The OS cell lines (MG-63 and U-2 OS) used for the experiments were obtained from the Institute of Biochemistry and Cell Biology (Shanghai, China). Lentiviral-mediated CXCR7 siRNA (Lv-siCXCR7), negative control vector, and virion-packaging elements were purchased from GeneChem (Shanghai, China). Human OS tissues and the corresponding adjacent non-cancerous tissues (ANCT) were collected from patients at the Department of Orthopedic Surgery, Changzheng Hospital. The tissue microarray of OS was made by Shanghai Outdo Biotech Co. Ltd. (Shanghai, China). All of the antibodies were purchased from Cell Signaling Technology (Boston, MA, USA). CXCR7 primer was synthesized by ABI (Framingham, MA, USA).

Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA); TRIzol reagent and Lipofectamine 2000 were obtained from Invitrogen (Carlsbad, CA, USA); M-MLV Reverse Transcriptase was purchased from Promega (Madison, WI, USA); SYBR-Green Master Mix was obtained from Takara (Otsu, Japan); and the ECL Plus kit was obtained from GE Healthcare (Piscataway, NJ, USA).

The tissue microarray was prepared for immunohistochemical analysis (IHC). Human OS tissues and the corresponding ANCT were obtained from biopsies in a total of 45 consecutive OS cases admitted to our hospital from January 2005 to December 2011. The baseline characteristics of the patients before neo-adjuvant chemotherapy are summarized in Table I. The study was approved by the Medical Ethics Committee of the Second Military Medical University and written informed consent was obtained from the patients or their parents before sample collection. Two pathologists respectively reviewed all of the cases.

The advanced tissue arrayer (ATA-100; Chemicon International, Temecula, CA, USA) was used to create holes in a recipient paraffin block and to acquire cylindrical core tissue biopsies with a diameter of 1 mm from the specific areas of the ‘donor’ block. The tissue core biopsies were transferred to the recipient paraffin block at defined array positions. The tissue microarrays contained tissue samples from 45 formalin-fixed paraffin-embedded cancer specimens with known diagnosis, and the corresponding ANCT from these patients. The block was incubated in an oven at 45°C for 20 min to allow complete embedding of the grafted tissue cylinders in the paraffin of the recipient block, and then stored at 4°C until microtome sectioning.

Tissue microarray sections were processed for IHC analysis of CXCR7 protein as follows. Immunohistochemical examinations were carried out on 3-mm sections. For anti-CXCR7 immunohistochemistry, unmasking was performed with 10 mM sodium citrate buffer, pH 6.0, at 90°C for 30 min. For anti-CXCR7 immunohistochemistry, antigen unmasking was not necessary. Sections were incubated in 0.03% hydrogen peroxide for 10 min at room temperature to remove endogenous peroxidase activity, and then in blocking serum [0.04% bovine serum albumin (A2153; Sigma-Aldrich, Shanghai, China) and 0.5% normal goat serum (X0907; Dako Corporation, Carpinteria, CA, USA) in phosphate-buffered saline (PBS)] for 30 min at room temperature. Anti-CXCR7 antibody was used at a dilution of 1:200. The antibody was incubated overnight at 4°C. Sections were then washed three times for 5 min in PBS. Non-specific staining was blocked with 0.5% casein and 5% normal serum for 30 min at room temperature. Finally, staining was developed using diaminobenzidine substrate, and the sections were counterstained with hematoxylin. Normal serum or PBS was used to replace the anti-CXCR7 antibody in the negative controls.

The expression of CXCR7 was semi-quantitatively estimated as the total immunostaining scores, which were calculated as the product of a proportion score and an intensity score. The proportion and intensity of the staining were evaluated independently by two observers. The proportion score reflected the fraction of positive staining cells (0, none; 1, ≤10%; 2, >10 to ≥25%; 3, >25 to 50%; 4, >50%), and the intensity score represented the staining intensity (0, no staining; 1, weak; 2, intermediate; and 3, strong). Finally, a total expression score was given ranging from 0 to 12. Based on the analysis in advance, CXCR7 expression was categorized into two groups: low-level CXCR7 expression (score 0–3) and high-level CXCR7 expression (score 4–12). The scoring was independently assessed by two pathologists.

OS cell lines were cultured in DMEM supplemented with 10% heat-inactivated FBS, 100 U/ml of penicillin, and 100 μg/ml of streptomycin. Cells in this medium were placed in a humidified atmosphere containing 5% CO₂ at 37°C. Cells were subcultured at a 1:5 dilution in medium containing 300 μg/ml G418 (an aminoglycoside antibody; commonly used stable transfection reagent in molecular genetic testing). On the day of transduction, OS cells were replated at 5×10⁴ cells/well in 24-well plates containing serum-free growth medium with polybrene (5 mg/ml). When reaching 50% confluency, cells were transfected with recombinant experimental virus or control virus at the optimal MOI (multiplicity of infection) of 50, and cultured at 37°C in 5% CO₂ for 4 h. The supernatant was then discarded and serum containing growth medium was added. At 4 days post-transduction, the transduction efficiency was measured by the frequency of green fluorescent protein (GFP)-positive cells. Positive and stable transfectants were selected and expanded for further study. The Lv-siCXCR7 vector-infected clone and the negative control vector-infected cells were designated as the Lv-siCXCR7 and the NC group.

To quantitatively determine the mRNA expression level of CXCR7 in OS cells, real-time PCR was performed. Total RNA was extracted from each clone using TRIzol according to the manufacturer’s protocol. Reverse transcription was carried out using M-MLV and cDNA amplification was performed using the SYBR-Green Master Mix kit according to the manufacturer’s guidelines. The CXCR7 gene was amplified using a specific oligonucleotide primer, and the β-actin gene was used as an endogenous control. The PCR primer sequences were as follows: CXCR7, 5′-CACCGCATCTCTTCGACTACTCAGATTCAAGAGAT CTGAGTAGTCGAAGAGATGCTTTTTTG-3′ and 5′-GATC CAAAAAAGCATCTCTTCGACTACTCAGATCTCTTGA ATCTGAGTAGTCGAAGAGATGC-3′; β-actin, 5′-CAACG AATTTGGCTACAGCA-3′ and 5′-AGGGGTCTACATGGCA ACTG-3′. Data were analyzed using the comparative Ct method (2^−ΔΔCt). Three separate experiments were performed for each clone.

OS cell lines were harvested and extracted using lysis buffer (Tris-HCl, SDS, mercaptoethanol and glycerol). Cell extracts were boiled for 5 min in loading buffer, and then an equal amount of cell extracts was separated on 15% SDS-PAGE gels. Separated protein bands were transferred onto polyvinylidene fluoride (PVDF) membranes, which were subsequently blocked in 5% skim milk powder. Primary antibodies against CXCR7, p-PI3K, p-AKT, β-arrestin, PCNA and metalloproteinase-9 (MMP-9) were diluted according to the manufacturer’s instructions and incubated overnight at 4°C. Subsequently, horseradish peroxidase-linked secondary antibodies were added at a dilution of 1:1,000 and incubated at room temperature for 2 h. The membranes were washed 3 times with PBS, and the immunoreactive bands were visualized using the ECL Plus kit according to the manufacturer’s instructions. The relative protein levels in the different cell lines were normalized to the concentration of β-actin. Three separate experiments were performed for each clone.

Cell proliferation was analyzed using the MTT assay. Briefly, cells infected with the Lv-siCXCR7 virus were incubated in a 96-well plate at a density of 1×10⁵ cells/well with DMEM supplemented with 10% FBS. Cells were treated with 20 μl of MTT dye for 0, 24, 48 and 72 h, and subsequently incubated with 150 μl of DMSO for 5 min. The color reaction was measured at 570 nm using an enzyme immunoassay analyzer (Bio-Rad, Hercules, CA, USA). The proliferation activity was calculated for each clone.

Transwell filters were coated with Matrigel (3.9 μg/μl; 60–80 μl) on the upper surface of a polycarbonate membrane (diameter, 6.5 mm; pore size, 8 μm). After incubation at 37°C for 30 min, the Matrigel solidified and served as the extracellular matrix for analysis of tumor cell invasion. Harvested cells (1×10⁵) in 100 μl of serum-free DMEM were added into the upper compartment of the chamber. A total of 200 μl of conditioned medium derived from NIH3T3 cells was used as a source of chemoattractant, which was placed in the bottom compartment of the chamber. After 24 h of incubation at 37°C with 5% CO₂, the medium was removed from the upper chamber. The non-invaded cells on the upper side of the chamber were scraped off with a cotton swab. Cells that had migrated from the Matrigel into the pores of the inserted filter were fixed with 100% methanol, stained with hematoxylin, then mounted and dried at 80°C for 30 min. The number of cells invading through the Matrigel was counted in 3 randomly selected visual fields from the central and peripheral portion of the filter by using an inverted microscope (×200 magnification). Each assay was repeated 3 times.

Six-week-old female immunodeficient mice (BALB/c-nu) were bred at the laboratory animal facility (Institute of Chinese Academy of Sciences, Shanghai), and were housed individually in microisolator ventilated cages with free access to water and food. All experimental procedures were performed according to the regulations and internal biosafety and bioethics guidelines of the Second Military Medical University and the Shanghai Municipal Science and Technology Commission. Three mice were injected subcutaneously with 1×10⁷ OS cells (U-2 OS) in 50 μl of PBS pre-mixed with an equal volume of Matrigel matrix (Becton-Dickinson). Mice were monitored daily and developed subcutaneous tumors. When the tumor size reached ~5 mm in length, the tumors were surgically removed, cut into 1–2 mm³ pieces, and re-seeded individually into other mice. When the tumor size reached ~5 mm in length, the mice were randomly assigned to the NC group and Lv-siCXCR7 group. In the treatment group, 15 μl of Lv-siCXCR7 was injected into the subcutaneous tumors using a multi-site injection format. Injections were repeated every other day after initial treatment. The tumor volume every 3 days was measured with a caliper, using the formula: Volume = (length × width)²/2.

SPSS 20.0 was used for the statistical analysis. Kruskal-Wallis H and Chi-square tests were used to analyze the expression levels in all groups. One-way analysis of variance (ANOVA) was used to analyze the differences between groups. The LSD method of multiple comparisons was used when the probability for ANOVA was statistically significant. Statistical significance was set at P<0.05.

The expression of CXCR7 protein was evaluated using IHC staining in OS tissues. The different levels of positive expression of CXCR7 protein were detected in OS (Fig. 1A and B) and ANCT tissues (Fig. 1C and D). Positive CXCR7 immunostaining was mainly localized in the cytoplasm of OS tissue cells. According to the CXCR7 immunoreactive intensity, the positive expression of CXCR7 in OS tissues was significantly increased compared with that in ANCT (P=0.033) (Table II).

The association of CXCR7 expression with various clinical and pathological factors was analyzed. As shown in Table I, increased expression of CXCR7 was closely correlated with the distant metastasis of OS (P=0.004). However, no significant association was found between CXCR7 expression and other factors including age, gender, histology and Ennecking staging of the tumor (all P>0.05).

First, lentiviruses of different multiplicity of infections (MOIs) were used to transfect OS cell lines (MG-63 and U-2 OS), and the transfection efficiency of Lv-siCXCR7 (MOI=50) was >65%. After Lv-siCXCR7 was transfected into the OS cell lines for 24 h, the expression levels of CXCR7 mRNA (Fig. 2A and B) and protein (Fig. 2C and D), p-PI3K, and p-AKT and β-arrestin proteins (Fig. 2E and F) were detected by real-time PCR and western blot assays, indicating a reduced expression of CXCR7, p-PI3K, p-AKT and β-arrestin in the Lv-siCXCR7 group when compared with the levels in the NC group.

Deregulated cell proliferation is a hallmark of cancer. To verify the effect of CXCR7 on tumor growth in OS cells, we examined cell proliferative activities by MTT assay. The results showed that knockdown of CXCR7 diminished the proliferative activities of OS cells in a time-dependent manner compared to the NC group (Fig. 3A and B). In addition, the expression level of PCNA protein, examined by western blot assay (Fig. 3C and D), was found to be significantly downregulated in the Lv-siCXCR7 group compared with the NC group.

To determine the effect of CXCR7 on cell invasion, a Transwell assay was performed. The invasive potential of tumor cells in the Transwell assay was determined by the ability of cells to invade a matrix barrier containing laminin and type IV collagen, the major components of the basement membrane. Representative micrographs of the Transwell filters are shown in Fig. 4A and B. The invasive potential of the OS cells was apparently weakened in the Lv-siCXCR7 group compared to the NC group (P<0.01) (Fig. 4C and D). In addition, the expression level of MMP-9 protein, examined by western blot assay (Fig. 4E and F), was found to be significantly downregulated in the Lv-siCXCR7 group compared with the level in the NC group.

Our in vitro experiments demonstrated an inhibitory effect of CXCR7 knockdown on OS growth. Therefore, we further investigated the effect of CXCR7 on U-2 OS xenograft tumor growth in vivo. The mean volume of the tumors in the experimental mice before treatment was 68.32±14.25 mm³. During the entire tumor growth period, the tumor growth activity was determined. The tumors treated with Lv-siCXCR7 grew substantially slower compared to the NC group (Fig. 5A). When the tumors were harvested, the average weight and volume of the tumors in Lv-siCXCR7 group were significantly reduced when compared with these parameters in the NC group (Fig. 5B and C), suggesting that CXCR7 knockdown blocked the growth of OS cells.