OS cell lines, Saos-2, U-2OS, HOS and MG-63, and normal osteoblast cell line NHOst, were obtained from the American Type Culture Collection (ATCC; Rockville, MD, USA). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS) (both from Life Technologies, Carlsbad, CA, USA) at 37°C in a humidified incubator containing 5% CO₂.

Total RNA was extracted by using the miRNA isolation kit (Life Technologies) according to the manufacturer's instructions. For detection of miR expression, the miRNA reverse transcription kit (Life Technologies) was used to convert 10 ng of total RNA into cDNA, according to the manufacturer's instructions. Real-time PCR was then performed using an miRNA Q-PCR detection kit (GeneCopoeia, Rockville, MD, USA) on Applied Biosystems 7500 Real-Time PCR system. The U6 gene was used as an internal reference. The primers were: miR-124 forward, TCGGCAGGTAAGGCACGCGGTG and reverse, TCAACT GGTGTCGTGGAGTCGGC; and U6 forward, CTCGCTTC GGCAGCACATATACT and reverse, ACGCTTCACGAATT TGCGTGTC. Expression of mRNA was detected using the standard SYBR-Green RT-PCR kit (Life Technologies) following the manufacturer's instructions. GAPDH was used as an internal reference. The primers were: ROR2 forward, TCCGAACGACCCTTTAGGAC and reverse, TTTAGCCAC CGCACGTTAGG; and GAPDH forward, GGAGCGAGATC CCTCCAAAAT and reverse, GCCATCACGC CACAGTTTC. The PCR cycling conditions used were: 94°C for 3 min followed by 40 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 30 sec. The relative expression was analyzed by the 2^−ΔΔCt method.

Cells were lysed with ice-cold lysis buffer (50 mM Tris-HCl, pH 6.8, 100 mM 2-ME, 2% w/v SDS, 10% glycerol). After centrifugation at 20,000 × g for 10 min at 4°C, proteins in the supernatants were quantified and separated with 10% SDS-PAGE. Then, proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane (Amersham Biosciences, Buckinghamshire, UK), which was then incubated with PBS containing 5% milk overnight at 4°C. The PVDF membrane was then incubated with rabbit anti-ROR2 monoclonal antibody (1:100) or the rabbit anti-GAPDH monoclonal antibody (1:200) (both from Abcam, Cambridge, UK) at room temperature for 3 h, respectively, and then with HRP-linked goat anti-rabbit secondary antibody (Abcam) at room temperature for 1 h. SuperSignal West Pico chemiluminescent substrate kit (Pierce, Rockford, IL, USA) was then used to detect signals according to the manufacturer's instructions. The relative protein expression was analyzed by Image-Pro Plus 6.0 software, represented as the density ratio vs. GAPDH.

Lipofectamine 2000 (Life Technologies) was used to perform cell transfection following the manufacturer's instructions. For functional analysis, Saos-2 and U-2OS cells were transfected with scramble miR and miR-124 mimics (both from Life Technologies), or co-transfected with miR-124 mimics and ROR2 plasmid (Santa Cruz Biotechnology), respectively.

We screened the target genes of miR-124 using TargetScan (http://www.targetscan.org/index.html).

Total cDNA from the cells was used to amplify the 3′-UTR of ROR2, which was then cloned into the pMir-REPORT vector (Life Technologies). Mutations were introduced within the potential seed sequences of the 3′UTR of ROR2 using the QuikChange site-directed mutagenesis kit (Stratagene), changing the seed sequences GUGCCUU into GUAAAUU. Using Lipofectamine 2000, Saos-2 and U-2OS cells were transfected with miR-124 mimics, as well as the pMir-REPORT vectors containing the wild-type or mutant-type of ROR2 3′-UTR, respectively. The pRL-SV40 vector (Promega, Madison, WI, USA) carrying the Renilla luciferase gene was used as an internal control. Luciferase activity was determined after 48 h using the Dual-Glo substrate system and LD400 luminometer (Beckman Coulter, Brea, CA, USA). Data are presented as the ratio of Renilla luciferase to firefly luciferase.

A wound-healing assay was performed to evaluate the cell migratory capacity of OS cells in each group. Briefly, OS cells were cultured to full confluence. Wounds of ~1 mm width were created with a plastic scriber, and cells were washed and incubated in a serum-free medium. Twenty-four hours after wounding, cells were incubated in a medium containing 10% FBS. After 36-h of culture, cells were fixed and observed under a microscope.

Cells in each group were starved in serum-free medium for 24 h, and then resuspended in serum-free medium. The cell suspension was added into the upper chamber, while the lower chamber was filled with base medium containing 10% FBS. After 24-h of incubation, cells attached to the bottom were stained with crystal violet for 20 min, and then washed and dried in air. Invasive cells were observed under a microscope.

Data are expressed as mean ± standard deviation from at least 3 separate experiments. The differences were analyzed using one-way analysis of variance (ANOVA). SPSS 18.0 software was used to perform statistical analysis. A p-value <0.05 were considered to indicate a statistically significant result.

Real-time RT-PCR was used to detect the expression of miR-124 in OS cell lines, U-2OS, HOS, Saos-2 and MG-63, and in the normal osteoblast cell line NHOst. As shown in Fig. 1, the expression of miR-124 was decreased in the OS cell lines compared with the normal osteoblast NHOst cells, suggesting that downregulation of miR-124 may be associated with OS development.

We further studied the role of miR-124 in the regulation of OS cell migration and invasion. As shown in Fig. 2A, the miR-124 level was significantly increased after transfection with the miR-124 mimics in the U-2OS and Saos-2 cells, compared to the control group. We then determined the cell migration by conducting a wound healing assay. The migratory capacity of the OS cells overexpressing miR-124 was significantly decreased compared to the control group, suggesting that miR-124 plays an inhibitory role in OS cell migration (Fig. 2B). After that, we performed a Transwell assay to determine the cell invasive capacity in each group. As shown in Fig. 2C, overexpression of miR-124 significantly suppressed the invasive capacity of Saos-2 and U-2OS cells compared to the control group, indicating that miR-124 plays a suppressive role in mediating OS cell invasion.

According to bioinformatic analysis, ROR2 is a putative target gene of miR-124 (Fig. 3A). However, whether miR-124 directly targets ROR2 has never been previously reported. Therefore, we conducted a luciferase reporter assay to clarify whether miR-124 can bind directly to their seed sequences in the ROR2 3′-UTR. Luciferase activity was significantly decreased in the U-20S and Saos-2 cells co-transfected with the wild-type (WT) ROR2 3′-UTR and miR-124 mimics, but showed no difference in U-20S and Saos-2 cells co-transfected with the mutant-type (MUT) ROR2 3′-UTR and miR-124 mimics, when compared with that in the control group (Fig. 3B), indicating that ROR2 is a direct target gene of miR-124.

We then detected the protein level of ROR2 in OS cell lines, U-2OS, HOS, Saos-2 and MG-63, and in the normal osteoblast cell line NHOst. As shown in Fig. 4A and B, the mRNA and protein levels of ROR2 were significantly increased in the OS cell lines compared to the NHOst cells. As miRs generally play suppressive roles in the regulation of their target expression at post-transcriptional levels, we further determined the effect of miR-124 overexpression or inhibition on the protein level of ROR2 in OS cells. Saos-2 and U-2OS cells were transfected with miR-124 mimics or miR-124 inhibitor, respectively. Transfection with miR-124 inhibitor significantly downregulated the level of miR-124 compared to the control group (Fig. 4C). As shown in Fig. 4D, western blot data demonstrated that overexpression of miR-124 inhibited the protein level of ROR2 in the OS cells when compared to the control group, while inhibition of miR-124 increased the protein level of ROR2 in OS cells, indicating that miR-124 negatively mediates the protein expression of ROR2 in OS cells.

To further clarify whether ROR2 acts as a downstream effector in miR-124-mediated migration and invasion of OS cells, we transfected OS cells with miR-124 mimics, or co-transfected them with miR-124 mimics and the ROR2 plasmid, and then determined the migratory and invasive capacities of the OS cells in each group. As shown in Fig. 5A and B, OS cells co-transfected with miR-124 mimics and ROR2 plasmid showed higher migratory and invasive capacities, when compared with the OS cells transfected with miR-124 mimics, suggesting that ROR2 is involved in miR-124-mediated migration and invasion of OS cells. To further confirm our data, we conducted a western blot assay to determine the protein level of ROR2 in each group, and found that transfection with the ROR2 plasmid reversed the inhibitory effect of miR-124 overexpression on ROR2 protein levels in the OS cells (Fig. 5C).

As ROR2 is an important receptor of non-canonical Wnt signaling, which plays a key role in the regulation of cell motility and is closely associated with tumor metastasis, we further determined the activity of non-canonical Wnt signaling in each group. As shown in Fig. 5D, we demonstrated that overexpression of miR-124 significantly inhibited the activity of c-JNK, the pivotal member in the non-canonical Wnt signaling pathway. However, restoration of ROR2 rescued the inhibitory effect of miR-124 overexpression on the activity of c-JNK. Therefore, we suggest that miR-124 can inhibit OS cell migration and invasion, partly at least, via targeting ROR2 and thus suppressing the activity of ROR2-mediated non-canonical Wnt signaling.