OR Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 10.3892/or.2013.2912 or-31-02-1030 Articles ERRATUM 2 2014 10 12 2013 31 2 1030 1030 Copyright © 2014, Spandidos Publications 2014 This is an open-access article licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. The article may be redistributed, reproduced, and reused for non-commercial purposes, provided the original source is properly cited.

Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line

KATSURO KOIKE

Oncol Rep 25: 609–617, 2011; DOI: 10.3892/or.2011.1137

After the publication of the article, an error was found and we would like to correct it. The corresponding author takes full responsibility for this oversight.

In Materials and methods, the third paragraph; ‘Construction of plasmid vector DNA’, the first appeared junB primer sets of ready-made primers by Takara Bio Inc., were mistaken following the order described in Fig. 1, where No. 1 and No. 2 primer sets were custom-made primer sets by Operon Biotechnologies. Thus, No. 3 and No. 4 primer sets (ready-made primers by Takara Bio Inc.) and No. 1 and No. 2 primer sets were reversely described.

In the article, it was described:

‘...junB DNA was amplified with junB primer sets (Takara Bio Inc., Otsu, Shiga, Japan) (forward: ACCCCTACCGGAGTCTC AAA, reverse: GGAGTAGCTGCTGAGGTTGG) and custom-made human junB exon-primer sets (Operon Biotechnologies, Tokyo, Japan) as summarized in Fig. 1 (forward: GAGCTGG AACGCCTGATTGTC, reverse: TGGTTCATCTTGTGCAG ATCGTC) using...’

However, it should be corrected as:

‘...junB DNA was amplified with junB primer sets (Takara Bio Inc., Otsu, Shiga, Japan) (forward: GAGCTGGAACGCCTGA TTGTC, reverse: TGGTTCATCTTGTGCAGATCGTC) and custom-made human junB exon-primer sets (Operon Biotechnologies, Tokyo, Japan) as summarized in Fig. 1 (forward: AC CCCTACCGGAGTCTCAAA, reverse: GGAGTAGCTGCTG AGGTTGG) using...’