The human gallbladder carcinoma cell line, GBC-SD, was maintained in the central laboratory of the Medical College of Xi’an Jiaotong University. Cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS; both from Gibco-BRL, USA) under saturated humidity conditions at 37°C in 5% CO₂. Cells were passaged at a 1:2 ratio when the attached cell density reached ~80 to 90%.

All animal experiments were reviewed and approved by the Ethics Committee of the First Affiliated Hospital of the Medical College, Xi’an Jiaotong University. BALB/c nude mice, 4–6 weeks of age (weighing 18–22 g) were provided by the laboratory animal center of the Fourth Military Medical University and bred in an SPF grade animal experimental center of the Xi’an Jiaotong University at 25°C and 60–70% humidity. They were fed a standard rodent diet and water.

According to the Bcl-2 mRNA sequence in GenBank and using siRNA Design Software provided by Invitrogen (http://www.invitrogen.com), we chose a target sequence according to the principle of siRNA target sequence design. We then further verified the sequence through the BLAST program from the NCBI (http://www.ncbi.nlm.nih.gov) website. The siRNA sequences that targeted the Bcl-2 gene were as follows: 515S sense, 5′-GATCCGCATC GCCCTGTGGATGACTTTCAAGAGAAGTCATCCACAG GGCGATGTTTTTTGGAAA-3′; 515A antisense, 5′-AGC TTTTCCAAAAAACATCGCCCTGTGGATGACTTCTCT TGAAAGTCATCCACAGGGCGATGCG-3′; ConS sense, 5′-GATCCACTACCGTTGTTATAGGTGTTCAAGAGACA CCTATAACAACGGTAGTTTTTTTGGAAA-3′; ConA antisense, 5′-AGCTTTTCCAAAAAAACTACCGTTGTTATAG GTGTCTCTTGAACACCTATAACAACGGTAGTG-3′. The 515S and 515A are sense and antisense strands of DNA containing the interference point sites. ConS and ConA are sense and antisense strands of DNA containing the negative control. The underlined sections in 515S and 515A, ConS and ConA are consistent or opposite complementary sequences with the target gene mRNA and negative sequence, respectively. GAT, GGAAA is the enzyme site, CCG is the recognition site of RNA polymerase III, TTCAAGAGA forms the structure of stem ring, and TTTTTT is the termination signal of transcription. These sequences were connected and reconstructed within the pSilencer™-EGFP vector (Department of Biochemistry and Molecular Biology of the Fourth Military Medical University), then transfected and integrated into the eukaryotic cell genome. Finally, shRNAs were transcribed out from the initiation site recognized by the RNA polymerase III.

After annealing the synthetic oligonucleotides, pSilencer™-EGFP was cut with BamHI and HindIII enzymes (Gibco-BRL, USA). The plasmid was inoculated into freeze-stored DH5α (Department of Biochemistry and Molecular Biology of the Fourth Military Medical University) and then cultivated on a plate, without antibiotics, at 37°C overnight. The following day, monoclonal colonies were selected and inoculated in 10 ml of LB culture solution without antibiotics, and cultured at 37°C with agitation at 250 rpm overnight. The next day 1% of the culture was transferred into 200 ml of non-antibiotic containing LB culture solution and agitated for a further 2 h. The culture was stopped when the solution absorbance at A₂₆₀ was 0.4. The bacterial culture was then placed on ice for 30 min, followed by centrifugation at 5,000 rpm for 10 min at 4°C. The supernatant was then removed and the cells were retrieved. The precipitate was resuspended in TSS under aseptic conditions; it was then frozen at −70°C until use. The recycling products and annealing products were connected at 4°C overnight. The connection was added to 100 μl of competent cells and shaken slightly, incubated on ice for 30 min, then placed in a 42°C water bath for 90 sec, followed by cooling for 2–3 min. Two hundred microliters of preheated no penicillin (Amp) LB medium was then added to each tube, then agitated slowly at 140–150 rpm for 45 min at 37°C to promote bacterial recovery. The transformed competent cells were smeared onto an agar plate that contained antibiotic until the liquid was completely absorbed. Then, the plate was inverted and cultured for 12–16 h at 37°C until the colonies appeared. Six colonies were randomly selected from each group. The plasmid was extracted with the ‘small kit’ from Shanghai HuaShun Company, according to the instructions.

Three microliters of extracted plasmid DNA was cut with the BamHI and HindIII enzyme and cultured for 3 h at 37°C. The digested products were separated on a 1% agarose gel by electrophoresis and then photographed under a UV transilluminator. The positive clones identified by enzyme digestion were sent to Beijing Augct DNA-Syn Biotechnology Co., Ltd. for sequence testing. Recombinant plasmids were named pSilencer™-EGFP sh515 (experimental group) and pSilencer™-EGFP shCon (negative control group).

GBC-SD cells in the logarithmic growth phase were inoculated into a 6-well plate at a concentration of 2×10⁵ cells/well. Transfection by a liposome-mediated DNA method using Lipofectamine 2000 (Invitrogen, Gaithersburg, USA) was performed 24–48 h when the culture confluence reached 80% in accordance with the instruction. The experiment was divided into two groups transfected with either pSilencer™-EGFP sh515 (experimental group) or pSilencer™-EGFP shCon (negative control group).

The culture solution of transiently transfected GBC-SD cells was replaced every 2–3 days. The cells began to die after two days when treated with G418, whose screening concentration was 400 μg/ml. Positive clones were observed in 2 weeks. Thereafter, the cloned cells did not appear to die in the presence of G418 (400 μg/ml), but their growth was slow. A visible cloning cell was formed in ~6–8 weeks. The monoclone was selected for further expansion in culture. The experiment was divided into the experimental group and the negative control group.

GBC-SD human gallbladder carcinoma cells were transiently transfected with pSilencer™-EGFP vector and the negative control empty vector, and the cells of each group were collected 12 h later for total RNA extraction using TRIzol reagent (Invitrogen). Eight microliters of RNA was used to synthesize cDNA and then subjected to PCR amplification. PCR primers were synthesized by Beijing Augct DNA-Syn Biotechnology Co., Ltd. The Bcl-2 primer sequences were as follows: upstream primer 5′-CTGGGAGAACAGGGTACGATAA-3′, downstream primer 5′-AGCCAGGAGAAATCAAACA GAG-3′, resulting in a PCR product of 210 bp. β-actin was amplified as a control using the following primer sequences: upstream 5′-TGCGCAGAAAACAAGATGATT-3′ and downstream 5′-TGGGGGACAAAAAGGGGGAAGG-3′, resulting in a PCR product of 450 bp. The PCR conditions were: one cycle of denaturing at 94°C for 30 sec (first cycle was 94°C for 4 min), annealing at 60°C for 30 sec, extension at 72°C for 30 sec, followed by 25 cycles. β-actin cDNA was amplified at the same time as an internal standard control. The PCR products were loaded onto a 1% agarose gel for electrophoresis. The stably transfected GBC-SD cells were also tested for knockdown of Bcl-2 with RT-PCR.

The GBC-SD cells were transfected with recombinant plasmid vectors of the two groups and harvested 12 h later. The total cell protein was extracted with the RIPA total protein kit (Santa Cruz Biotechnology, Inc., USA) and quantified with the ABC protein quantification method. The sample was separated by SDS-PAGE (12%) and transferred onto a nitrocellulose membrane. The western blot analysis method was used to detect Bcl-2 protein expression using rabbit anti-human Bcl-2 polyclonal antibody (AB1720; Chemicon, USA). Detection was performed with an enhanced chemiluminescence agent. The expression of β-actin was tested as an internal standard control. The stably transfected GBC-SD cells were also tested for Bcl-2 protein expression using the same method.

GBC-SD cells were transfected transiently with the vector of each group and digested 12 h later. The cells were inoculated into a 96-well plate at a concentration of 5×10³ cells/well. A concentration of 10 μmol/l Ponasterone A was added to each well as an inducer. A further 20 μl of freshly prepared MTT (0.5 mg/ml) (Sigma, USA) was added to different wells at 12, 24, 36, 48 and 60 h later, respectively. The cells were cultured at 37°C for 4 h, then MTT liquid was removed and 150 μl DMSO (Sigma, USA) was added to each well. Optical density (OD) readings were obtained at 490 nm, from which the inhibition rate of tumor cell growth was calculated using the formula: Inhibition rate = (average absorbance (A) value of control group - average A value of experimental group)/average A value of control group × 100%.

Apoptotic cells were determined using the Annexin V/fluorescein isothiocyanate (FITC) Apoptosis Detection kit (Jingmei Biotech Co., Shenzhen, China) and an EPICS XL-MCL flow cytometer (Becton-Dickinson) according to the manufacturer’s instructions. Briefly, GBC-SD cells, and cells stably transfected with either GBC-SD-RNAi pSilencer™-EGFP shCon or GBC-SD-RNAi pSilencer™-EGFP sh515 were collected and single cell suspensions (1×10⁶ cells) were prepared. Briefly, 1×10⁶ cells were stained with Annexin V/FITC for 30 min at 4°C in the dark and then stained with propidium iodide for 10 min before flow cytometric analysis.

The number of living cells was counted by the trypan blue staining method and used to adjust the number of cells to 5×10⁵/ml. The cells were inoculated into a 96-well plate in a volume of 100 μl/well and cultured for 24 h in an incubator with 5% CO₂ and saturated humidity at 37°C. A volume of 25 μl of different drugs was added into the experimental wells: 1 μg/ml 5-fluorouracil (5-FU; Tianjin Jinyao Amino Acid Co., Ltd.), 0.3 μg/ml mitomycin C (MMC; Hebei QiYuan Pharmaceuticals Corp.), 0.04 μg/ml adriamycin (ADM; Zhejiang HaiZheng Pharmaceutical Co., Ltd.) and 0.3 μg/ml cisplatin (DDP; Shandong Luoxin Pharmaceutical Co., Ltd.) (drug concentration was subjected to 1/10 of blood concentration), while the same amount of PBS was added into the control wells. The medium was removed after cultivation for 48 h, and 25 μl of freshly prepared MTT solution (2 mg/ml) was added into each well. The supernatant was removed after cultivation for 6 h at 37°C, and 150 μl of DMSO was added to each well. OD readings of each well were measured at 570 nm when the purple crystals were dissolved completely, with 630 nm as a reference wavelength. The inhibition rate was calculated using the following formula: Inhibition rate (%) = (1 - average OD value of the experimental well/average OD value of the control well) × 100.

The results of DNA sequencing, from Beijing Augct DNA-SYN Biotechnology Co., Ltd., showed that the sequence of the vector was identical to the designed sequence, indicating that the recombinant plasmid vector was constructed successfully (Fig. 1). The recombinant plasmid which contained the shRNA coding sequence was named pSilencer™-EGFP sh515 (experimental group) and the empty vector was referred to pSilencer™-EGFP shCon (negative control group). Both plasmids were amplified for future study.