Oral submucous fibrosis (OSF) is a potentially malignant disease predominantly found in Asian people. The areca nut has been implicated in this disease. Arecoline, one of the areca alkaloids, induces epithelial-mesenchymal transition (EMT)-related factors in primary human buccal mucosal fibroblasts. Yet, the mechanisms of the underlying arecoline-induced EMT in OSF remain unknown. In the present study, we aimed to investigate the role of microRNAs (miRNAs) in arecoline-induced EMT in HaCaT cells. We found that miR-203 was significantly downregulated in OSF tissues compared to that in normal buccal mucosa tissues, and that miR-203 negatively regulated secreted frizzled-related protein 4 (SFRP4) and positively regulated transmembrane-4 L six family member 1 (TM4SF1). We observed that upregulation of miR-203 significantly decreased the cell proliferation of HaCaT cells, and significantly upregulated the expression of cytokeratin 19 (CK19) and E-cadherin proteins, whereas it significantly downregulated the expression of N-cadherin and vimentin compared to these levels in the vehicle control cells. Thus, we provide evidence to illustrate that miR-203 plays a role in the pathogenesis of OSF, which may be a target for OSF management.
Oral submucous fibrosis (OSF) is a potentially malignant disease predominantly found in Asian people (
Arecoline, one of the areca alkaloids, is the main agent of the areca nut responsible for fibroblast proliferation (
EMT is an indispensable mechanism during morphogenesis, and is also a crucial event in oral squamous cell carcinoma and OSF (
MicroRNAs (miRNAs) are a class of short (~22 nt) non-coding RNAs, which have been implicated in multiple cellular processes, including survival, proliferation, apoptosis and EMT in various types of cells (
In the present study, we aimed to investigate the role of miRNAs in arecoline-induced EMT in HaCaT cells. Furthermore, we also explored the potential regulated targets of the miRNAs. We found that miR-203 was significantly downregulated in OSF tissues compared to that in normal buccal mucosa tissues, and that miR-203 negatively regulated secreted frizzled-related protein 4 (SFRP4), which is correlated with EMT-related gene expression (
A total of 6 OSF tissue samples and 6 normal buccal mucosa tissues (Nor) were obtained from the Xiangya Hospital of Central South University according to the legislation and the Ethics Board of Xiangya Hospital. All subjects or their caregivers provided written informed consent. All samples were collected and identified by histopathological evaluation. All the samples were stored at −80°C until being used.
HaCaT cells were purchased from ProCell Co. (Wuhan, China). All the cells were cultured in MEM supplemented with 15% fetal bovine serum in a 5% CO2 humidified atmosphere at 37°C. The cells were transfected with miR-203 mimics, miR-203 inhibitor, and a negative control (NC) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) at a final concentration of 30 nM. To detect the effect of arecoline on EMT, the HaCaT cells were treated with arecoline (Selleck Chemicals, Houston, TX, USA) at the indicated concentrations for 72 h.
The RNeasy Plus Mini kit (Qiagen, Valencia, CA, USA) was used to extract total RNA according to the manufacturer’s instructions. The miRNeasy Mini kit (Qiagen) was used for real-time PCR to detect the expression of miR-203, miR30c and miR-206. The specific primer sets for miRNA-203, miR30c, miR-206 and U6 were purchased from GeneCopoeia. miR-203, miR30c and miR-206 expression was normalized to that of U6. The FastLane Cell SYBR®-Green kit (Qiagen) was used for real-time PCR to detect the expression of TM4SF1 and SFRP4. The primers for TM4SF1, SFRP4 and GAPDH were: TM4SF1 sense, GCTGGAACAGGATGACTGCT and antisense, ACTCGGACCATGTGGAGGTA; SFRP4 sense, ATCTCGCCTGAAGCCATCG and antisense, GGGGCTTAG GCGTTTACAGT; GAPDH sense, CAATGACCCCTTCATTG ACC and antisense, GACAAGCTTCCCGTTCTCAG. TM4SF1 and SFRP4 expression was normalized to GAPDH. The 2−ΔΔCt method was used to analyze the data.
RIPA lysis buffer (Cwbiotech, Wuhan, China) was used to extract the total protein from the tissues and cells. The BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the protein concentration. The total protein was separated by 10% SDS-PAGE and then transferred to nitrocellulose membranes. The membranes were blocked with 8% non-fat milk for 1 h and incubated with the indicated primary antibody (anti-TM4SF1 and anti-SFRP4 from Epitomics; rabbit, 1:1,000; anti-N-cadherin and anti-vimentin from Abcam; rabbit, 1:500; anti-CK19, GAPDH and anti-E-cadherin from Santa Cruz; mouse, 1:500) overnight at 4°C. The membranes were washed and incubated with the appropriate secondary antibody for 90 min at 37°C. The signals on the membranes were detected by enhanced chemiluminescence (ECL) reagent. Data were analyzed by densitometry using Image-Pro Plus software 6.0 and normalized to internal control expression (GAPDH).
The wild-type 3′-UTR of TM4SF1 and SFRP4 was inserted into the dual luciferase reporter vector. For the luciferase assay, 105 cells were plated and cultured in 24-well plates to reach ~70% confluency. The cells were co-transfected with miR-203 mimics and the TM4SF1 or SFRP4 dual luciferase reporter vector, respectively. After a 48-h transfection, the Luciferase Reporter Gene Assay kit (Global Biotech, Shanghai, China) was used to determine the luciferase activitiy on a luminometer (Roche).
Cells (1,000) were seeded in each well of 96-well plates for 12 h. Then, following the indicated treatment, the cells were further incubated for 0, 12, 24, 48, 72 and 96 h, respectively. CCK-8 reagent (10
Statistical analysis was performed by GraphPad Prism 5 and SPSS 16.0 softwares. The Student’s t-test or one-way ANOVA was used depending on the experimental conditions. Data are expressed as mean ± SD. Compared to the controls, a P-value of <0.05 was considered to indicate a statistically significant result.
We performed qPCR assay to detect the changes in miRNAs in 6 OSF tissues. Compared to the average expression in the normal oral mucosa tissues, the expression of miR-206 was significantly upregulated in 2 cases and slightly upregulated in 4 cases of OSF; the expression of miR-30c was significantly upregulated in 5 cases and slightly upregulated in 1 case of OSF; the expression of miR-203 was significantly upregulated in all of the 6 cases (
In all of the 6 cases of OSF tissues and normal oral mucosa tissues, we found that TM4SF1 was significantly decreased at the mRNA and protein levels in the OSF tissues compared with levels in the normal tissues (
To investigate whether miR-203 regulates the expression of SFRP4 and TM4SF1, we cloned the 3′UTR of SFRP4 and TM4SF1 downstream to the luciferase reporter gene. The constructed vectors were co-transfected with miR-203 mimics or inhibitor into the HaCaT cells. The luciferase activity of cells transfected with the miR-203 mimics and SFRP4 was significantly decreased compared with the cells that were transfected with SFRP4 alone, whereas the luciferase activity of cells transfected with miR-203 inhibitor and SFRP4 was significantly increased compared with the cells that were transfected with SFRP4 alone (
To determine the effects of arecoline on EMT in HaCaT cells, the HaCaT cells were treated with a series of increased doses of arecoline for 72 h. Western blotting was used to evaluate the changes in expression of the EMT-related genes, including CK19, E-cadherin, N-cadherin and vimentin. The results showed that CK19 expression was significantly decreased with increased concentrations of arecoline; E-cadherin expression was markedly reduced at 0.08 mM; while the expression of N-cadherin and vimentin was significantly upregulated with increasing concentrations of arecoline (
To further analyze the effects of arecoline on miR-203, SFRP4 and TM4SF1 in the HaCaT cells, cells were treated with arecoline alone or co-treated with miR-203 mimics/inhibitor. We found that arecoline significantly decreased the expression of miR-203 compared with the vehicle control, and had a synergistic effect with the miR-203 inhibitor while co-treatment with miR-203 mimics rescued the expression of miR-203 that was decreased by arecoline (
We observed that downregulation of miR-203 mediated by arecoline or co-treatment with the miR-203 inhibitor significantly increased cell proliferation ability in the HaCaT cells compared to the vehicle control cells. Furthermore, we observed that co-treatment of miR-203 mimics and arecoline significantly decreased the upregulation of cell proliferation induced by arecoline (
To explore the potential molecular mechanisms underlying miR-203-induced cell proliferation and EMT, we assessed the expression of CK19, E-cadherin, N-cadherin and vimentin in HaCaT cells. Downregulation of miR-203 induced by arecoline or miR-203 inhibitor significantly downregulated the expression of CK19 and E-cadherin proteins compared to these levels in the vehicle control cells, whereas it significantly upregulated the expression of N-cadherin and vimentin. Reversal of the downregulation of miR-203 in the arecoline-treated cells by miR-203 mimic transfection significantly upregulated the expression of CK19 and E-cadherin proteins compared to these levels in the vehicle control cells, whereas it significantly downregulated the expression of N-cadherin and vimentin (
miRNAs have been implicated in inflammation, fibrosis, EMT and various types of cancers, such as oral cancer. Some miRNA families have gained attention for their clear function in tissue fibrosis. miR-30c has been reported to be a tumor suppressor in endometrial cancer (
In the present study, we found that the expression of miR-203 was significantly upregulated in all 6 OSF tissues, whereas upregulated expression of miR-206 and miR-30c was observed in 2 and 5 cases, respectively. Collectively, we therefore focused on the role of miR-203 in EMT of HaCaT cells for further analysis. We also found that SFRP4 was increased, while TM4SF1 was significantly decreased in OSF tissues at the mRNA and protein levels compared with that in the normal tissues. By dual luciferase report assay, we demonstrated that miR-203 negatively regulated SFRP4 and positively regulated TM4SF1 at the transcriptional levels. Secreted frizzled related protein (SFRP) proteins are characterized by a frizzled-like cysteine-rich domain and form a family of soluble proteins (SFRP1-5) (
CK19 is expressed exclusively by epithelial cells and derived cancers (
In conclusion, the present study provides evidence that miR-203 plays a critical role in arecoline-induced OSF by regulating the process of EMT, at least partially, via targeting SFRP4 and TM4SF1. Thus, miR-203 may be a target for the prevention and therapy of OSF.
This study was supported by the National Natural Sciences Foundation of China (no. 81260166, 81041052 and 30572044).
Expression of miR-206, miR-30c, miR-203, SFRP4 and TM4SF1 in OSF tissues and normal oral mucosa tissues. qPCR was utilized to detect the expression of (A) miR-206, (B) miR-30c, (C) miR-203, (D) SFRP4 and (E) TM4SF1 in OSF tissues and normal oral mucosa tissues. (F) Western blotting was used to analyze the expression of SFRP4 and TM4SF1 protein in OSF and normal oral mucosa tissues and quantification was carried out for (G) SFRP4 and (H) TM4SF1. Data are expressed as the means ± SD. *P<0.05, **P<0.01, ***P<0.001. SFRP4, secreted frizzled-related protein 4; TM4SF1, transmembrane-4 L six family member 1; OSF, oral submucous fibrosis.
miR-203 negatively regulates SFRP4 and positively regulates TM4SF1. (A) The luciferase activity in cells transfected with SFRP4 3′UTR was decreased by the miR-203 mimics, whereas increased by miR-203 inhibitor. (B) The luciferase activity in cells transfected by TM4SF1 3′UTR was increased by miR-203 mimics, whereas decreased by miR-203 inhibitor. qPCR was used to detect the expression of (C) miR-203, (D) SFRP4 and (E) TM4SF1 mRNA after transfection with miR-203 mimic, miR-203 inhibitor or NC. Data shown are means ± SD, *P<0.05, **P<0.01, ***P<0.001. SFRP4, secreted frizzled-related protein 4; TM4SF1, transmembrane-4 L six family member 1.
Arecoline affects expression of epithelial-mesenchymal transition-related genes in a dose-dependent manner. Expression of epithelial-mesenchymal transition-related genes (CK19, E-cadherin, N-cadherin and vimentin) in HaCaT cells was determined by western blotting and the results were quantified. Data shown are means ± SD, *P<0.05, **P<0.01, ***P<0.001. CK19, cytokeratin 19.
Effects of arecoline and miR-203 on SFRP4 and TM4SF1 in the HaCaT cells. qPCR was used to detect the expression of (A) miR-203, (B) SFRP4 mRNA and (C) TM4SF1 mRNA. (D) Western blotting was used to detect the expression of SFRP4 and TM4SF1 and the results were quantified. Data shown are means ± SD, *P<0.05, **P<0.01, ***P<0.001; #P<0.05, ##P<0.01, ###P<0.001. SFRP4, secreted frizzled-related protein 4; TM4SF1, transmembrane-4 L six family member 1.
Effects of arecoline and miR-203 on HaCaT cells. (A) CCK-8 cell proliferation assay was used to evaluate cell proliferation. Data are expressed as 450 nm optical density in the different groups. (B and C) Expression of epithelial-mesenchymal transition-related genes (CK19, E-cadherin, N-cadherin and vimentin) in the HaCaT cells was determined by western blotting and quantified. Data shown are means ± SD, *P<0.05, **P<0.01, ***P<0.001; #P<0.05, ##P<0.01. CK19, cytokeratin 19.