The 51 formalin-fixed and paraffin-embedded (FFPE) samples from 2 groups of cancer patients were studied, including 40 primary lung adenocarcinoma samples (20 samples with lymph node metastasis, 20 samples without) and 11 BM samples from lung adenocarcinoma. All samples were collected from West China Hospital, Sichuan University. A pathologist evaluated histologic tumor type, tumor grade, and tumor percentage using hematoxylin-eosin (H&E)-stained samples. Histologic classifications of the samples are summarized in Table I. Ethics approval for the study was obtained from the Ethics Committee of the West China Hospital of Sichuan University.

Total RNA was extracted and purified using RecoverAII™ Total Nucleic Acid Isolation (Cat No. AM1975; Ambion, Austin, TX, US) following the manufacturer’s instructions and checked for an RIN number to inspect RNA integration by an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA).

miRNA molecular in total RNA was labeled by miRNA Complete Labeling and Hyb kit (Cat No. 5190-0456; Agilent Technologies) following the manufacturer’s instructions, labeling section. Each slide was hybridized with 100 ng Cy3-labeled RNA using miRNA Complete Labeling and Hyb Kit (Cat No. 5190-0456) in hybridization Oven (Cat No. G2545A; Agilent Technologies) at 55°C, 20 rpm for 20 h according to the manufacturer’s instructions, hybridization section. After hybridization, slides were washed in staining dishes (Cat No. 121; Thermo Shandon, Waltham, MA, USA) with Gene Expression Wash Buffer kit (Cat No. 5188-5327, Agilent Technologies). Slides were scanned by Agilent Microarray Scanner (Cat No. G2565BA) and Feature Extraction software 10.7 (both from Agilent Technologies) with default settings. Raw data were normalized by Quantile algorithm, GeneSpring Software 11.0 (Agilent Technologies).

Real-time quantitative PCR (qPCR) was carried out to quantify the mature miR-9^*, miR-1471, miR-214 and miR-145 by TaqMan MicroRNA Assays according to the manufacturer’s protocol (Applied Biosystems, USA). The qPCR reaction was performed with the following parameter values: 15 min at 50°C, 10 min at 95°C, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min. The TaqMan probes were designed by ABI. miR-145, GUCCAGUUUU CCCAGGAAUCCCU; miR-214, ACAGCAGGCACAGAC AGGCAGU; miR-471, ACACCTGGCTCCACAGUGUGAC; miR-9^*, UAAAGCUAGAUAACCGAAAGU; U6B, CGCAAG GATGACACGCAAATTCGTGAAGCGTTCCATATTTTT. qPCR was performed on ABI 7900 HT Sequence Detection System, and data were analyzed with 7900 System SDS software. U6B snRNA was used as normalization control. Relative expression values from 3 independent experiments were calculated following the 2^−ΔΔCt method.

Human lung adenocarcinoma cell lines A549 and SPC-A1, and the adenovirus-immortalized human embryonic kidney epithelial cells HEK-293 were from the American Type Culture Collection and were maintained in DMEM (Gibco-BRL) with 10% fetal bovine serum. Cells were grown in a humidified atmosphere of 5% CO₂ at 37°C.

The pri-miR-145 sequence −179 to +287 (+1 being the first base of the mature miR-145) was amplified from HEK-293 cell genomic DNA. PCR product was cloned into pMD18-T (Takara Bio, Inc.), verified by sequencing, and subcloned into shuttle plasmid pAdTrack-CMV (designated as pAdTrack-miR-145) (26). pAdTrack-miR-145 linearized with PmeI was used to transform BJ5183-AD-1 cells harboring the adenoviral pAdeasy-1 vector for homologous recombination. Colonies were screened by plasmid miniprep and PacI restriction analysis to obtain clones with recombinant miR-145 (designated as pAdeasy-miR-145). PacI linearized pAdeasy-miR-145 was used to transfect HEK-293 cells to obtain packaged recombinant miR-145 adenovirus (designated as AD-miR-145). AD-miR-145 was amplified by repeated infection and verified by PCR. The pAdTrack-CMV empty vector was used as control (designated as AD-control). The titers and the multiplicity of infection were determined according to the manufacturer’s protocols.

Cell proliferation was evaluated by Cell Counting Kit-8 (CCK-8) (Dojindo) according to the manufacturer’s instructions. Briefly, A549 cells (5,000 cells) and SPC-A1 cells (3,000 cells) were plated in 96-well plates in 100 μl/well and incubated for 24 h. Then, cells were infected with AD-miR-145 and AD-control (multiplicity of infection, 80). After 48 h, CCK-8 was added under sterile conditions, A549 cells were incubated for 2 h and SPC-A1 cells for 3 h before reading absorbance at 450 nm in an enzyme-linked immunosorbent assay plate reader (BioTeck Instruments, Inc.). Each experiment was performed in 4 replicate wells and independently repeated three times. Absorbance values were normalized to media control.

The invasion assay was performed by using 24-well Millicell hanging cell culture inserts consisting of 8-μm PET membrane (Millipore) coated with BD Matrigel Basement Membrane Matrix. Briefly, the infected A549 and SPC-A1 cells were trypsinized and resuspended in DMEM containing 1% FBS and 5×10⁴ cells were added to the upper chamber of each well. After 24 h at 37°C, cells on the upper membrane surface were removed by careful wiping with a cotton swab and the filters were fixed by treatment with methanol for 20 min and stained with 0.1% crystal violet solution for 20 min. Invasive cells adhering to the undersurface of the filter were then counted (5 high-power fields) using an inverted microscope. The migration assay is the same as the invasion assay except no Matrigel was used.

The SPSS 18.0 program was used for general statistical analysis. Data are expressed as means ± standard deviation (SD). Statistical significance of the studies was analyzed by Student’s t-test. To understand the relationship between miRNAs, the significant correlations were determined using the Kendall rank correlation test. P-value <0.05 was considered to indicate a statistically significant difference.

To investigate differentially expressed miRNAs between primary and brain metastatic lung adenocarcinoma, 5 primary lung adenocarcinoma samples without lymph node metastasis and 3 BMs in lung adenocarcinoma were analyzed using Agilent Human miRNA Microarray (8^*60k) v16.0. The miRNAs that were altered by at least 2-fold and P-value was <0.05 were considered to be significant candidates. Heat maps depicted the relative expression level of mature miRNAs indicated by microarray analyses of the samples from 8 patients (Fig. 1).

Using strict criteria above, we identified 5 upregulated miRNAs and 3 downregulated miRNAs. miR-214 was the most downregulated miRNA with an average 20.33-fold change. miR-145 and miR-23a were also downregulated, with 6.9 and 3.62-fold change, respectively. We also observed an apparent increased expression of miRs-9^*, -1471, -718, -3656 and -720. miR-9^* was the most upregulated miRNA with an average 64.84-fold change. All the differential miRNAs are shown in Table II.

To confirm our microarray data, TaqMan real-time PCR was performed to analyze the expression of the most significantly deregulated miRNAs, including miR-9^*, miR-1471, miR-214 and miR-145, as shown in Table II. We examined the expression of 4 miRNAs in 51 samples (including 8 samples for microarray analysis). The miRNA expression level of each sample was quantified and normalized to U6B expression. The TaqMan real-time PCR data showed that the expression of miR-1471 and miR-9^* was upregulated significantly in BM samples vs. primary lung adenocarcinoma (p<0.001, p<0.001, respectively), with the increase of 3.65 and 3.14-fold, respectively (Fig. 2A and 2B). Consistent with the microarray data, as shown in Fig. 2C, miR-214 was downregulated significantly in BM samples with a decrease of 24.85-fold (P<0.001). miR-145 was also verified to be significantly downregulated 9.17-fold in BM samples (P<0.001, Fig. 2D).

We explored the role of the dysregulated miRNAs in primary lung adenocarcinoma progression and metastasis through bioinformatics analysis. Of note, a literature search showed that several of the miRNAs that we found dysregulated in BM from lung adenocarcinoma have also been reported to be altered in other types of tumor progression and metastasis (Table III).

To further evaluate the effect of these dysregulated miRNAs on the process of BM of lung adenocarcinoma, we focused on miR-145 and characterized its functional behavior first.

To investigate the relationship of the expression of miR-145 with lymph node involvement, we analyzed the relative expression level of miR-145 in 20 primary lung adenocarcinoma samples with and in 20 samples without lymph node involvement (including 5 primary lung adenocarcinoma samples used in microarray assay). However, the miR-145 expression level in our primary lung adenocarcinoma showed no significant difference between with and without lymph node metastasis.

One measure of the tumorigenic nature of cells is the ability to proliferate to form colonies in distant metastatic sites. To determine the effect of miR-145 expression on cell proliferation, we used AD-miR-145 and AD-control to infect human lung adenocarcinoma cell lines A549 and SPC-A1. After infection, we found the expression of miR-145 was increased in both cell lines that were infected with AD-miR-145 compared to AD-control and MOCK groups (data not shown). By CCK-8 proliferation assay, it was demonstrated that overexpression of miR-145 markedly inhibited cell proliferation in both cell lines. Compared to cells infected with AD-control, the average growth rate of A549 (Fig. 3A) and SPC-A1 (Fig. 3B) cells overexpressing miR-145 decreased by ~41 and 22%, respectively, in 3 separate experiments.

The TaqMan qPCR results showed that the expression of miR-145 in primary lung adenocarcinoma was not related to lymph node metastasis, suggesting that miR-145 may have no effect on the early stages of metastasis. To further determine the effect of miR-145 overexpression on the migration and invasion ability of A549 and SPC-A1 cell lines, the transwell assays were performed. Overexpression of miR-145 had no effect on migration (Fig. 4A) and invasion ability (Fig. 4B) of A549 and SPC-A1 cell lines.