemia cellsLeuk Lymphoma453733762004 ChanEWChengSCSinFWXieYTriptolide induced cytotoxic effects on human promyelocytic leukemia, T cell lymphoma and human hepatocellular carcinoma cell linesToxicol Lett12281872001 LiuJShenMYueZTriptolide inhibits colon-rectal cancer cells proliferation by induction of G1 phase arrest through upregulation of p21Phytomedicine197567622012 LiuYSongFWuWKTriptolide inhibits colon cancer cell proliferation and induces cleavage and translocation of 14-3-3 epsilonCell Biochem Funct302712782012 KimMJLeeTHKimSHChoiYJHeoJKimYHTriptolide inactivates Akt and induces caspase-dependent death in cervical cancer cells via the mitochondrial pathwayInt J Oncol37117711852010 ZhangCCuiGHLiuFWuQLChenYInhibitory effect of triptolide on lymph node metastasis in patients with non-Hodgkin lymphoma by regulating SDF-1/CXCR4 axis in vitroActa Pharmacol Sin27143814462006 YangSChenJGuoZTriptolide inhibits the growth and metastasis of solid tumorsMol Cancer Ther265722003 HsiaoYPYuCSYuCCTriggering apoptotic death of human malignant melanoma a375. S2 cells by bufalin: involvement of caspase cascade-dependent and independent mitochondrial signaling pathwaysEvid Based Complement Alternat Med20125912412012 LoCLaiTYYangJSGallic acid inhibits the migration and invasion of A375. S2 human melanoma cells through the inhibition of matrix metalloproteinase-2 and RasMelanoma Res212672732011 YuCSHuangACYangJSSafrole induces G0/G1 phase arrest via inhibition of cyclin E and provokes apoptosis through endoplasmic reticulum stress and mitochondrion-dependent pathways in human leukemia HL-60 cellsAnticancer Res32167116792012 LiuKCHoHCHuangACGallic acid provokes DNA damage and suppresses DNA repair gene expression in human prostate cancer PC-3 cellsEnviron ToxicolSept22011(Epub ahead of print) NiCHYuCSLuHFChrysophanol-induced cell death (necrosis) in human lung cancer A549 cells is mediated through increasing reactive oxygen species and decreasing the level of mitochondrial membrane potentialEnviron ToxicolJul302012(Epub ahead of print) YuCCKoFYYuCSNorcantharidin triggers cell death and DNA damage through S-phase arrest and ROS-modulated apoptotic pathways in TSGH 8301 human urinary bladder carcinoma cellsInt J Oncol41105010602012 NiCHChenPYLuHFChrysophanol-induced necrotic-like cell death through an impaired mitochondrial ATP synthesis in Hep3B human liver cancer cellsArch Pharm Res358878952012 TsaiSCYangJSPengSFBufalin increases sensitivity to AKT/mTOR-induced autophagic cell death in SK-HEP-1 human hepatocellular carcinoma cellsInt J Oncol41143114422012 ChenHYLuHFYangJSThe novel quinolone CHM-1 induces DNA damage and inhibits DNA repair gene expressions in a human osterogenic sarcoma cell lineAnticancer Res30418741922010 LinYTYangJSLinSYDiallyl disulfide (DADS) induces apoptosis in human cervical cancer Ca Ski cells via reactive oxygen species and Ca2+-dependent mitochondria-dependent pathwayAnticancer Res28279127992008 ChenYYChiangSYLinJGEmodin, aloe-emodin and rhein induced DNA damage and inhibited DNA repair gene expression in SCC-4 human tongue cancer cellsAnticancer Res309459512010 HoYTLuCCYangJSBerberine induced apoptosis via promoting the expression of caspase-8, -9 and -3, apoptosis-inducing factor and endonuclease G in SCC-4 human tongue squamous carcinoma cancer cellsAnticancer Res29406340702009 LuHFYangJSLaiKCCurcumin-induced DNA damage and inhibited DNA repair genes expressions in mouse-rat hybrid retina ganglion cells (N18)Neurochem Res34149114972009 JiBCYuCCYangSTInduction of DNA damage by deguelin is mediated through reducing DNA repair genes in human non-small cell lung cancer NCI-H460 cellsOncol Rep279599642012 WuPPLiuKCHuangWWTriptolide induces apoptosis in human adrenal cancer NCI-H295 cells through a mitochondrial-dependent pathwayOncol Rep255515572011 HuangWHeTChaiCTriptolide inhibits the proliferation of prostate cancer cells and down-regulates SUMO-specific protease 1 expressionPLoS One7e376932012 PetriccioneMCinigliaCComet assay to assess the genotoxicity of Persian walnut (Juglans regia L.) husks with statistical evaluationBull Environ Contam Toxicol891661712012 KwasniewskaJGrabowskaMKwasniewskiMKolanoBComet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cellsEnviron Mol Mutagen533693752012 GouthamHVMumbrekarKDVadhirajaBMDNA double-strand break analysis by γ-H2AX foci: A useful method for determining the overreactors to radiation-induced acute reactions among head-and-neck cancer patientsInt J Radiat Oncol Biol PhysJul242012(Epub ahead of print) SavinaNVSmalMPKuzhirTDErshova-PavlovaAAGoncharovaRIDNA-damage response associated with occupational exposure, age and chronic inflammation in workers in the automotive industryMutat Res74821282012 PenningtonKPWalshTLeeMBRCA1, TP53, and CHEK2 germline mutations in uterine serous carcinomaCancerJul182012(Epub ahead of print) SerranoMALiZDangetiMDNA-PK, ATM and ATR collaboratively regulate p53-RPA interaction to facilitate homologous recombination DNA repairOncogeneJul162012(Epub ahead of print) FortiniPFerrettiCPascucciBDNA damage response by single-strand breaks in terminally differentiated muscle cells and the control of muscle integrityCell Death DifferJun152012(Epub ahead of print) JiaYGYangYMZuoBGuoLDLouJYDNA damage response in ovarian clear cell adenocarcinomaSichuan Da Xue Xue Bao Yi Xue Ban433313342012(In Chinese) WongVCCashHLMorseJLLuSZhitkovichAS-phase sensing of DNA-protein crosslinks triggers TopBP1-independent ATR activation and p53-mediated cell death by formaldehydeCell Cycle11252625372012 BoltzKALeehyKSongXNelsonADShippenDEATR cooperates with CTC1 and STN1 to maintain telomeres and genome integrity in ArabidopsisMol Biol Cell23155815682012 TammaroCRaponiMWilsonDIBaralleDBRCA1 exon 11 alternative splicing, multiple functions and the association with cancerBiochem Soc Trans407687722012 PessettoZYYanYBesshoTNatarajanAInhibition of BRCT(BRCA1)-phosphoprotein interaction enhances the cytotoxic effect of olaparib in breast cancer cells: a proof of concept study for synthetic lethal therapeutic optionBreast Cancer Res Treat1345115172012 YardenRIMetsuyanimSPickholtzIShabbeerSTellioHPapaMZBRCA1-dependent Chk1 phosphorylation triggers partial chromatin disassociation of phosphorylated Chk1 and facilitates S-phase cell cycle arrestInt J Biochem Cell Biol44176117692012 SilberJRBobolaMSBlankAChamberlainMCO(6)-Methylguanine-DNA methyltransferase in glioma therapy: Promise and problemsBiochim Biophys Acta182671822012 FumagalliCPruneriGPossanziniPMethylation of O6-methylguanine-DNA methyltransferase (MGMT) promoter gene in triple-negative breast cancer patientsBreast Cancer Res Treat1341311372012

Triptolide decreased the viability of A375.S2 human malignant melanoma cells in vitro. A375.S2 cells (5×105 cells/well) were maintained in 12-well plates and were incubated with 0, 10, 15, 25 and 30 nM of triptolide, vehicle (1 μl DMSO) as control 24 h. Cells were harvested and stained with PI (5 μg/ml) and then were analyzed by flow cytometry as previously described. ***P<0.001.

Differential concentration of triptolide-induced DNA damage in A375.S2 cells examined by Comet assay. The A375.S2 cells (5×105 cells/well) were maintained in 12-well plates incubated with 0, 15, 20, 25 and 30 nM of triptolide, and 0.1% of H2O2 (positive control) for 24 h (A and B) or cells were incubated with 20 nM of triptolide for 0, 6, 12, 24 and 48 h (C and D) and DNA damage was determined by Comet assay as described in Materials and methods. *P<0.05.

Triptolide-induced DNA damage in A375.S2 cells examined by DAPI staining. The A375.S2 cells (5×105 cells/well) were maintained in 12-well plates and incubated with 0, 15, 20, 25 and 30 nM of triptolide, and 0.1% of H2O2 (positive control) for 24 h and DNA damage was determined by DAPI staining as described in Materials and methods. *P<0.05.

Triptolide-induced DNA damage in A375.S2 cells examined by DNA gel electrophoresis. The A375.S2 cells (1×106 cells/well) were placed in 12-well plates were incubated with 0, 15, 20, 25 and 30 nM of triptolide for 48 h. Cells were collected and DNA were isolated for DNA gel electrophoresis as described in Materials and methods.

Triptolide-inhibited DNA damage and expression of repair genes in A375.S2 cells determined by real-time PCR. The total RNA was extracted from the A375.S2 cells after incubation with 0 and 20 nM triptolide for 24 h, RNA samples were reverse-transcribed, and cDNA used for real-time PCR as described in Materials and methods. The ratios of ATM, ATR, BRCA-1, p53, DNA-PK and MGMT mRNA/GAPDH are presented. Data represents mean ± SD of three experiments. *P<0.05.

Proposed flow chart for triptolide-induced DNA damage and inhibition of gene expression, DNA damage and repair in A375.S2 human malignant melanoma cells.

The DNA sequence was evaluated using the Primer Express software and each assay was run on an Applied Biosystems 7300 Real-time PCR system.

Primer name Sequences
Human BRCA1 F: CCAGGGAGTTGGTCTGAGTGAR: ACTTCCGTAAGGCATCGTAACAC
Human DNA-PK F: CCAGCTCTCACGCTCTGATATGR: CAAACGCATGCCCAAAGTC
Human MGMT F: CCTGGCTGAATGCCTATTTCCR: TGTCTGGTGAACGACTCTTGCT
Human p53 F: GGGTTAGTTTACAATCAGCCACATTR: GGGCCTTGAAGTTAGAGAAAATTCA
Human ATM F: TTTACCTAACTGTGAGCTGTCTCCATR: ACTTCCGTAAGGCATCGTAACAC
Human ATR F: GGGAATCACGACTCGCTGAAR: CTAGTAGCATAGCTCGACCATGGA
Human GAPDH F: ACACCCACTCCTCCACCTTTR: TAGCCAAATTCGTTGTCATACC

Each assay was performed in triplicate to ensure reproducibility. BRCA1, breast cancer gene 1; DNA-PK, DNA-dependent serine/threonine protein kinase; MGMT, O6-methylguanine-DNA methyltransferase; ATM, ataxia telangiectasia mutated; ATR, ataxia-telangiectasia and Rad3-related; GAPDH, glyceraldehydes-3-phosphate dehydrogenase.