All blood samples were collected either from patients who were diagnosed with malignant/benign ovarian tumors, or from healthy females undergoing routine physical examinations at the Department of Gynecologic Oncology, Affiliated Tumor Hospital of Guangxi Medical University. The malignant group consisted of 177 cases of ovarian cancer, including 109 cases of serous cystadenocarcinoma, 54 of mucinous cystadenocarcinoma, and 14 of undifferentiated carcinoma according to the criteria of the World Health Organization (WHO, 1973). Among them, 81 cases were stages I–II and 96 cases were stages III–IV in accordance with FIGO standards (2004). The age of patients was 26–67 years (average, 44.6 years), and all patients were followed up for 2.4–62.16 months (mean, 41.10 months). The benign group consisted of 101 cases, including 59 of serous cystadenoma, 42 of ovarian teratoma, and the patients for these samples were aged 14–64 years (average, 35.6 years). The control group consisted of 49 healthy female aged 25–53 years (average, 43.4 years). All blood samples were obtained prior to any treatments, and 2 ml of blood was centrifuged at 3,000 rpm for 5 min, and the supernatants were kept at −80°C.

All ovarian samples were collected from patients after surgery in the Department of Gynecologic Oncology, Affiliated Tumor Hospital of Guangxi Medical University and were diagnosed by pathologists. Of the 57 cases of malignant ovarian tumors, 30 were serous cystadenocarcinoma, 12 were mucinous cystadenocarcinoma, and 15 were low differentiated adenocarcinomas according to the WHO criteria; 26 cases were stages I–II and 31 were stages III–IV in accordance with FIGO standards. All patients for those 57 samples ranged in age from 28 to 73 years (average, 47.4 years). There were 23 cases of benign ovarian tumors, including 10 of serous cystadenoma, 7 of mucinous cystadenoma and 6 of ovarian teratoma, and the patients were aged 18–73 years (average, 43.4 years). There were 22 cases of normal ovarian tissues excised when the patients underwent the myomectomy or total hysterectomy, following receipt of informed consent and were confirmed to be normal by a pathologist; the patients were aged 48–67 years (average, 58.7 years). The ovarian sample for cDNA cloning of HPSE was a mucinous adenocarcinoma diagnosed by pathologists. The study was endorsed by the Ethics Committee of the Guangxi Medical University. All patients received an explanation concerning the aims of the study and provided signed informed consent. All samples were collected from primary lesions during surgery, and stored in a liquid nitrogen tank. The stored samples were then ready for mRNA isolation and histopathological examination.

pcDNA3.1 expression vector (Invitrogen), pEGFP-N1 vector (Clontech) and E Coli DH-5α were laboratory kept vectors. Ovarian cancer cells including A2780, SKOV3 and HO-8910 were purchased from Shanghai Institute of Cellular Biology of Chinese Academy of Sciences. Cells including HO-8910pm, CBP-resistant SKOV3 and DDP-resistant SKOV3 were established in our laboratory.

Primers were designed according to the nucleotide sequence of HPSE mRNA which had been deposited in the GenBank database (NM_006665). The gene specific primers were: primers for measurement of HPSE expression in ovarian cancer: forward, 5′-TCCGAGAACACTACCAG-3′ and reverse, 5′-GCATCTTAGCCGTCTTTC-3′. β-actin was used as the control gene: forward, 5′-CTCCATCCTGGCCTCGCTGT-3′ and reverse, 5′-GCTGTCACCTTCACCGTTCC-3′. Primers for cDNA cloning of HPSE: forward, 5′-CCGCTCGAGATGCTGTGCGCTCGAAG-3′ and reverse, 5′-CCGGAATTCATTTTCAGATGCAAGCAG-3′.

Six siRNAs for HPSE silencing approach were: 1) pGPU6/GFP/Neo-heparanase-548: GGAGAAGTTACGGTTGGAATG; 2) pGPU6/GFP/Neo-heparanase-640: GCTCTGTAGATGTGCTATACA; 3) pGPU6/GFP/Neo-heparanase-1222: GCTTTATGTGGCTGGATAAAT; 4) pGPU6/GFP/Neo-heparanase-1556: GCAAGTGGATAAATACCTTCT; 5) positive control (pGPU6/GFP/Neo-shGAPDH): GTATGACAACAGCCTCAAG; 6) Negative control (pGPU6/GFP/Neo-shNC): GTTCTCCGAACGTGTCACGT.

Protein expression of HPSE was measured by streptavidin-biotin complex assay (SABC). The SABC kit was purchased from Wuhan Boster Bio-Engineering Inc., (Wuhan, China). Anti-HPSE polyclonal antibody was purchased from Santa Cruz Inc. The images were reviewed in a blinded manner by two experienced pathologists. The determination of staining intensity was as follows: the cytoplasm of ovarian cancer cells exhibiting brown granular staining (Fig. 1D) was considered positive staining and samples showing the absence of staining (Fig. 1A–C) were considered negative. The intensity of protein expression was related identically to the rate of positive cells. The cells with cytoplasmic or membranous staining showing dark brown granules were determined to exhibit strong positivity (score 3). Cells stained light brown indicated weakly positive (score 1) staining, and cells with no brown granules were scored 0. Intensity between strong positivity and weak positivity was considered as medium positive (score 2) intensity. The positive staining of cells was determined by the number of positive cells vs. the number of total cells at high magnification. A percentage of <5% cells was scored as 0; 6–25%, 1; 26–50%, 2; 51–75%, 3 and >75%, 4. The product of the staining intensity and the positive rate of cells in each field was determined to be the immunity score, and average score of 5 visions in each section was the final immunity score. A final immunity score ranging from 0–2 was determined as negative and a score ≥2 was determined as positive.

The concentration of HPSE in serum was measured using enzyme-linked immunosorbent assay (ELISA) in accordance with the manufacturer's instructions.

The transcript expression of HPSE was measured by RT-PCR. Total RNA was isolated using TRIzol Reagents (Gibco, USA) and first strand cDNA was synthesized using M-MuLV system (MBI-Fermentas) from 2 μg RNA. Primers were designed according to the nucleotide sequence that had been deposited in the GenBank database. Polymerase chain reaction amplification was performed with the following protocol: initial denaturation at 94°C for 5 min, followed by a variable number of 35 cycles, 94°C for 30 sec, specific annealing temperature for 30 sec, elongation at 72°C for 45 sec, and then a final elongation at 72°C for 5 min. PCR products were visualized on 2% agarose gels containing ethidium bromide and photographed using imaging system. PCR products of HPSE were purified and sequenced.

The stable HPSE upregulated cell line was established as follows: cDNA of HPSE cloned from tissue of epithelial ovarian cancer by PCR was sub-cloned into BglII sites of pGEM-T Easy Vector (Promega) for sequencing. Then the XholI and EcoRI fragments were inserted into XholI and EcoRI-digested pcDNA3.1 vector to generate HPSE recombinant expression system, and the insert was confirmed by sequencing. The pcDNA3.1-HPSE was transfected into A2780 cells using Lipofectamine 2000 (Invitrogen, USA). Individual clones were screened for G418-based induction. RT-PCR and western blotting were performed to measure the HPSE expression.

The stable HPSE silencing cell line was established as follows: transfection was performed at ~80% confluency in six-well plates (Corning, NY, USA) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Four purified pGPU6/GFP/Neo-shRNA expression vectors which contained the HPSE shRNA insert and two control vectors were transfected into SKOV3 cells with 10 μl of Lipofectamine 2000 reagent. After 48 h of transfection, RT-PCR and western blotting were performed to assess the efficiency of HPSE knockdown.

Cell growth inhibition was determined by MTT assay, with 3 replications (4); cell proliferation rate was determined using the colony forming assay as previously reported (5); cell cycle was detected by flow cytometry, and the proportion of cells in the G1, G2 and S phases of cell cycle was analyzed using multicycle software. Cell invasion in vitro was measured by Matrigel invasion, and the kit was purchased from Biological Centre of Peking University (Beijing, China); cell migration in vitro was measured by Transwell migration, and the kit was purchased from Corning Costar (Cambridge, MA, USA); cell adhesion in vitro was measured by Adhesion assay, and the kit was purchased from Biological Centre of Peking University. All steps were carried out in accordance with the manufacturer's instructions.

The data were analyzed by SPSS13.0 software. The results of ELISA are presented as the means ± SD. The measurement data were analyzed using one-way ANOVA, complemented with Kruskal-Wallis tests. The statistical data were analyzed with the Chi-square tests; comparison within groups was analyzed using t-test. p<0.05 was considered to indicate a statistically significant difference. The prognosis was analyzed using the Cox model.

As shown in Fig. 2, the concentration of HPSE in serum of patients with malignant ovarian tumors was visibly higher than that in the serum of patients with benign ovarian tumors and controls (p=0.0), but no statistical difference between the benign group and controls was observed. Further study revealed that the amount of HPSE in ovarian cancer patients with distant metastasis was notably higher than the amount in patients with no distant metastasis (p=0.042), but no relationship between serum concentration of HPSE and lymphatic, pelvic and peritoneal metastasis was observed (as shown in Table I). Moreover, the concentration of HPSE in serum of patients with serous, mucinous and undifferentiated cancer showed no statistical difference, suggesting there was no direct relationship between serum concentration of HPSE and histological type, although the serum concentration of HPSE in patients with poorly differentiated and stages III–IV cancer were significantly higher than the concentrations in well differentiated and stages I–II cancer (p=0.035 and 0.000, respectively).

In addition, the diagnostic value of serum HPSE concentration prior to surgery was also evaluated. As shown in Table II, when the serum CA125 concentration was 35 U/ml, the sensitivity for prognosis was 75.7%, the specificity for prognosis was 69.5%, the area under the ROC curve was 0.776, the standard deviation was 0.030, and the 95% confidence interval was 0.717, 0.836 (p=0.000); in comparison, when the serum HPSE concentration was 4.60 ng/ml, the sensitivity was 76.3%, the specificity was 55.9%, the area under the ROC curve was 0.685, the standard deviation was 0.031, and the 95% confidence interval was 0.700, 0.823 (p=0.000). These results revealed that all the parameters for diagnosis with HPSE concentration were similar or close to the parameters for diagnosis with CA125 concentration, indicating that HPSE may be a potential biomarker for ovarian cancer diagnosis.

As shown in Table III, the positive expression rates of HPSE at both the mRNA and protein levels in malignant ovarian tumors were significantly higher than the rates in benign tumors and controls (p=0.013 and 0.007, respectively), while no statistically significant difference was observed between the rates in benign tumors and controls. As shown in Table IV, further study showed that the positive expression rate of HPSE in malignant ovarian cancer had no direct correlations with histological type, but was closely related to differentiation grade and stages. Compared to the rates in well differentiated and stages III–IV cancer, the positive expression rates of HPSE at both the mRNA and protein levels were clearly upregulated in low differentiated and stages I–II cancer (p=0.025 and 0.014; 0.013 and 0.001, respectively), and the rate in ovarian cancer patients with distant metastasis was notably higher than that in patients with no distant metastasis (p=0.027 and 0.003), although no relationship between the rates and lymphatic, pelvic and peritoneal metastasis was observed.

The positive expression of HPSE was also closely associated with prognosis in ovarian cancer. Among all the factors involved in prognosis such as age, histological type, differentiation grade, FIGO stage, lymphatic metastasis, peritoneal metastasis, distant metastasis, peritoneal fluid and tumor residues, we found that tumor residue, lymphatic metastasis, distant metastasis, mRNA expression of HPSE and the positive protein expression rate of HPSE were closely associated with prognosis in ovarian cancer according to COX model analysis (as shown in Table V) (p=0.039, 0.031, 0.031, 0.028 and 0.01, respectively).

cDNA of HPSE was cloned from tissue of epithelial ovarian cancer by PCR, and the length was ~1,600 bp in accordance with standard DNA marker, consistent with the theoretical length of HPSE. The cDNA was sub-cloned into pcDNA3.1 vector and sequenced to be 100% identical to the sequence of HPSE already deposited in GenBank. The expression of HPSE in ovarian cancer cells varied fairly. As shown in Fig. 3, RT-PCR results indicated that HPSE was expressed in HO-8910pm, HO-8910-178-1 and CBP-resistant SKOV3 ovarian cancer cells, and was highly expressed in HO-8910 and normal SKOV3 cells, while no expression was detected in A2780 and DDP-resistant SKOV3 cells. Based on these results, the A2780 cells with no HPSE expression, and SKOV3 cells with strong HPSE expression were selected for subsequent studies.

As shown in Fig. 4, compared to the expression in A2780 cells transfected with pcDNA3.1 empty vector, HPSE expression at both the mRNA and protein level was only detected in A2780 cells transfected with pcDNA3.1-HPSE vector. Thus, the A2780 cells transfected with pcDNA3.1-HPSE vector was used to study the influence on biological behaviors of tumor cells caused by HPSE.

To gain further insight into the specific function of HPSE, we developed a shRNA interference approach in SKOV3 ovarian cancer cells. Four purified pGPU6/GFP/Neo-shRNA expression vectors, which contained the HPSE shRNA insert (pGPU6/GFP/Neo-HPSE-548, pGPU6/GFP/Neo-HPSE-640, pGPU6/GFP/Neo-HPSE-1222, and pGPU6/GFP/Neo-HPSE-1566) and two control vectors (pGPU6/GFP/Neo-shNC and pGPU6/GFP/Neo-shGAPDH) were transfected into SKOV3 cells. The transfection rate was measured by GFP cells vs. total cells in one microscope field, each cell with five fields. As shown in Fig. 5 and Table VI, the transfection rates between these six cells had no statistically significant difference. However, the mRNA expression of HPSE in these 6 cells clearly varied. As shown in Fig. 6, HPSE expression at mRNA level in SKOV3 cells transfected with pGPU6/GFP/Neo-HPSE-1222 was significantly reduced compared to those transfected with pGPU6/GFP/Neo-HPSE-548, pGPU6/GFP/Neo-HPSE-640, pGPU6/GFP/Neo-HPSE-1556, and two control cells. Thus, pGPU6/GFP/Neo-HPSE-1222 with the greatest silencing efficiency was selected for further study.

SKOV3 cells transfected with pGPU6/GFP/Neo-HPSE-1222, pGPU6/GFP/Neo-shGAPDH and pGPU6/GFP/Neo-shNC were incubated in G418 medium for 14 days, and those still with GFP were identified as stable HPSE silencing cells (as shown in Fig. 7). Western blotting was performed to evaluate inhibition of HPSE protein synthesis. As shown in Fig. 8, HPSE protein was specifically silenced in SKOV3 cells transfected with pGPU6/GFP/Neo-HPSE-1222 plasmids in comparison with that in control cells.

The stable A2780 cells transfected with pcDNA3.1-HPSE vector in which the HPSE was upregulated, and the stable SKOV3 cells transfected with pGPU6/GFP/Neo-HPSE-1222 vector for which the HPSE expression was downregulated, were used to study the effects of HPSE on biological behaviors. 1) The effects on cell growth: the overexpression of HPSE in A2780 cells clearly accelerated the cell growth compared with the growth speed of normal A2780 cells and pcDNA3.1-A2780 cells (p=0.003), and the silencing of HPSE in SKOV3 cells apparently slowed down the cell proliferation in comparison with that in two controls (p=0.001). 2) The effects on cell cycle: as shown in Table VII, the percentage of cells in proliferative phase (S phase + G2 phase + M phase) of cell cycle in pcDNA3.1-HPSE-A2780 cells was visibly more than that in pcDNA3.1-A2780 cells (p=0.003), and the percentage of cells in the proliferative phase of cell cycle in pGPU6/GFP/Neo-HPSE-1222-SKOV3 cells was much less than that in control cells (p=0.034 and 0.015, respectively). 3) The effects on cell invasion, metastasis and cell adhesion: as shown in Table VIII, the ability of cell invasion and adhesion of pcDNA3.1-HPSE-A2780 cells was notably stronger than that of pcDNA3.1-A2780 cells (p=0.003 and 0.002), although no difference was observed in cell metastasis between them. The ability of invasion and adhesion of pGPU6/GFP/Neo-HPSE-1222-SKOV3 cells was markedly weaker than that of the two control cells (p=0.015, 0.015 and 0.038, respectively) and, similarly, no difference was observed in cell metastasis between them. Collectively, these results revealed that the expression of HPSE in ovarian cancer cells had notable effects on biological behaviors of cancer cells, indicating that HPSE might play a role in cancer development in the clinic.