MCF-7 was purchased from ATCC (Manassas, VA, USA). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics at 37°C in a 5% CO₂ incubator. Reversine and Aurora kinase inhibitor were obtained from Calbiochem (St. Louis, MO, USA). VX-680 was purchased from Selleck (Houston, TX, USA). 12-O-tetradecanoylphorbol-13-acetate (TPA), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), dimethylsulfoxide (DMSO) and anti-β-actin antibodies were obtained from Sigma (St. Louis, MO, USA). Primary antibodies against Aurora kinase A and B, phosphorylated (p)-Aurora kinase A, p-Aurora kinase B, p-IκBα, p-c-Jun, p38, p-p38, JNK, p-JNK, ERK and p-ERK were purchased from the Cell Signaling Technology (Beverly, MA, USA). Antibodies against MMP-9, IκBα, p65, PCNA and horseradish peroxidase (HRP)-conjugated IgG were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). DMEM, FBS and phosphate-buffered saline (PBS) were obtained from Gibco-BRL (Gaithersburg, ME, USA). Ninety-six-well plates, 6-well plates, 6 and 10 cm dishes were purchased from SPL Life Sciences (Pocheon, Gyeonggi, Korea). Matrigel was purchased from BD Biosciences (Bedford, MA, USA).

A cell viability assay was performed using an MTT assay. Briefly, the cells were seeded at a density of 3ⅹl0⁴ cells/well and allowed to attach to the plate surface. After 24 h, the cells were treated with Aurora kinase inhibitors. After incubation for an additional 24 h, the cells were washed with PBS, treated with MTT (0.5 mg/ml PBS) and incubated at 37°C for 30 min. Formazan crystals were dissolved with DMSO (100 µl/well) and detected at 570 nm using a microplate reader (Model 3550; Bio-Rad, Richmond, CA, USA).

The cells were lysed with an ice-cold M-PER^® Mammalian Protein Extraction reagent (Pierce Biotechnology, Rockford, IL, USA). The protein concentration of each lysate was determined using the Bradford assay (31). Samples (20 µg) were resolved by electrophoresis on 10% acrylamide gel, and transferred electrophoretically to Hybond™-PVDF membranes. The membranes were blocked with 5% bovine serum albumin or 5% skim milk and subsequently incubated overnight with primary antibodies (1 µg/ml), followed by incubation with secondary antibodies (HRP-conjugated anti-IgG). ECL reagents (GE Healthcare) were used as substrates for the detection of peroxidase.

The procedure for a gelatin zymography assay was performed as previously described (32).

Total RNA was extracted from cells using a FastPure™ RNA kit (Takara, Shiga, Japan). cDNA was synthesized from 1 µg total RNA using a PrimeScript™ RT reagent kit (Takara). The mRNA levels were determined by quantitative PCR using the ABI PRISM 7900 sequence detection system and SYBR-Green (Applied Biosystems, Foster City, CA, USA). Aurora kinase A and B, and 18S primers were purchased from SABiosciences (Qiagen Inc., Valencia, CA, USA). The primers used were: MMP-9 (NM 004994) sense, CCTGGAGACCTGAGAACCAATCT and antisense, CCA CCCGAGTGTAACCATAGC; and GAPDH (NM 002046) sense, ATGGAAATCCCATCACCATCTT and antisense, CGCCCCACTTGATTTTGG. To control for variation in mRNA concentration, the results were normalized to the housekeeping gene, GAPDH or 18S. Relative quantification was performed using the comparative Ct method according to the manufacturer’s instructions.

Cells were washed twice, scraped into 1.5 ml of ice-cold PBS (pH 7.5) and pelleted at 3,000 rpm for 3 min. Cytosol and nuclear extracts were prepared from cells using the NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology). Activation of AP-1 and NF-κB was analyzed by a gel mobility shift assay using nuclear extracts. Oligonucleotides containing the κ-chain (κB, 5′-CCGGTTAACAGAGGGGGCTTTCCGAG-3′) and AP-1 (5′-CGCTTGATGAGTCAGCCGGAA-3′) binding site were synthesized and used as probes for the gel retardation assays. Complementary strands were annealed and labeled with [α-³²P]dCTP. Labeled oligonucleotides (10,000 cpm), 10 µg of nuclear extracts and binding buffer [10 mM Tris-HCl, pH 7.6, 500 mM KCl, 10 mM EDTA, 50% glycerol, 100 ng poly(dI•dC), 1 mM DTT] were then incubated for 30 min at room temperature in a final volume of 20 µl. Reaction mixtures were analyzed by electrophoresis on 4% polyacrylamide gels in a 0.5X Tris-borate buffer (pH 8.3). The gels were dried and examined by autoradiography. Specific binding was demonstrated through competition with a 50-fold excess of cold κB or AP-1 oligonucleotide.

The invasion assay was carried out in 24-well chambers (8-µm pore size) coated with Matrigel diluted in DMEM (52 µl/cm² of growth surface) according to the manufacturer’s instructions (BD Biosciences). Matrigel coating was re-hydrated in 0.5 ml DMEM for 30 min immediately prior to experiments. Cells (2×10⁵) were added to the upper chamber and chemoattractant was added to the bottom well. Conditioned medium (0.5 ml) was added to the lower compartment of the invasion chamber. After 24 h incubation, the cells on the upper side of the chamber were removed using cotton swabs, and migrated cells were fixed and stained with toluidine blue solution. Invading cells were counted in five random areas of the membrane with the assistance of a light microscope.

The migration assay was carried out in 24-well chambers (8-µm pore size). Cells (2×10⁵) were added to the upper chamber and chemoattractant was added to the bottom well. Conditioned medium (0.5 ml) was added to the lower compartment of the chamber. After a 24-h incubation, the cells on the upper side of the chamber were removed using cotton swabs, and migrated cells were fixed and stained with toluidine blue solution. Invading cells were counted in five random areas of the membrane with the assistance of a light microscope.

Aurora kinase-specific small interfering RNA (siRNA) and negative control siRNA were purchased from Bioneer (Daejeon, Korea). Transfection of MCF-7 cells was performed according to the manufacturer’s instructions (Amaxa GmbH, Cologne, Germany). Briefly, cells (3×10⁵) were collected and re-suspended in 100 µl of MCF-7 nucleofector solution. The cell suspensions were mixed with 100 pmol siRNA, placed in a sterile electroporation cuvette, and subjected to program P-020 with the Nucleofector II (Amaxa GmbH).

miR RNAi Aurora kinase A and B lentiviral vectors were produced using the BLOCK-iT™ Pol II miR RNAi Expression system protocol (Invitrogen, Carlsbad, CA, USA). Single-stranded DNA oligos (Aurora kinase A and B) were created by the BLOCK-iT™ RNAi Express system (Invitrogen). As a control, LacZ Oligo sequences were provided by the RNAi expression system kit. Lentivirus was produced by the ViraPower™ Lentiviral Expression systems protocol (Invitrogen).

Data are presented as means ± SE from three individual experiments performed in triplicate replicates. Statistical data analysis was performed using one-way ANOVA program and Student’s t-test. Differences with p<0.05 were considered to indicate a statistically significant result.

Previous studies have shown that PKC strongly induces invasion in MCF-7 cells (33,34). To examine whether PKC activates Aurora kinases or regulates the expression of these kinases, we determined levels of phosphorylated Aurora kinases (p-AURKs) and total protein levels of the kinases using MCF-7 cells as a model system. As shown in Fig. 1A and B, treatment of cells with TPA, a PKC activator, increased the levels of total protein and phosphorylation of AURKA and AURKB in a time-dependent manner. The phosphorylation of AURKA and AURKB was constantly increased for 24 h (Fig. 1C). Furthermore, we confirmed that AURKA and B activation is dependent on PKC using PKC inhibitor (Fig. 1D).

To investigate the molecular basis of the TPA-induced activation of Aurora kinases, MCF-7 cells were pretreated with various pharmacological inhibitors of cell signaling pathways, including MAPK, NF-κB and phosphatidylinositol 3-kinase (PI3K). The TPA-induced phosphorylation (Aurora kinase A, Th288; Aurora kinase B, Th232) of Aurora kinases A and B was abrogated by MAPK inhibitors (Fig. 2A). TPA upregulated total protein levels of Aurora kinases were blocked by MAPK inhibitors (Fig. 2B). By contrast, NF-κB and PI3K inhibitors did not block the TPA-induced phosphorylation/upregulation of Aurora kinase A and B expression (Fig. 2C and D). These results indicated that TPA induces the phosphorylation of Aurora kinases through a MAPK-mediated pathway in MCF-7 cells.

To examine whether AURKs are involved in the invasion of MCF-7 cells, we used Aurora kinase inhibitors (reversine and VX-680) and AURK A- and B-specific siRNAs. Treatment of cells with TPA significantly increased the invasion/migration of MCF-7 cells compared to that of control cells. The TPA-induced increase of cell invasion/migration was significantly reduced by pretreatment with the inhibitors of Aurora kinases (Fig. 3A). Supporting the results, transfection of cells with Aurora kinase A or B specific siRNA also reduced the TPA-induced invasion of cells (Fig. 3B).

MMP-9 is a key enzyme for degrading type IV collagen, which is a major component of the basement membrane, therefore MMP-9 plays a critical role in cancer cell invasion. Treatment of MCF-7 cells with the Aurora kinase inhibitors did not lead to a significant change in cell viability, as measured by the MTT assay at the indicated concentrations and incubation lengths (Fig. 4A). To determine whether Aurora kinases are involved in TPA-induced MMP-9 expression, MCF-7 cells were pretreated with Aurora kinase inhibitors for 1 h and then additionally treated with TPA for 24 h. As shown in Fig. 4B, treatment of MCF-7 cells with TPA significantly increased MMP-9 expression and secretion. The TPA-induced upregulation of MMP-9 expression and secretion in MCF-7 cells was significantly suppressed by pretreatment with Aurora kinase inhibitors. RT-PCR analysis revealed that TPA increased the levels of MMP-9 mRNA in MCF-7 cells and that Aurora kinase inhibitors blocked the TPA-induced upregulation of MMP-9 mRNA expression (Fig. 4C). To confirm the result, we performed siRNA-mediated gene silencing of Aurora kinases in MCF-7 cells. As shown in Fig. 4D, transfection of MCF-7 cells with Aurora kinase A- and B-targeting siRNA markedly reduced the protein levels of Aurora kinases. The siRNA-mediated silencing of Aurora kinase A and B markedly decreased TPA-mediated increases in MMP-9 mRNA expression and protein levels (Fig. 4E and F). To determine the off-target effect, infected MCF-7 cells by miR RNAi-AURK A and B lentivirus were treated with TPA. The TPA-induced upregulation of MMP-9 expression in MCF-7 cells was significantly suppressed by miR RNAi-AURK A and B lentivirus (Fig. 4G and H). These results indicated that Aurora kinases serve as one of the underlying mechanisms for PKC-induced MMP-9 expression.

The MMP-9 promoter has been reported to contain NF-κB and AP-1 binding sites. These transcription factors are centrally involved in the induction of MMP-9 gene expression by TPA (27,32). Therefore, we examined whether the Aurora kinase-mediated upregulation of MMP-9 expression was nvolved NF-κB or AP-1. MCF-7 cells were pretreated with Aurora kinase inhibitors for 1 h and then treated with TPA (100 nM) for 3 h, and the nuclear extracts were analyzed by EMSA. As shown in Fig. 5A and B, NF-κB and AP-1 DNA binding activities were markedly increased by TPA. The TPA-induced increases of DNA binding were significantly blocked by Aurora kinase inhibitors. Additionally, the nuclear translocation of the p65 subunit of NF-κB and the phosphorylation status of c-Jun a subunit of AP-1 were analyzed by western blotting (Fig. 5C). Activation of NF-κB is known to be regulated by IκBα phosphorylation and degradation (33,35). Therefore, we examined the effect of Aurora kinase inhibitors on the TPA-induced phosphorylation and degradation of IκBα by western blotting. As shown in Fig. 5C Aurora kinase inhibitors suppressed the TPA-induced phosphorylation and degradation of IκBα. Moreover, in Aurora kinase A and B knockdown cells, NF-κB and AP-1 DNA binding activities, the nuclear translocation of p65 and degradation of IκBα and phosphorylation of c-Jun by TPA were significantly blocked (Fig. 5D–F, respectively).