Six specimens of non-tumorous brain tissues (internal decompression in cerebral trauma) and 16 specimens of glioma tissues were obtained from the Affiliated Hospital of Xuzhou Medical College (Xuzhou, China). Surgically removed tissues were sampled for histological diagnosis, and the remaining tissues were immediately frozen in liquid nitrogen and stored at −80°C. The present study was approved by the Research Ethics Committee of Xuzhou Medical College, and informed consent was provided by the patients.

Cell lines (293T and U251) were purchased from the Cell Bank of the Shanghai Institutes of the Chinese Academy of Sciences and were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Evergreen Biological Engineering Co., Hangzhou, China) at 37°C in 5% CO₂. For hypoxia, the cells were cultured in a modular incubator chamber (150i; Thermo Fisher Scientific, Waltham, MA, USA) at 37°C with 5% CO₂, 1% O₂ and 94% N₂.

For overexpression of Siah1, the Siah1 cDNA was inserted into the pWPXLd plasmid using BamHI and MluI sites. For silencing of Siah1, two short hairpin RNA (shRNA) duplexes were designed as follows: shSiah1A F, TGATAGGAACACGCAAGCAATTCAAGAGATTGCTTGCGTGTTCCTATCTTTTTTC and shSiah1A R, TCGAGAAAAAAGATAGGAACACGCAAGCAATCTCTTGAATTGCTTGCGTGTTCCTATCA; shSiah1B F, TCACACCTTTGAGCTTAATCTTCAAGAGAGATTAAGCTCAAAGGTGTGTTTTTTC and shSiah1B R, TCGAGAAAAAACACACCTTTGAGCTTAATCTCTCTTGAAGATTAAGCTCAAAGGTGTGA. The shRNA oligomers and non-targeting oligomers (scramble) were annealed and then subcloned into the pLL3.7 plasmid by the HpaI and XhoI cloning site. Cell transfection was performed with PolyJET (SignaGen, Gaithersburg, MD, USA) as described in the manufacturer’s protocol. The viruses were propagated in 293T cells by cotransfecting the corresponding plasmids with the helper plasmids.

The formation of the stable cell lines was previously described (24). For stable overexpression of Siah1, the U251 cells were infected by GFP or GFP-Siah1 viruses, respectively. Forty-eight hours after infection, the cells were continuously cultured in medium containing 2.5 μg/ml puromycin (Sigma, St. Louis, MO, USA). The surviving cells were cultured into cell lines stably expressing GFP or GFP-Siah1. For the silencing of Siah1, the scramble or shSiah1 virus-infected U251 cells were subjected to the sorting of GFP-positive cells by flow cytometry. GFP-positive cells were cultured to produce stable lines silenced for Siah1.

Equal amounts of protein lysates were subjected to 10% SDS-PAGE and then transferred to a PVDF membrane (Millipore, Billerica, MA, USA) and probed with the primary antibodies (Siah1, PHD3, HIF-1α, β-actin) at 4°C overnight and the secondary antibodies at room temperature for 1 h. Bound antibodies were detected by the ECL Plus Western Blotting Substrate (Thermo Fisher, Waltham, MA, USA) and exposed to X-ray film. Band densities were quantified by ImageJ software. The relative amount of the proteins was determined by normalization of the densitometry.

The stable cell lines were cultured in a 6-well plate under normal conditions for 24 h and starved by no serum for 12 h. Then, scratches were performed in the middle of the wells with a pipette tip. Thereafter, the cells were cultured under a hypoxic condition (5% CO₂, 1% O₂ and 94% N₂) for 12 and 24 h. The images were captured by an inverted microscope (IX71; Olympus, Tokyo, Japan) at the designated time points. The number of cells crossing the wound was normalized according to the control.

Cell invasion was assessed using Matrigel-precoated Transwell inserts (8.0-μm pore size with polyethylene tetraphthalate membrane; Invitrogen) according to the manufacturer’s protocol. The pretreated cell suspension (1×10⁵) in serum-free culture media was added into the inserts, and each insert was placed in the lower chamber filled with culture media containing 10% FBS as a chemoattractant. The invasion chambers were incubated under a hypoxic condition for 24 h. Then, the non-invasive cells were removed from the upper chamber; filters were fixed with methanol for 15 min and stained with a 0.1% crystal violet solution for 10 min. Five fields of adherent cells in each well were randomly photographed under an inverted microscope and counted.

Data are presented as the means ± SEM. Statistical significance was determined using the Student’s t-test, and P<0.05 was considered to indicate a statistically significant result.

In order to understand the possible role of Siah1 in human glioma, we examined the Siah1 expression in 6 specimens of non-tumorous brain tissues and 18 specimens of glioma tissues (6 low-grade and 12 high-grade) by western blotting. A representative blot is shown in Fig. 1A. The statistical results indicated that the protein level of Siah1 in the glioma tissues was higher than that in the non-tumorous tissues and was correlated with advanced tumor status and stage (Fig. 1A and B). These results suggest that Siah1 expression is upregulated in human glioma, which provides us with initial evidence that Siah1 plays a role in the development and progression of human glioma.

To investigate the possible role of Siah1 in the development and progression of human glioma, we utilized loss-of- and gain-of function approaches. Firstly, we downregulated Siah1 expression using its specific short hairpin RNA and observed the effects on cell migration and invasion. For the silencing of Siah1, two shRNA targets (shSiah1A and shSiah1B) were cloned into the lentiviral vector pLL3.7 and screened for their efficacy in suppressing Siah1 expression, and a negative control shRNA (scramble) was used as a control. As shown in Fig. 2A, the silencing efficiency of shSiah1B was ~80%. Thereafter, shSiah1B and the scramble were packaged into the lentivirus in 293T cells and used to establish the stable cell line with loss of Siah1 (Fig. 2B). Next, we investigated whether the cell migration and invasion were affected by the silencing of Siah1 under hypoxia in the stable cell lines. The wound healing assay showed that the number of migratory cells was reduced by 27 and 36% at 12 and 24 h (Fig. 2C and D). The Transwell assay showed that the invasive cells decreased by 43%, compared with the corresponding controls (Fig. 2E and F). These results indicate that Siah1 is involved in the migration and invasion of human glioma cells and downregulation of Siah1 inhibits the glioma cell migration and invasion under hypoxia.

To further investigate the role of Siah1, we tested the effect of Siah1 on cell migration and invasion in U251 cells transfected by a lentivirus overexpressing Siah1. The stable cell lines overexpressing GFP or GFP-Siah1 were assessed by GFP imaging and western blotting (Fig. 3A and B). Then, we investigated whether the cell migration and invasion were promoted upon Siah1 overexpression under hypoxia in the stable lines expressing GFP or GFP-Siah1. The wound healing assay showed that the number of migratory cells was increased by 25 and 62% at 12 and 24 h (Fig. 3C and D) and the Transwell assay showed that the number of invasive cells increased by 51%, when compared with the corresponding controls (Fig. 2E and F). These results further indicate that Siah1 is involved in the migration and invasion of human glioma cells, and overexpression of Siah1 promotes glioma cell migration and invasion under hypoxia.

It has been reported that HIF-1α is activated under hypoxia and plays a crucial role in glioma cell migration and invasion (3); however, whether Siah1 is involved in the regulation of HIF-1α in human glioma cells is still unclear. For this reason, we detected the expression level of PHD3 and HIF-1α in Siah1 loss-of- and gain-of-function studies at several hypoxia time points by western blotting. We found that loss of Siah1 led to a more rapid increase in oxygen sensor PHD3 thereby inhibiting the production of HIF-1α when compared with the control (Fig. 4A and B). In addition, we analyzed the role of Siah1 under the condition of overexpression. As shown in Fig. 4C and D, compared with the control, overexpression of Siah1 resulted in a slower increase in PHD3 thereby promoting the rapid production of HIF-1α. These results suggest that Siah1 promotes cell migration and invasion by regulating the degradation of PHD3 thereby improving the stability of HIF-1α.