Human NB SH-SY5Y cells were purchased from the American Type Culture Collection (ATCC; Rockville, MD, USA) and cultured in Dulbecco’s modified Eagle’s medium-F12 (DMEM-F12; HyClone), supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/ml penicillin and 100 μg/ml streptomycin (Sigma Chemical Co., St. Louis, MO, USA) at 37°C in a humidified 5% CO₂ incubator. The TNKS1 inhibitor XAV939 was purchased from Sigma-Aldrich.

SH-SY5Y cells were cultured and proliferated for XAV939 and RNAi treatment. XAV939 was dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich), and the final concentration was 1 μM based on our previous study results (14). The control group was treated with DMSO only. The TNKS1 gene was knocked down by RNAi method, and the related products were purchased from GeneChem Co., Ltd. (Shanghai, China). Three specific sequences of short hairpin RNAs (shRNAs) targeting different regions of the human TNKS1 mRNA sequence (shRNA-1, −2 and −3, designed to choose the best sequence for the RNAi effect) and a scrambled shRNA (SCR), were constructed into the GV118 lentiviral vector, which had a GFP tag. Then the lentivirus was packaged and amplified in HEK293T cells. The SH-SY5Y cells were infected at an MOI of 10 on the basis of a preliminary experiment. The shRNA sequences targeting human TNKS1 and SCR are listed below (5′–3′):

The effect of RNAi was then verified by quantitative real-time RT-PCR (qRT-PCR) and western blotting, and the optimal sequence was selected for follow-up assays. Following XAV939 treatment or RNAi-TNKS1 for 72 h, all groups were subjected to detection of telomere length, telomerase activity, apoptosis evaluation and cell invasion assay.

The Genomic DNA extraction kit (Dingguo Biotechnology, Beijing, China) was used to extract total DNA according to the manufacturer’s instructions. The DNA quality and quantity were checked and quantified using NanoDrop 1000 (NanoDrop, Wilmington, DE, USA).

The telomere length was determined using qPCR as previously described by Cawthon (18,19). This method determines the average ratio of telomere repeat copy numbers to single-copy gene numbers (the relative T/S ratio) in each sample. The T/S ratio is proportional to the average telomere length, thus the relative telomere length can be calculated quantitatively. qPCR reactions were performed using an ABI 7500 (Applied Biosystems). Triplicate DNA samples were amplified in parallel in 20 μl PCR reactions containing 60 ng of sample DNA, 10 μl 2X SYBR^® Prime Ex Taq™ (Takara), 100 nM of forward telomere primer (CGGTTTGTTTGGGTTTGGGT TTGGGTTTGGGTTTGGGTT) and 900 nM of reverse telomere primer (GGCTTGCCTTACCCTTACCCTTACCCT TACCCTTACCCT) and 0.4 μl 50X ROX Fluorescent Dye II. The reaction proceeded for one cycle at 95°C for 10 min, followed by 30 cycles at 95°C for 15 sec and 56°C for 1 min. The β-globin reaction mixture consisted of 60 ng of sample DNA, 10 μl 2X SYBR^® Prime Ex Taq™, 300 nM of forward β-globin primer (GCTTCTGACACAACTGTGTTCACT AGC) and 700 nM of reverse β-globin primer (CACCAA CTTCATCCACGTTCACC) and 0.4 μl 50X ROX Fluorescent Dye II. The β-globin reaction proceeded for one cycle at 95°C for 10 min, followed by 35 cycles at 95°C for 15 sec and 54°C for 1 min. The data were then analyzed with the ABI SDS software to generate the standard curve for each plate. Relative telomere length was calculated from the T/S ratio = 2^−ΔCt, where ΔCt = Ct_telomere − Ct_β-globin.

Telomerase activity was measured by a combination of telomeric repeat amplification protocol (TRAP) and the human telomerase ELISA kit (R&D Systems) according to the manufacturers’ protocol. The assay was performed 96 h after XAV939 treatment or RNAi-TNKS1.

The morphological cell change characteristic of apoptosis was observed by TEM. Following XAV939 treatment and RNAi-TNKS1, the SH-SY5Y cells were collected and fixed in 2.5% glutaraldehyde for 24 h. The cells were then washed with phosphate-buffered saline (PBS) 3 times and fixed in 1% osmic acid for 2–3 h. Subsequently, the samples were dehydrated in ascending grades of ethanol followed by clearing in propylene oxide, replaced with acetone, and embedded in araldite. The pellet was cut into 1-μm slices and immersed in 3% uranyl acetate-lead citrate for double staining and viewed by TEM (JEM-1200EX).

SH-SY5Y cell apoptosis was quantified by FCM using the Annexin V/FITC apoptosis detection kit (KeyGen Biotech, Nanjing, China) following the manufacturer’s protocol. The cells were seeded in 6-well plates (1×10⁵ cells/well) and treated with DMSO or 1 μM XAV939 or RNAi-TNKS1. Then, the cells were harvested, washed with cold PBS and double-stained with Annexin V-FITC as well as propidium iodide (PI) in the dark. Each sample was then analyzed by fluorescence-activated cell sorting (FACS) (BD, San Jose, CA, USA). At least 10,000 cells were analyzed. Alternatively, apoptosis was also determined using Hoechst 33342 staining. At the indicated time points after treatment, cells were washed with PBS and stained with Hoechst 33342 (10 μg/ml; Sigma-Aldrich). The cells were then observed by a fluorescence microscope (Olympus inverted fluorescence microscope, IX71) with excitation at 340 nm, and ~100 cells from five random microscopic fields were counted. The percentage of apoptotic cells was calculated as the ratio of apoptotic to total cells. The mean and standard error were calculated for each time point and treatment group (14).

Cell invasion assays were performed using BD Matrigel Basement Membrane Matrix (BD Biosciences, Franklin Lakes, NJ, USA) according to the manufacturer’s instructions. The diluted Matrigel was added to the upper chamber of a 24-well Transwell plate (Corning Company, Corning, NY, USA) and incubated at 37°C for 4–5 h for gelling. Transfected and untransfected SH-SY5Y cells were harvested from the culture dishes by trypsin, washed and resuspended in serum-free medium (containing XAV939), and added to the upper wells at a density of 2×10⁵ cells/well in 100 μl DMEM/F12 medium, while 600 μl medium containing 20% FBS was added to the lower wells. The Transwell plates were incubated at 37°C in a humidified atmosphere containing 5% CO₂ in air for 24 h, and then the cells remaining on the upper surface of the membrane were removed with cotton swabs. Migrated cells, which remained on the lower face of the porous membrane, were fixed with 90% ethanol for 30 min and stained with 0.1% crystal violet dye for 10 min. Cells that had invaded the lower surface of the filter were counted under an inverted microscope, and cells in nine fields per well were counted.

All quantitative variables are expressed as means ± standard deviation (SD) and tested for normality using homogeneity variances prior to further statistical analysis. Each experiment was repeated three times. The data were analyzed by one-way ANOVA followed by Tukey’s post-test using SPSS software, version 16.0. Differences were considered to be statistically significant at P<0.05.

Both qPCR and western blotting were used to detect the optimal sequence for RNAi-TNKS1. The results of qRT-PCR showed that the melting curve of β-actin and TNKS1 were standard single peaks, indicating specific amplification products (Fig. 1A). After transfection with shRNA-1, −2, −3 and SCR, the relative expression of TNKS1 mRNA was 1.10±0.12, 0.42±0.04, 0.82±0.05 and 1.00±0.03, respectively (Fig. 1B, P<0.05), while the relative expression of TNKS1 protein was 0.87±0.13, 0.41±0.06, 0.76±0.05 and 1.00±0.03, respectively (Fig. 1C and D, P<0.05). The results indicated that transfection with shRNA-2 most significantly reduced both the expression of TNKS1 mRNA and protein, and the inhibition ratio was ~60%, which reached the standard for the interference effect. Thus, shRNA-2 was chosen as the optimal sequence for RNAi-TNKS1 for the follow-up assays.

Results of qPCR showed that the melting curves of β-globin and telomere presented standard single peaks, indicating specific amplification products (Fig. 2A). Following treatment with XAV939 or RNAi-TNKS1, the relative telomere lengths were 0.60±0.05 and 0.46±0.08, respectively, which were both lower than these lengths in the control and SCR groups (Fig. 2B, P<0.05). The results indicate that treatment with XAV939 and RNAi-TNKS1 significantly shortened the telomere length compared with that of the control groups.

Telomerase was extracted by the TRAP-PCR kit and measured by the ELISA kit. The results showed that the telomerase activity in the control, XAV939 treatment, SCR and shRNA groups was 19.25±0.30, 19.01±0.57, 15.30±0.50 and 15.13±0.52 U/l, respectively (Fig. 3). Compared with the respective control groups, the telomerase activity in the cell groups treated with XAV939 or RNAi-TNKS1 was not significantly different (Fig. 3, P>0.05), indicating that XAV939 treatment and RNAi-TNKS1 had no effect on telomerase activity.

After treatment with XAV939 or RNAi-TNKS1, the TEM results showed that the mitochondria were swollen and formed many vacuoles (Fig. 4, indicated by thin arrows). Other organelle structure was unclear or disappeared, and chromatin was condensed at the edge of the nuclear membrane, which are typical morphologic alterations of apoptotic or necrotic cells (Fig. 4, indicated by thick arrows).

Early apoptotic cells stained by Annexin V, are noted in the right lower quadrant in Fig. 5A. The results showed that the percentages of apoptotic cells in the control and SCR groups were 2.15±0.38 and 3.63±0.69%, while that in the XAV939-treated or RNAi-TNKS1 group was 7.19±0.74%, respectively (Fig. 5C), which were significantly higher than the percentages in the relevant control group (P<0.05, Fig. 5C). To further confirm that TNKS1 inhibition promoted apoptosis in SH-SY5Y cells, we studied the nuclear morphology of cells following Hoechst 33342 staining (Fig. 5B). As depicted in Fig. 5B, control cells without XAV939 treatment had normal and intact cell membrane, and were stained uniformly and displayed equally disseminated chromatin. In contrast, cells that were treated with XAV939 or RNAi-TNKS1 showed varying degrees of archetypal characteristics of apoptotic cells, such as the condensation of chromatin, shrinkage of nuclei and the presence of apoptotic bodies with intense blue fluorescence. The major findings are indicated by arrows in Fig. 5B. The percentage of cells with apoptotic nuclei following XAV939 treatment or RNAi-TNKS1 increased from 13.47 to 33.59% and from 23.08 to 45.56%, respectively, which demonstrated the promotion of apoptosis following TNKS1 inhibition (P<0.05, Fig. 5D). Collectively, these results suggest that apoptosis is promoted by TNKS1 inhibition in NB.

SH-SY5Y cells that migrated into the lower chamber were stained with crystal violet (Fig. 6A). The results showed that the numbers of migrated cells in the control, XAV939 treatment, SCR and shRNA groups were 58.0±3.0, 30.2±2.1, 60.1±3.5 and 28.1±1.6, respectively (Fig. 6B). Following treatment with XAV939 and RNAi-TNKS1, the invasion rates decreased 47.9 and 53.2% respectively, compared with the control groups (Fig. 6B, P<0.05). It can be concluded that both XAV939 treatment and RNAi-TNKS1 inhibit the invasiveness of SH-SY5Y cells.