In the present study, 38 pairs of papillary thyroid cancer and adjacent normal thyroid specimens were obtained from the Department of Breast and Thyroid Surgery of the Shanghai Tenth People’s Hospital and approved by the Institutional Ethics Committee of the Shanghai Tenth People’s Hospital (no. SHSy-ieC-pap-15-1). Each patient provided written informed consent. The samples were immediately snap-frozen in liquid nitrogen. The specimens were pathologically confirmed as papillary thyroid carcinoma. No patients had received any chemotherapy or radiotherapy prior to surgery.

The human TPC-1, BCPAP, K1 and NPA PTC cell lines, human normal thyroid cell line (Nthy-ori 3-1) and HeK293T cells were purchased from the Chinese Academy of Sciences (Shanghai, China). TPC-1, K1, NPA and Nthy-ori 3-1 cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) (both from Gibco, Carlsbad, CA, USA), penicillin (100 U/ml) and streptomycin (100 µg/ml) (Enpromise, China). BCPAP and HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) supplemented with 10% FBS, 1% penicillin and 1% streptomycin. The cells were incubated at 37°C with 5% CO₂ in saturated humidity.

miR-183 mimics, inhibitors, PDCD4 siRNA or their negative control (NC) were purchased from GenePharma (Shanghai, China). The TPC-1 cells were cultured to 30–40% confluence in 6-well plates (BD Biosciences, Franklin Lakes, NJ, USA) and were transfected with miR-183 mimics, miR-183 inhibitors, PDCD4 siRNA or their NC at working concentrations using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. miRNA NC and siRNA NC were used as NCs.

miRNAs were harvested from tissues and cells using a miRcute miRNA Isolation kit (Tiangen, Beijing, China), according to the manufacturer’s instructions. miR-183 expression levels were detected using one-step RT-qPCR (EzOmics SYBR qPCR kit). The miR-183 and U6 primer, and EzOmics SYBR qPCR kit were purchased from Biomics Biotechnologies Inc. (Jiangsu, China). U6 was used as an internal control. The miR-183 stem-loop RT primer used was: 5′-GCGAGCACAGAATTAATACGACTCACTATA GGT-3′; miR-183 5′-TATGGCACTGGTAGAATTCACT-3′ (sense), and 5′-GCGAGCACAGAATTAATACGAC-3′ (antisense); while that of U6 stem-loop RT primer was: 5′-GTC GTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGA CAAAATATGG-3′; U6 5′-TGCGGGTGCTCGCTTCGGC AGC-3′ (sense), and U6 5′-CCAGTGCAGGGTCCGAGGT-3′ (antisense). Briefly, 100 ng RNAs were added to a 25 µl reaction system containing 12.5 µl 2X master mix, 0.5 µl 50X SYBR-Green, 0.5 µl reverse transcription primer (10 µM), 0.5 µl sense and miR-183 primer (10 µM). RT-qPCR was performed on a 7900HT fast RT-PCR instrument (Applied Biosystems, Singapore) using SYBR-Green for fluorophore detection. One-step RT-qPCR parameters were as follows: 37°C for 60 min, 10 min at 95°C, followed by 40 cycles of 20 sec at 95°C, 30 sec at 62°C and 30 sec at 72°C. Each sample was tested three times.

For the detection of PDCD4 mRNA expression, total RNA was isolated from tissues and cells using TRIzol (Invitrogen), and cDNA was generated by reverse transcription using the PrimeScript RT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. The primer (GenePharma) sequences used were: PDCD4 5′-GTTGGC AGTATCCTTAGCATTGG-3′ (sense), and 5′-TCCACATCA GTTGTGCTCATTAC-3′ (antisense); GAPDH 5′-AAGGTC GGAGTCAACGGATT-3′ (sense), and 5′-CTGGAAGAT GGTGATGGGATT-3′ (antisense). GAPDH mRNA levels were used for normalization. The RT-qPCR parameters used were: 2 min at 95°C, and then 40 cycles of 15 sec at 95°C and 30 sec at 60°C. The relative expression was calculated using the relative quantification equation (RQ) = 2^−ΔΔCt (36). Each sample was tested in triplicate.

The transfected cells were seeded in 96-well (1×10³ cells/well) culture plates (BD Biosciences) and incubated at 37°C in 5% CO₂. Cell proliferation was assessed at 24, 48, 72 and 96 h post-transfection using the MTT assay kit (Sigma, Santa Clara, CA, USA) according to the manufacturer’s instructions. Briefly, 20 µl (5 mg/ml) MTT solution was added to each well. After a 4-h incubation, the medium was replaced with 150 µl dimethylsulfoxide (DMSO; Sigma). After 10 min of agitation (100 rpm), the absorbance at 490 nm of each sample was measured by a microplate spectrophotometer (Bio-Tek, Winooski, VT, USA). Experiments were performed in biological triplicate and included six replicates.

The transfected cells were seeded in 6-well (1×10³ cells/well) culture plates (BD Biosciences). Incubation at 37°C with 5% CO₂ for 7–10 days until visible cloning was observed in the dish. Subsequently, the culture medium was removed and the wells were washed twice with phosphate-buffered saline (PBS). The colonies were fixed with 95% ethanol for 10 min, dried and stained with 0.1% crystal violet solution for 10 min. Each plate was then washed three times with running water. Cell colonies with >50 cells were counted and photographed. The experiment was performed three times.

A wound-healing assay was used to evaluate the migratory ability of the transfected cells. The transfected cells were seeded in 6-well plates at 30×10⁵ cells/well, and incubated until the cell monolayer reached 100% confluence. The bottom of the 6-well plates was scratched with a P200 pipette tip. Detached cells were washed with PBS and replaced with fresh medium. The scratch widths were measured at 0 and 48 h using an inverted microscope (50-fold). The experiment was repeated independently three times.

Transwells (Corning, Lowell, MA, USA) with a Matrigel (2 mg/ml)-coated membrane containing 8-mm diameter pores were washed with serum-free RPMI-1640. RPMI-1640 supplemented with 10% FBS was added to the lower chamber and the Transwell filter was placed into 24-well plates. The transfected cells (4×10⁴ cells/Transwell) were plated in the top chamber of in 200 µl serum-free RPMI-1640 with 0.1% BSA. After 18 h incubation at 37°C in 5% CO₂, the cells remaining on the upper membrane surface were removed using a cotton swab. The cells that invaded through the membranes were washed with PBS three times, fixed with 10% formalin and stained with 0.5% crystal violet. Five random fields for each chamber were photographed. To quantify the number of cells that had invaded, the cells were dissolved in 300 µl 33% glacial acetic acid and the absorbance at 573 nm was measured using a microplate spectrophotometer.

An apoptosis assay was used to evaluate cell apoptosis using the Annexin V-FITC/PI apoptosis detection kit (Beyotime, Jiangsu, China). After 48 h transfection, the cells were washed three times with ice-cold PBS, trypsinized and centrifuged. Then, 2.5 µl Annexin V-FITC reagent and 50 µl 1X binding buffer were added to the cell groups. The cells were then incubated in the dark for 15 min at room temperature. Subsequently, 5 µl propidium iodide (PI) and 250 µl 1X binding buffer were added and the cells were incubated in the dark for 5 min at room temperature. The cells were gently resuspended in the Annexin V incubation reagent at a concentration of 10⁵–10⁶ cells/100 µl. The samples were then processed by flow cytometry (FACSCanto™ II; BD Biosciences).

The wildtype 3′-UTR of PDCD4 including predicted miR-183 targeting sites was amplified using PCR amplification using the Primer Star kit (Takara) according to the manufacturer’s instructions. The primers used were: sense, 5′-TAATAAGCTACCTTTTGTAAG GCCATGTTTATTATCTAATCATTCCA-3′ and antisense, 5′-TTGGAATGATTAGATAATAAACATGGCACTTACAA AAGGTAGCTTATT-3′. The mutant constructs were generated by mutation. The mutant and wild-type 3′-UTR fragments were subcloned into the XhoI site in the 3′-UTR of Renilla luciferase of the psiCHeCK-2 reporter vector. The constructed vectors were designated as PDCD4-wt-vector and PDCD4-mut-vector. For the dual-luciferase reporter assays, 293T cells were seeded in 12-well plates (BD Biosciences) and cultured until the cells reached 80–90% confluence. The PDCD4-wt-vector or PDCD4-mut-vector (0.2 µg) were co-transfected with 100 nmol/l miR-183 or miRNA NC using Lipofectamine™ 2000. After 36 h transfection, firefly and Renilla luciferase activities were measured using Dual-Luciferase reporter assay kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The firefly luciferase (FL) activity of each sample was normalized to the Renilla luciferase (RL) activity. All the experiments were performed three times.

The protein expression levels were analyzed by western blot analysis. Forty-eight hours post-transfection, the cells were washed twice with ice-cold PBS, RIPA lysis buffer (Beyotime) was added, and the cells were lysed on ice for 30 min, wiped off, transferred to an EP tube and centrifuged at 12,000 rpm for 30 min at 4°C. The supernatants were collected and protein concentrations were quantified using a BCA protein assay kit (Beyotime). Each sample with 40 µg protein was denatured with 5X sodium dodecyl sulfate (SDS) loading buffer (Beyotime) at 95°C for 5 min. Subsequently, the protein samples were separated by 10% SDS-polyacrylamide gel and transferred onto PVDF membranes (both from Beyotime). The membranes were blocked with 5% fat-free milk for 1 h, and incubated with primary antibodies PDCD4 (1:1,000 dilution; Cell Signaling Technology, Beverly, MA, USA) and β-actin (1:1,000 dilution; sc-1616-R; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) as a loading control overnight at 4°C. The membranes were washed three times with PBST and incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. After washing three times with PBST, immunoreactive protein bands were detected using the Odyssey scanning system (LI-COR, Lincoln, NE, USA).

Data are presented as the means ± standard deviation (SD) from at least three separate experiments. The Student’s t-test (two-tailed) was used to compare the statistical differences between the two groups using SPSS 17.0 (SPSS, Inc., Chicago, IL, USA) statistical software. P<0.05 was considered to indicate statistically significant results.

We first determined the expression levels of miR-183 in papillary thyroid cancer and cell lines by RT-qPCR. As shown in Fig. 1A, the levels of miR-183 showed a 11.59±0.2817-fold higher expression in cancer tissues when compared with the adjacent normal tissues (P<0.05). Similarly in comparison with Nthy-ori 3-1, the papillary thyroid cancer cell lines expressed higher levels of miR-183 (P<0.05; Fig. 1B). These results indicated that miR-183 was upregulated in papillary thyroid cancer and cell lines.

An MTT assay was used to investigate the effects of miR-183 on papillary thyroid cancer cell proliferation. TPC-1 cells were treated with 50 and 100 nM miR-183 mimics, miR-183 inhibitor or miRNA NC for 24, 48, 72 and 96 h and the absorbance was measured at 490 nm. As shown in Fig. 2A, the upregulation of miR-183 significantly increased the growth rate of TPC-1 cells in a dose- and time-dependent manner (P<0.05). Moreover, the viability of miR-183 inhibitor groups was consistently significantly lower than that of the miRNA NC groups (P<0.05, Fig. 2B). Cell proliferation was markedly enhanced or inhibited when cells were treated with 100 nM miR-183 mimics or inhibitor for 72 h at a growth rate of 22.32 and 34.7% (P<0.05) (Fig. 2A and B). Thus, 100 nm was used in the subsequent experiments. Increased and decreased colony formation was observed in the miR-183 and miR-183 inhibitor groups as compared to the miRNA NC group (Fig. 2D). The number of colonies for each group is shown in Fig. 2C. The clone formation of the miRNA NC group (258.3±20.69) was significantly higher than that of the miR-183 inhibitor group (88.5±6.18) and lower than that of the miR-183 mimics group (390.3±15.45) (P<0.05). The results confirmed that miR-183 promotes TPC-1 cell proliferation.

The wound-healing and Transwell invasion assays were used to determine whether miR-183 overexpression promotes tumor aggression. As shown in Fig. 3, the cells transfected with miRNA NC migrated slower than miR-183 mimics but more rapidly than the miR-183 inhibitor. The result of the Transwell assay (Fig. 4A) showed that the number of TPC-1 cells transfected with miR-183 mimics to the lower chamber markedly increased compared with miRNA NC, whereas the number of miR-183 inhibitors markedly decreased compared with miRNA NC. The quantification results (Fig. 4B) confirmed the results observed by inverted microscopy. The OD values at 573 nm were: miR-183 mimics group (0.8347±0.01431), miRNA NC group (0.6327±0.01581) and miR-183 inhibitor group (0.4113±0.01004) (P<0.05). The results indicated that the overexpression of miR-183 promoted TPC-1 cell migration and invasion.

To examine whether miR-183 inhibited the apoptosis of papillary thyroid cancer cells, TPC-1 cells were transfected with 100 nmol/l of miR-183 mimics, miRNA NC and miR-183 inhibitor for 36 h. Flow cytometry data (Fig. 5) showed that the number of apoptotic cells was reduced in the miR-183 mimics group (Q2+Q4=1.5±0.06% apoptotic cells) compared to the miRNA NC group (Q2+Q4=5.1±0.08% apoptotic cells) (P<0.05). However, the number of apoptotic cells in the miR-183 inhibitor group (Q2+Q4=7.8±0.07% apoptotic cells) was markedly increased (P<0.05). These results indicated that miR-183 inhibited apoptosis in TPC-1 cells.

To determine whether PDCD4 is a direct target of miR-183, the 3′-UTR of PDCD4 mRNA containing the miR-183 binding sites and the mutant were cloned into a luciferase reporter construct. The luciferase reporter assay (Fig. 6B) showed that the relative luciferase activity (RL/FL) of miR-183 mimics co-transfection of the PDCD4-wt-vector group was significantly decreased compared with the NC. However, this effect of miR-183 was abolished following the co-transfection of PDCD4-mut-vector. These results indicated that PDCD4 is a direct target of miR-183.

To determine the relationship between miR-183 and PDCD4 at the mRNA and protein levels, miR-183 mimics, inhibitors or miRNA NC (100 nmol/l) were transfected into TPC-1 cells, and the levels of PDCD4 mRNA and protein were monitored. The RT-qPCR analysis showed that PDCD4 mRNA levels were not significantly altered during these treatments (Fig. 7A). However, western blot analysis revealed that compared to the controls, the expression of PDCD4 was significantly reduced by miR-183 mimics transfection and increased by miR-183 inhibitor transfection (Fig. 7B). The results indicated that miR-183 did not affect mRNA stability and regulated PDCD4 expression at the post-transcriptional level.

To determine whether PDCD4 serves as a critical mediator of the role of miR-183 in PTC cells, PDCD4 and NC siRNAs were transfected into TPC-1 cells. As shown in Fig. 8H, the protein level of PDCD4 was decreased in TPC-1 cells transfected with PDCD4 siRNA compared with NC siRNA. In the MTT assay, compared with the NC siRNA group, the PDCD4 siRNA group markedly increased cell proliferation by 33.4, 65.4 and 44.4% at 48, 72 and 96 h, respectively (P<0.05; Fig. 8A). Moreover, cell colony formation efficiency increased in the PDCD4 siRNA group (P<0.05 Fig. 8B and C). Knockdown of PDCD4 promoted the migration and invasion ability of TPC-1 cells (P<0.05; Fig. 8D, E and G). The apoptosis assay demonstrated knockdown of PDCD4 decreased TPC-1 cell apoptosis by 90% at 36 h after transfection (Fig. 8F). These data indicated that effects of siRNA versus PDCD4 were similar to those induced by miR-183 in TPC-1 cells, rendering PDCD4 as a functional target of miR-183.