Polyclonal antibodies to cyclin E, CDK2, CDK6, cyclin D1, p53, p21^WAF1, p27^KIP1 and GAPDH were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The polyclonal MMP-2 antibody was obtained from Chemicon International (Billerica, MA, USA). miR-20b (5′-CAAAGUGCUCAUAGUGCAGGUAG-3′) and miR-20b inhibitor were designed and synthesized by Genolution (Seoul, Korea).

Human bladder carcinoma cell lines (EJ, 5637 and T24) were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). The cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (4.5 g glucose/liter) supplemented with 10% fetal calf serum, L-glutamine and antibiotics (Biological Industries, Beit Haemek, Israel) at 37°C in a 5% CO₂ humidified incubator. Normal human urothelial cells (HUCs) were obtained from ScienCell Research Laboratories (Carlsbad, CA, USA). The cells were cultured in urothelial cell medium supplemented with urothelial cell growth supplement and penicillin/streptomycin solution according to the protocol of the manufacturer.

To quantify miRNA expression, real-time PCR amplification was subjected to a Rotor-Gene™ 6000, as previously described (25). Real-time PCR assays were carried out in microreaction tubes (Corbett Research, Mortlake, Australia) using a miScript PCR Starter kit (Qiagen Korea, Seoul, Korea). For amplification of the target miRNAs, forward primers for miR-20b (5′-CAAAGUGCUCAUAGUGCAGGUAG-3′) were designed. The PCR reaction was performed in a final volume of 20 μl (10 μl 2X QuantiTect SYBR-Green PCR Master Mix, 2 μl 10X miScript Universal Primer, 2 μl 10 pmol forward primer, 2 μl template cDNA and RNase-free water). Real-time PCR conditions were as follows: one cycle of initial activation for 15 min at 95°C, followed by 50 cycles of 15 sec at 94°C for denaturation, annealing for 30 sec at 55°C and extension for 30 sec at 70°C. The melting program was performed at 70–99°C at a heating rate of 1°C/5 sec. Spectral data were captured and determined using Rotor-Gene Real-Time Analysis Software 6.0 Build 14. All of the reactions were carried out in triplicate. In this experiment, U6 was used as a control for the normalization of the real-time PCR results in miRNA quantification studies using the miScript PCR system.

In order to identify the potential targets of miR-20b, we used the miRanda (http://www.microrna.org/microrna/home.do) algorithm to search the human genome based on an NCBI mRNA database (http://www.ncbi.nlm.nih.gov/) for signaling pathway annotation and putative functional annotation.

Cell proliferation was analyzed using a modification of the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphe-nyltetrazolium bromide (MTT) assay, which is based on the conversion of tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2-tetrazolium to a formazan product by mitochondrial dehydrogenase (26). The formazan product was determined by quantifying its absorbance at 490 nm. The morphology of cell proliferation was photographed using phase-contrast microscopy.

Cells were transfected with miR-20b and the miR-20b inhibitor using Lipofectamine 2000 transfection reagent according to the manufacturer's protocol (Invitrogen). After transfection for the indicated times, the cells were studied via MTT assay, immunoblotting, zymography, electrophoretic mobility shift assay (EMSA), and invasion and wound-healing migration assays.

Cells were harvested and fixed in 70% ethanol. After washing the cells with ice-cold phosphate-buffered saline (PBS), they were incubated with RNase (1 mg/ml), DNA intercalating dye and propidium iodide (50 mg/ml). The analysis of cell cycle distribution was determined by a Becton-Dickinson FACStar flow cytometer equipped with Becton-Dickinson Cell Fit software.

After transfection for 48 h, the cells were rinsed twice with ice-cold PBS and freeze-thawed in 250 μl lysis buffer [containing, in mmol/l, HEPES (pH 7.5) 50, NaCl 150, EDTA 1, EGTA 2.5, DTT 1, β-glycerophosphate 10, NaF 1, Na₃VO₄ 0.1 and phenylmethylsulfonyl fluoride 0.1 and 10% glycerol, 0.1% Tween-20, 10 μg/ml of leupeptin and 2 μg/ml of aprotinin], and then scraped into 1.5-ml tubes. The lysates were then centrifuged at 12,000 rpm for 20 min at 4°C. The protein concentration of the supernatant was quantified using a Bradford reagent method (Bio-Rad). Cellular proteins were electrophoresed on a 0.1% SDS-10% polyacrylamide gel (SDS-PAGE) under denaturing conditions and transferred to nitrocellulose membranes (Hybond, Amersham Corp.). The blots were blocked in 10 mmol/l Tris-HCl (pH 8.0), 150 mmol/l NaCl and 5% (wt/vol) non-fat dry milk and then the membranes were incubated with primary antibodies at 4°C overnight, which was followed by incubation with peroxidase-conjugated secondary antibodies for 90 min, followed by visualization of the immunocomplexes using a chemiluminescence reagent kit (Amersham Corp.). The experiments were repeated at least 3 times.

Cell lysates were prepared using an ice-cold lysis buffer [containing, in mM/l, HEPES (pH 7.5) 50, NaCl 150, EDTA 1, EGTA 2.5, DTT 1, β-glycerophosphate 10, NaF 1, Na₃VO₄ 0.1 and phenylmethylsulfonyl fluoride 0.1 and 10% glycerol, 0.1% Tween-20, 10 μg/ml of leupeptin and 2 μg/ml of aprotinin) and were sonicated at 4°C [Micro Ultrasonic cell disrupter (from Kontes], at 30% power, 2 times for 10 sec, each time. After centrifugation at 10,000 × g for 5 min, the lysates were clarified and the supernatants were precipitated by adding protein A-Sepharose beads precoated with saturating amounts of the indicated antibodies at 4°C for 2 h. When monoclonal antibodies were used, protein A-Sepharose was pre-incubated with rabbit anti-mouse immunoglobulin G (Jackson ImmunoResearch Laboratories). The immunoprecipitated proteins on the beads were washed 4 times with 1 ml of lysis buffer and twice with a kinase buffer (containing, in mM/l, HEPES 50, MgCl₂ 10, DTT 1, β-glycerophosphate 10, NaF 1 and sodium orthovanadate 0.1). The final pellet was re-suspended in 25 μl of kinase buffer containing either 1 μg of glutathione S-transferase (GST)-pRb C-terminal (pRb amino acids 769–921) fusion protein (Santa Cruz Biotechnology), or 5 μg of histone H₁ (Life Technologies, Inc.), 20 μM/l ATP and 5 μCi of [γ³²P] ATP (4,500 μCi/mmol; ICN), and were then incubated for 20 min at 30°C with occasional mixing. Twenty-five microliters of 2X concentrated Laemmli sample buffer was added to terminate the reaction, which was then resolved on either 10 or 12.5% SDS-polyacrylamide gels. The migration of histone H₁ or GST-pRb was determined using Coomassie blue staining. Phosphorylated pRb and histone H₁ were visualized (27).

Cells (3×10⁵) were seeded into 6-well plates in 2 ml medium and were grown to 90% confluency. A clear area was damaged with a 2-mm-wide tip. After 3 washes with PBS, the plate was incubated at 37°C in serum-free medium. The migration of cells into the wounded area was analyzed and photographed using an inverted microscope (magnification, ×40).

Invasion assays were performed using an invasion assay kit (Cell Biolabs, USA) according to the manufacturer's instructions. Cells (2.5×10⁴) were re-suspended in serum-free medium and plated in the upper chamber. Medium with 10% FBS was added to the lower portion of the chamber as a chemoattractant. After 24 h of incubation, the cells were allowed to pass through a polycarbonate membrane bearing 8-μm sized pores with a thin layer of an ECM matrix-like material. The cells on the lower surface of the membrane were stained and photographed. The invasive ability of the cells was evaluated using a commercial cell invasion assay kit (Chemicon International).

Culture supernatants were resolved in a polyacrylamide gel containing 1 mg/ml gelatin. The gel was then washed with 2.5% Triton X-100 at room temperature for 2 h, followed by incubation at 37°C overnight in a buffer containing 10 mM CaCl₂, 150 mM NaCl and 50 mM Tris-HCl, pH 7.5. The gel was stained using 0.2% Coomassie blue and photographed on a light box. Areas of gelatinase activity were determined as a clear band in a dark blue field.

After centrifugation, the cell pellets were re-suspended in 1 ml of buffer A containing 10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT and 0.5 mM PMSF. They were then incubated on ice for 15 min and vortexed in the presence of 0.5% Nonidet NP-40. The pellets were centrifuged and extracted in 1 ml of buffer B containing 20 mM HEPES pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT and 1 mM PMSF for 15 min at 4°C. Protein concentrations were measured via the Bio-Rad protein assay.

The nuclear extract (10–20 μg) was pre-incubated at 4°C for 30 min with the 100-fold excess of an unlabeled oligonucleotide spanning the MMP-2 cis-element of interest. The sequences were as follows: Sp-1, GCCCATTCCTTCCGCCCCCAGATGAAGCAG; ATF2, GATCCAGCTTGATGACGTCAGCCG. The reaction mixture was then further incubated at 4°C for 20 min in a buffer (25 mM HEPES buffer pH 7.9, 0.5 mM EDTA, 0.5 mM DTT, 0.05 M NaCl and 2.5% glycerol) with 2 μg of poly(dI-dC) and 5 fmol (2×10⁴ cpm) of a Klenow end-labeled (³²P-ATP) 30-mer oligonucleotide, which corresponded to the DNA binding site in the MMP-2 promoter. The reaction mixture was electrophoresed at 4°C on a 6% polyacrylamide gel using a TBE (89 mM Tris, 89 mM boric acid and 1 mM EDTA) running buffer. The gel was washed dried and exposed to X-ray film overnight (27).

Where appropriate, data are expressed as the mean ± SE. Data were evaluated by factorial ANOVA and a Fisher's least significant difference test where appropriate. Statistical significance was set at P<0.05.

To examine the expression level of miR-20b in bladder cancer cell lines, 3 types of bladder cancer cell lines (EJ, T24 and 5637) and normal HUCs were employed using quantitative real-time PCR. As shown in Fig. 1A, compared with the HUCs, the expression levels of miR-20b were significantly downregulated in all 3 examined bladder cancer cell lines (EJ, T24 and 5637). Since miR-20b expression was decreased in the EJ cells, we selected this cell line for further investigation. Next, to investigate the function of miR-20b in the proliferation of the EJ cells, the cells were transfected with Lipofectamine 2000 only (control), miR-20b mimics (miR-20b) or a negative control (miR-20b inhibitor) at various concentrations (30–100 nM). Overexpression of miR-20b significantly reduced the proliferation of the EJ cells within 48 h, as evidenced by the MTT assay (Fig. 1B). The different concentrations of miR-20b (30–100 nM) showed almost the same antiproliferative effect in the EJ cells (Fig. 1B). Based on this observation, 30 nM of miR-20b was used for the subsequent experiments. Similar results were confirmed by phase-contrast images (Fig. 1C).

Flow cytometric analysis was used to investigate whether the miR-20b-mediated inhibition of cell proliferation was due to the modulation of the cell cycle. After transfection of miR-20b (30 nM) into the EJ cells for 48 h, DNA content analysis was analyzed. Cell cycle distribution analysis demonstrated that the miR-20b (30 nM)-transfected cells induced a significant accumulation of cells in the G1 phase (Fig. 2A–D). In addition, the G1 phase cell cycle arrest was followed by a corresponding decrease in the population of the S phase population in the presence of miR-20b (Fig. 2A–D). To verify whether the observed G1 phase cell cycle arrest of miR-20b transfectants was involved in the regulation of the cell cycle machinery, the levels of cell cycle-regulatory molecules were examined. First, we used bioinformatics analysis from the public miRNA database (miRanda, http://www.microrna.org/microrna/home.do) to identify the targets of miR-20b. We found that miR-20b targeted G1 phase cell cycle regulators, including cyclin D1, CDK2 and CDK6 (Fig. 3E). Immunoblot analysis indicated that the overexpression of miR-20b resulted in decreased expression of cyclin D1, CDK2 and CDK6 (Fig. 3A). However, the expression level of cyclin E was not changed in the miR-20b-transfected cells (Fig. 3A). The kinase activities of the CDKs are an essential step in the formation of the cyclin/CDK complexes, which result in the cell cycle progression through sequential checkpoints (8,9). Therefore, we evaluated the effect of miR-20b on the kinase activities associated with CDK2 or CDK6. The transfection of miR-20b into the EJ cells suppressed the kinase activities of both CDK2 and CDK6 immunoprecipitates (Fig. 3C).

The effect of miR-20b on CDK inhibitors (CKIs), which blocks the progression of the G1 to the S phase of the cell cycle (8) was investigated. Immunoblot analysis indicated that miR-20b overexpression stimulated the induction of p21^WAF1 in the EJ cells (Fig. 3B). However, the expression levels of another CKI p27^KIP protein and tumor-suppressor p53 protein were not altered in the miR-20b-transfected cells (Fig. 3B). An immunoprecipitation experiment was employed to further investigate whether the suppression of cyclin/CDK complexes induced by miR-20b was due to the interaction between p21^WAF1 and CDKs. Immunoprecipitated levels of both p21^WAF1/CDK2 and p21^WAF1/CDK6 were increased in the miR-20b-transfected cells (Fig. 3D). These results indicated that p21^WAF1 plays an important role in miR-20b-mediated G1 phase cell cycle arrest inhibiting CDK activities in bladder cancer EJ cells.

Next, we examined the role of miR-20b in the migration and invasion of bladder cancer EJ cells using a wound-healing migration assay and a Boyden chamber invasion assay. As shown in Fig. 4A, the transfection of miR-20b into EJ cells inhibited cell migration into the wounded areas within 48 h and caused a significant decrease in the wound-closure rate compared with both the control and miR-20b inhibitor transfectants. Consistently, the overexpression of miR-20b showed a significant reduction in invasiveness through Matrigel-coated plates by comparison with either the control or miR-20b inhibitor-transfected cells (Fig. 4B). These results demonstrated that the overexpression of miR-20b inhibited the migration and invasion of bladder cancer EJ cells.

To identify the potential target genes for the inhibition of cell migration and invasion induced by miR-20b, we used miRNA target prediction miRanda algorithms. Since the expression of MMP-2 is known to be involved in regulating the migration and invasion of tumor cells (10,11), we focused on MMP-2 as a potential predicted target gene (Fig. 5C). We next examined the expression of MMP-2 in the miR-20b-transfected cells. Gelatin zymography assay showed that the transfection of miR-20b into EJ cells resulted in an apparent reduction in MMP-2 expression (Fig. 5A). Furthermore, overexpression of miR-20b markedly inhibited the expression level of MMP-2 protein in the EJ cells as determined by immunoblot analysis (Fig. 5A). In addition, we found that miR-20b potentially targets the transcription factors Sp-1 and ATF2, which are involved in the regulation of MMP-2 in tumor cells (15), using bioinformatics analysis of the miRNA target prediction (Fig. 5C). To further investigate whether the inhibitory effect of miR-20b on MMP-2 expression involves the potential target genes Sp-1 and ATF2, an EMSA assay was performed. Nuclear extracts from the miR-20b-transfected cells showed decreased activation of the Sp-1 binding motif (Fig. 5B). However, no specific binding activity of ATF2 was observed in the miR-20b transfectants (Fig. 5B). These results suggested that the activation of Sp-1 binding is involved in the miR-20b-induced inhibition of MMP-2 expression in bladder cancer EJ cells.