Forty-two patients who were diagnosed with primary NSCLC at the Department of Thoracic Surgery, The First Affiliated Hospital of China Medical University from January 2006 to December 2010 were included in the present study. All diagnoses were based on standard laboratory tests (cytology and histology) and confirmed by computerized tomography of the thorax. None of the patients underwent radiotherapy or chemotherapy before the operation. The study was approved by the China Medical University Ethics Committee and was conducted by the Helsinki Declaration. All patients provided written informed consent to participate in the study.

The human non-small cell lung cancer cell line NCI-H460 was purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA) and grown in RPMI-1640 culture medium containing 10% fetal bovine serum (FBS), 100 units/ml of penicillin, and 100 μg/ml streptomycin in humidified air (5% CO₂ atmosphere) at 37°C. Cells were transfected with hsa-miR-200c (UAAUACUGCCGGGUAAUGAUGGA) (Open Biosystems, Huntsville, AL, USA) with RNAiFect transfection reagent (Qiagen, Gaithersburg, MD, USA).

Total RNA was isolated from the cell lines and from lung specimens with TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Expression of mature miR-200c was determined by the TaqMan miRNA assay (Applied Biosystems), and normalized using the 2^−ΔΔCt method relative to U6. All TaqMan PCRs were conducted in triplicate with a fluorescence-based, real-time detection method (ABI PRISM 7500 Sequence Detection System; Applied Biosystems).

The transfected and untransfected cells were treated with RESV (Sigma Chemicals, St. Louis, MO, USA). MTT (10 μl, at 5 mg/ml) was added at a final concentration of 500 μg/ml, and the mixture was further incubated for 1 h at 37°C, and the liquid in the wells was removed thereafter. DMSO (100 μl) was then added to each well, and the absorbance was read with a UVmax microplate reader (Molecular Devices, Sunnyvale, CA, USA) at 560 nm.

Cells (5×10⁵) were collected without EDTA and washed with PBS. A 500 μl binding buffer, 5 μl Annexin V-FITC and 5 μl propidium iodide (PI) were added into the suspension in that order and mixed at room temperature in the dark for 10 min. The examination of apoptosis was performed by flow cytometry within 1 h.

Cells seeded on 6-well plates were treated and then collected. After being washed with PBS three times, the cell suspension was fixed with 70% ethanol, and incubated with RNAse A at 37°C. After being stained with 400 μl PI, the suspension was evaluated by flow cytometry.

All experiments using animals were performed according to the guidelines of the China Medical University Ethics Committee. Nude mice (nu/nu), 6–8 weeks of age, were purchased from Vital River Laboratories Co., Ltd. (Beijing, China). The animal facility was maintained under conditions of 20±2°C, 50±10% humidity, and a 12-h light/dark cycle. H460 cells (3×10⁷ in 200 μl) were subcutaneously injected into the axilla of each mouse. After the tumor diameters reached 3–5 mm, the mice were divided randomly into three groups and received a 200 μl intratumoral injection of miR-200c, RESV or both miR-200c and RESV. Two injections were administered at 10 a.m and 5 p.m. every two days. The tumor growth was then monitored for 30 days. Every five days until the end of the experiment, one mouse from each group was randomly selected to be sacrificed by CO₂ asphyxiation, and tumors were harvested and weighed. The tissue was fixed in 4% paraformaldehyde for histopathologic analysis. Additional mice (n=60) were used to establish xenografts to obtain survival curves. Mice with xenografted tumors (as described above) that reached 3–5 mm in diameter were divided into four groups (n=15 for each). Survival was monitored until the experiments were terminated due to the heavy tumor burden.

The miRNA targets predicted by TargetScan (http://www.targetscan.org/) are based on the presence of conserved 8mer, 7mer and 6mer sites that match the seed region of each miRNA (13). TargetScan also predicts non-conserved sites, additional types of seed matches that are preferentially conserved in different species, and sites with mismatches in the seed region that are compensated by conserved 3′ pairing (14).

Tissues and cells were lysed in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100) containing a protease inhibitor cocktail (Sigma). Protein amounts were quantified using the BCA protein assay kit. Equivalent amounts of protein (20 μg) were separated using 12% SDS-PAGE and transferred to a PVDF membrane (Millipore Corporation, Billerica, MA, USA). Western blot analysis was performed using primary antibodies: RECK (Santa Cruz Biotechnology, Santa Cruz, CA, USA), stress-activated protein kinase/JNK antibody (Cell Signaling Technology, Beverly, MA, USA), phospho-stress activated protein kinase/p-JNK (Thr¹⁸³/Tyr¹⁸⁵) (Cell Signaling Technology), CHOP (Abcam), BiP (Cell Signaling Technology), c-jun (Cell Signaling Technology), phosphorylated c-jun (Ser⁶³) (Cell Signaling Technology) and β-actin (Millipore). Binding of each specific antibody was detected with horseradish peroxidase (HRP)-conjugated respective secondary antibodies (Amersham Biosciences, Buckinghamshire, UK) and ECL solutions (Amersham Biosciences).

Data were analyzed using GraphPad Prism 5 software. Statistical analysis was performed using a one-tailed Student’s t-test (unilateral and unpaired). Kaplan-Meier survival plots were generated, and comparisons between survival curves were carried out using the log-rank statistical analysis. P-values <0.05 were considered to indicate statistically significant differences.

The level of miR-200c in the tumor tissues was lower than that in the normal tissues as determined by real-time PCR (P<0.05; Fig. 1A). To investigate the association of miR-200c with patient survival, the survival data from 42 patients with NSCLC were assessed. Kaplan-Meier analysis showed that miR-200c expression was closely correlated with the favorable prognosis of patients with NSCLC (P<0.05; Fig. 1B).

A slower growth rate of the miR-200c-expressing H460 cells was noted when compared with the untreated cells by using MTT assay (P<0.05; Fig. 2A). Annexin V/PI double staining showed a higher level of apoptosis in the miR-200c-expressing H460 cells (P<0.05; Fig. 2B). PI staining of cells revealed that miR-200c-expressing H460 cells were arrested in the G₁ phase (Fig. 2C). RESV also inhibited proliferation, induced apoptosis and G₁ arrest in H460 cells (Fig. 2). Notably, RESV showed stronger antitumor activity in the miR-200c-positive H460 cells than that in the negative miR-200c H460 cells. Furthermore, we confirmed that the activity of RESV in the miR-200c-positive H460 cells was not a simple summation of RESV and miR-200c (Fig. 2).

We next determined whether RESV and miR-200c display antitumor activities in established xenograft tumor models. As shown in Fig. 3A, the tumor volumes of the RESV-treated and the miR-200c-treated mice were less than that of the untreated mice (P<0.05). Similarly, tumor weights for the RESV-treated group and the miR-200c-treated group were also significantly reduced when compared to that of the untreated group (P<0.05; Fig. 3B). We also found that the RESV-treated and miR-200c-treated mice displayed a prolonged survival rate when compared to the untreated mice (P<0.05; Fig. 3C). The results of the in vitro studies demonstrated that the combined treatment with RESV and miR-200c had the strongest antitumor activity in the established xenograft tumor models.

To clarify the mechanism of RESV in the miR-200c-positive H460 cells, TargetScan was used to determine the predicted target genes of miR-200c. The prediction results are partly shown in Fig. 4. Furthermore, we focused on an ER stress-related protein, RECK. As shown in Fig. 5, RECK expression was upregulated following miR-200c transfection. Expression of ER stress molecules (BiP and CHOP) was significantly increased in the miR-200c-transfected cells. No significant changes in JNK and c-jun were detected in the transfected cells. However, phosphorylated JNK and c-jun were increased. We then confirmed that caspase-3 and caspase-9 were activated in the transfected cells (Fig. 5). RESV further enhanced RECK, BiP, CHOP, JNK, c-jun, caspase-3 and caspase-9 expression in the miR-200c-transfected cells but not in the untransfected cells (Fig. 5).