OR Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 10.3892/or.2015.4523 or-35-03-1689 Articles Overexpressed genes associated with hormones in terminal ductal lobular units identified by global transcriptome analysis: An insight into the anatomic origin of breast cancer YANGJIANMIN1 YUHAIJING1 ZHANGLIANG2 DENGHUA2 WANGQI1 LIWENPING1 ZHANGANQIN1 GAOHONGYI3 YINAIHUA4 Breast Disease Center, Guangdong Women and Children's Hospital, Guangzhou, Guangdong, 511400, P.R. China Translational Medicine Center, Guangdong Women and Children's Hospital, Guangzhou, Guangdong, 511400, P.R. China Department of Pathology, Guangdong Women and Children's Hospital, Guangzhou, Guangdong, 511400, P.R. China Medical Genetics Center, Guangdong Women and Children's Hospital, Guangzhou, Guangdong, 511400, P.R. China Correspondence to: Professor Qi Wang, Breast Disease Center, Guangdong Women and Children's Hospital, 521 Xingnan Road, Guangzhou, Guangdong, 511400, P.R. China, E-mail: wangqigz@hotmail.com 03 2016 28 12 2015 35 3 1689 1695 04 10 2015 10 11 2015 Copyright © 2016, Spandidos Publications 2016

Although human breast ducts and terminal ductal lobular units (TDLUs) share the same cell types, ample evidence shows that TDLUs are the predominant site for the origin of breast cancer. Yet, there is still limited information concerning the molecular mechanisms. Analysis of transcriptomic profiles in TDLUs may provide insight into early breast tumorigenesis. We compared genome-wide expression profiles of 8 matched sets of breast main duct and TDLU samples, using significance analysis of microarray (SAM) software to screen differentially expressed genes (DEGs) with fold-change >2.0 and q-value <0.05. Moreover, we used Gene Ontology for functional enrichment analysis. We identified 472 DEGs between the two tissue types, and confirmed 17 randomly chosen DEGs by quantitative reverse transcription-PCR (qRT-PCR). Notably, hormone-related pathways were highly enriched in the TDLU samples, including various hormone-related DEGs that are associated with breast carcinogenesis and tumor progression. Oncogenic upregulation in TDLUs indicates a potential inappropriate or excessive response to successive hormone stimulus during the proliferation, differentiation and lactation cycles of the human mammary gland. Imbalanced hormone reactions may finally result in the early onset of neoplastic transformation that occurs mostly in breast TDLUs.

 terminal ductal lobular unit breast cancer hormones differentially expressed genes global transcriptome profiling Introduction

Breast cancer is the most common malignancy and the leading cause of cancer-related deaths among women worldwide. Morphologically, breast cancer can be classified as ductal carcinoma or lobular carcinoma. Although ductal carcinomas were initially thought to arise from the ductal system, current evidence shows that most benign and malignant breast lesions originate from the same anatomical compartment, the terminal ductal lobular units (TDLUs). Hyperplasic or atypical hyperplasic epithelia that line TDLUs are believed to be carcinoma precursor or premalignant cells. Histologically, a TDLU has both ductal and lobular components; premalignant TDLU cells can further develop to ductal or lobular carcinoma (1–4). The lobules are the milk-producing breast structures, of which the terminal lobules are the TDLUs (5). Notably, TDLUs are predominant site of origin of breast cancer even though the ducts and TDLUs consist of the same general cell types.

Gene expression profiling can provide valuable information concerning carcinogenesis, classification, diagnosis and treatment of tumors, and has been widely used to investigate the molecular mechanisms of various cancer types, particularly for breast cancer in Western countries. However, most microarray studies of breast cancers have mainly focused on cancer itself (6–8). Reports of microarray analyses of TDLUs and breast cancer etiology are scarce. For example, Tripathi et al compared gene expression profiles between histologically normal TDLU epithelium of breast cancer patients and cancer-free controls. They found that global gene expression abnormalities already existed in the non-cancerous epithelium of breast cancer subjects and in early stage carcinomas (9).

The present study aimed to survey genes that are differentially regulated in breast TDLU tissues and main duct controls, using genome-wide expression profiling. A total of 472 differentially expressed genes (DEGs) were identified between the two groups. Notably, hormone metabolism and response pathways were highly enriched in the TDLU samples, including various hormone-related DEGs that are reportedly associated with malignant transformation and progression in breast cancers. The marked differences in transcriptomic patterns between the human breast duct and TDLU samples are likely to reflect differences in responses to microenvironment alteration. This study provides important clues to the hormone-driven carcinogenic process that starts in the TDLU, and may facilitate the development of novel targeted therapeutics for breast cancer.

 Materials and methods Clinical specimens

This study was approved by the Medical Ethics Committees of the Guangdong Women and Children's Hospital. Written informed consent was obtained from all participants. We collected 8 matched pairs of breast main duct and TDLU tissue samples from 8 premenopausal patients with benign papilloma who underwent surgical treatment. Pathological examination was performed to confirm histological normalcy of the uninvolved tissues. The main ducts were extracted along with the blue blot after injection of 0.2 ml of methylenum caeruleum dye into the discharge hole during resection. The TDLU samples were collected by incising 2×2 mm sections of the non-blue-stained glandular tissue at the terminal of specimens. Immediately after collection, all samples were rapidly preserved in RNAlater RNA stabilization reagent (Qiagen, Inc., Chatsworth, CA, USA); a portion of each sample was used for histological analysis.

 Global gene expression profiling

Briefly, total RNA was extracted using TRIzol reagent (Invitrogen, Gaithersburg, MD, USA) according to the manufacturer's instructions. RNA quality was assessed by formaldehyde agarose gel electrophoresis; RNA concentration was measured using spectrophotometry (Nanodrop, Wilmington, DE, USA). We then amplified and labelled 100 ng of total RNA of each sample using Agilent Low Input Quick Amp Labeling kit. Fluorescence (Cy5 or Cy3) labeled cRNA was hybridized to Agilent human 8×60 K microarrays at 65°C for 16 h in a hybridization oven. Hybridized slides were washed and scanned using an Agilent microarray scanner. Raw data of the obtained images were extracted using Agilent Feature Extraction software and analyzed using Agilent GeneSpring GX 11.5 software. The data were deposited in the NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) under accession number GSE39021.

 Quantitative reverse transcription-PCR (qRT-PCR) validation

Briefly, up to 1 µg of DNase I-treated total RNAs per sample was reverse-transcribed into cDNA using oligo (dT)12 and M-MLV reverse transcriptase (Life Technologies) following standard procedures. The derived cDNA was further amplified in triplicates using a LightCycler® 480 Real-Time PCR system (Roche Applied Science). The 20-µl reaction mixture contained 1X PCR buffer (Mg2+ Plus), 200 µM of each dNTP, 0.5 µM of the forward primer, 0.5 µM of the reverse primer (Table I), and Eva Green Master Mix. PCR conditions consisted of 95°C for 4 min; 45 cycles of 94°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec; followed by 1 cycle of 72°C for 8 min. Relative quantification of expression was analyzed by the 2−ΔΔCT method.

 Statistical analysis

Genes were regarded as expressed and retained for further analysis if the probe intensities were >400 after global median normalization. DEGs were screened using two class unpaired analysis in the SAM software. Thresholds were set at a fold-change >2.0 and q-value <0.05. Significant enrichment of Gene Ontology (GO) terms was analyzed using hyper-geometric distribution in the R language software package.

 Results Differential transcriptomic patterns between breast main duct and TDLU tissues

The anatomic sites of the breast main duct and TDLUs are shown in Fig. 1. Total extracted RNA from clinical samples was used for microarray analysis. A total of 472 mRNA transcripts were identified as being significantly differentially expressed. Supervised hierarchical clustering of the 472 DEGs showed distinct patterns between the breast duct and TDLU samples (Fig. 2). Among them, 230 genes were highly expressed in the TDLU tissues, and 242 genes were highly expressed in the main duct tissues. The significant enrichment analysis of GO terms for the DEGs using the R language package software showed that these 472 hits were involved in distinct biological processes. Notably, the top 6 pathways, hormone metabolic process, regulation of hormone levels, response to hormone stimulus, cellular hormone metabolic process, response to endogenous stimulus and steroid metabolic process, are implicated in hormone metabolism and response. As these genes are related and greatly overlap, we combined them into a 'hormone-related' pathway with a total of 18 genes (Table II).

 Correlation between microarray analysis and qRT-PCR results

To confirm the microarray results, 17 DEGs identified by microarray were randomly chosen for validation using qRT-PCR. These genes included ADIPOQ, ADORA2B, BMP7, CA4, CCL19, ITGB3, CCL21, CEL, ECSCR, FABP4, LOX, S100A8, HSD11B2, LAMA1, LILRB3, S100A9 and WNT5A. The unchanged expression of dehydrogenase (GAPDH) between the two tissues was used as a reference gene. The fold-change of expression for each gene between the breast main duct and TDLU tissues was measured using the same batch of samples as in the microarray. Ratios measured by the microarray were highly consistent with the data from qRT-PCR, which confirmed marked differences in gene expression profiles between the two groups (Fig. 3).

 Discussion

Women undergo multiple cycles of growth and differentiation of mammary glands through their lifetimes. Although the basic structure of the mammary gland is composed of ducts and lobules, their phenotypes and gene expression patterns alter greatly with age and pregnancy. Considering that breast differentiation and development are relatively stable in multiparous women, premenopausal multiparous women were selected to analyze gene expression profiles of breast duct and TDLU tissues. Significantly different transcriptomes were identified between the two structures and confirmed by qRT-PCR, which indicated fundamental differences in physiological functions and biochemical processes.

The breast is a hormone-dependent organ, and breast carcinomas are closely modulated by hormones, not only steroid hormones, but any chemical substances produced in the body with essential biological functions for life such as metabolism, growth, development, differentiation and reproduction. We found that 230 genes were highly expressed in the TDLUs, the functional units of the breast. Among the functions associated with these genes, the top 6 were related to hormone metabolism and hormone response. These hormone-related upregulated genes included HMGCS2, UGT2B11, DHRS2, SERPINA6, CA4, CYP26A1, FABP4, SCG5, CRYM, SERPINA1, FAM3B, ADIPOQ, CA2, IGF2, LEP, HSD11B2, EGR2 and ADCY1. Some of these are closely associated with tumorigenesis and cancer development, which suggests an explanation for the higher production of cancer cells in TDLUs.

The protein encoded by HMGCS2, 3-hydroxy-3-meth-ylglutaryl-CoA synthase 2 (mitochondrial), belongs to the HMG-CoA synthase family. It functions as a mitochondrial enzyme that catalyzes the first ketogenesis reaction in various hormonal and metabolic situations. Recently, Martinez-Outschoorn et al reported that fibroblasts that over-express MGCS2 in tumor stroma effectively promote anabolic tumor growth, and its overexpression in MDA-MB-231 breast cancer cells markedly increased tumor development and metastatic capacity by driving increased mitochondrial biogenesis. Thus, the ketogenesis pathway is a potential target in cancer intervention and therapeutics. These results clearly indicate that HMGCS2 is a bona fide metabolic oncogene (10). Here, HMGCS2 was the most highly upregulated gene (4.79-fold) in the TDLU samples, which may drive breast cancer development and progression via the ketone metabolism pathway.

Fatty acid binding protein-4 (FABP4) is encoded and found in adipocytes. Fatty acid binding proteins are a family of highly conserved, cytoplasmic proteins that bind long-chain fatty acids and play key roles in fatty acid uptake, transport and metabolism. The role of lipid metabolism in cancer has recently drawn great attention. FABP4 was found to be upregulated in omental metastases compared with primary ovarian tumors, using a protein array. FABP4 deficiency significantly inhibited tumor metastasis in mice, indicating its important role in ovarian cancer metastasis. This study showed that stromal adipocytes provide fatty acids for rapid cancer cell growth, suggesting that lipid metabolism could be a target in the treatment of cancer (11). Substantially higher levels of serum FABP4 have been identified in breast cancer patients when compared with healthy controls, and FABP4 has been positively associated with tumor size and nodal status. These data demonstrate that high FABP4 levels are significantly associated with breast cancer risk and adverse tumor characteristics (12). Similar correlations have also been determined in prostate cancer (13). These findings are further supported by previous observations that FABP4 expression was the highest in the HER2-positive breast cancer subtype. FABP4 positivity was associated with significantly shorter disease-free survival and overall survival in triple-negative breast cancer (14). Thus, selective inhibition of FABP4 may be a potential anticancer strategy for various breast cancer subtypes. The breast is an endocrine organ, consisting of adipose tissue, which can influence tumor growth or differentiation by adipose tissue-derived hormones.

Glucocorticoids have an anti-proliferative effect in many tumors including breast cancer cells (15,16). Hydroxysteroid (11-β) dehydrogenase-2 (HSD11B2) potently inactivates hormonally active glucocorticoids to comparatively less active metabolites. HSD11B2 has thereby been postulated to protect cells from the growth-inhibiting and or pro-apoptotic effects of glucocorticoids involved in the protein kinase A and protein kinase C signaling pathways (17). Increased HSD11B2 expression has an obvious function in cells that acquire anchorage-independent growth and acinar-conformational disruption. A reduced HSD11B2 protein level by specific siRNAs resulted in diminished breast cell carcinogenesis (18). Similarly, inhibition of HSD11B2 expression was found to suppress the proliferation of breast cancer PMC42 cells (19). These results were further supported by detection of HSD11B2 overexpression in breast cancer cell lines and breast tumors, leading to an increased cell growth of 50–120% (20,21). Thus, HSD11B2 upregulation is postulated to have a proliferative role on breast cancer cells through impairment of the anti-proliferative activity of glucocorticoids.

Leptin (LEP), an adipocyte-derived cytokine, plays a major role in the regulation of food intake, energy expenditure and body weight through the leptin receptor. It also has endocrine functions, and affects immune responses, hematopoiesis, angiogenesis and wound healing. Although leptin is mainly expressed by white adipocytes, it is also expressed by other tissues including mammary epithelial cells (22). Leptin mRNA expression was significantly higher in breast cancer cells than that in non-cancerous tissues and increased expression of leptin and the leptin receptor were found during oncogenic transformation of benign cells (23,24). In addition, strong leptin protein expression was detected in most breast cancer cells but not in normal epithelium, using immunohistochemical staining (25). Serum leptin levels have also been found to be highly elevated in breast cancer patients compared with levels in healthy controls (26). Furthermore, an in vivo study showed that leptin directly contributed to the development of mammary tumors in a leptin-deficient mouse model (27). These observations strongly suggest that leptin production is enhanced in mammary glands during tumorigenesis. Leptin increases anchorage-dependent breast cell proliferation, and may promote carcinogenesis and progression of breast cancer by activating pathways that include signal transducers and activators of transcription 3 (STAT3), extracellular signal-regulated kinase (ERK) and transcript activator protein 1 (AP-1) (28). Functionally blocking leptin signaling may be an effective approach to prevent and treat breast cancer.

The other upregulated genes in TDLU tissues have been shown to affect breast tumorigenesis and progression. Insulin-like growth factor 2 (IGF-2) is a mitogenic peptide hormone; its overexpression occurs in many cancer types and it is associated with poor patient prognosis. IGF-2 is thought to control normal cell growth and development, and stimulates breast cancer proliferation (29–31). Adipocytes have been shown to secrete levels of IGF-2 that are sufficient to promote proliferation of MCF-7 breast cancer cells (32). Approximately 20–30% of breast cancers show amplification and elevated expression of ErbB2 (i.e., HER-2), which is associated with poor clinical outcomes. Early growth response 2 (EGR2) is a zinc finger transcription factor. An EGR2 binding site is reportedly found within the ErbB2 promoter, and EGR2 is reportedly upregulated during ErbB2+ tumor induction (33). Furthermore, overexpression of EGR2 has been reported in ErbB2-expressing breast cancer cell lines. These findings implicate EGR2-ErbB2 signaling in mammary tumor formation (34).

Large bodies of clinical and epidemiological evidence shows the critical role of hormones in mammary gland development and tumorigenesis (35,36). As women age, their breast lobules and TDLU structures regress. This results in reduced breast cancer risk. Conversely, a gradual increase in breast cancer risk is associated with increasing numbers of lobule units (37). Obviously, enhanced oncogene expression in TDLUs sensitizes the lobular epithelium to the proliferative effects of successive hormone stimulus. Multiple accumulated genetic changes may drive a benign-malignant progression, finally resulting in the onset of breast cancer originating in the TDLU. Our findings should be verified by studies with larger cohorts.

In summary, we identified a cluster of upregulated genes involved in hormone metabolism and hormone stimulus response pathways in TDLU samples by global transcriptome analysis. Notably, the hormone stimulus of these elevated DEGs is potentially oncogenic, and may contribute to the greater incidence of breast carcinogenesis occurring in TDLU tissue.

 Abbreviations TDLU

terminal ductal lobular unit

 DEGs

differentially expressed genes

 qRT-PCR

quantitative reverse transcription-polymerase chain reaction

 Acknowledgments

The present study was supported by a grant from the Guangdong Science and Technology Program, China (2012B031800174).

 References WellingsSRJensenHMOn the origin and progression of ductal carcinoma in the human breastJ Natl Cancer Inst501111111819734123242 WellingsSRJensenHMMarcumRGAn atlas of subgross pathology of the human breast with special reference to possible precancerous lesionsJ Natl Cancer Inst552312731975169369 WellingsSRA hypothesis of the origin of human breast cancer from the terminal ductal lobular unitPathol Res Pract166515535198010.1016/S0344-0338(80)80248-26253967 AllredDCMohsinSKFuquaSAHistological and biological evolution of human premalignant breast diseaseEndocr Relat Cancer84761200110.1677/erc.0.008004711350726 MusumeciGCastrogiovanniPSzychlinskaMAAielloFCVecchioGMSalvatorelliLMagroGImbesiRMammary gland: From embryogenesis to adult lifeActa Histochem117379385201510.1016/j.acthis.2015.02.01325800977 MaXJSalungaRTuggleJTGaudetJEnrightEMcQuaryPPayetteTPistoneMSteckerKZhangBMGene expression profiles of human breast cancer progressionProc Natl Acad Sci USA10059745979200310.1073/pnas.093126110012714683156311 SotiriouCNeoSYMcShaneLMKornELLongPMJazaeriAMartiatPFoxSBHarrisALLiuETBreast cancer classification and prognosis based on gene expression profiles from a population-based studyProc Natl Acad Sci USA1001039310398200310.1073/pnas.173291210012917485193572 FuJAllenWXiaAMaZQiXIdentification of biomarkers in breast cancer by gene expression profiling using human tissuesGenom Data2299301201410.1016/j.gdata.2014.09.004253961184226530 TripathiAKingCde la MorenasAPerryVKBurkeBAntoineGAHirschEFKavanahMMendezJStoneMGene expression abnormalities in histologically normal breast epithelium of breast cancer patientsInt J Cancer12215571566200810.1002/ijc.23267 Martinez-OutschoornUELinZWhitaker-MenezesDHowellASotgiaFLisantiMPKetone body utilization drives tumor growth and metastasisCell Cycle1139643971201210.4161/cc.22137230827223507492 NiemanKMKennyHAPenickaCVLadanyiABuell-GutbrodRZillhardtMRRomeroILCareyMSMillsGBHotamisligilGSAdipocytes promote ovarian cancer metastasis and provide energy for rapid tumor growthNat Med1714981503201110.1038/nm.2492220376464157349 HanckeKGrubeckDHauserNKreienbergRWeissJMAdipocyte fatty acid-binding protein as a novel prognostic factor in obese breast cancer patientsBreast Cancer Res Treat119367377201010.1007/s10549-009-0577-9 UeharaHTakahashiTOhaMOgawaHIzumiKExogenous fatty acid binding protein 4 promotes human prostate cancer cell progressionInt J Cancer13525582568201410.1002/ijc.2890324740818 KimSLeeYKooJSDifferential expression of lipid metabolism-related proteins in different breast cancer subtypesPLoS One10e0119473201510.1371/journal.pone.0119473257512704353724 LippmanMBolanGHuffKThe effects of glucocorticoids and progesterone on hormone-responsive human breast cancer in long-term tissue cultureCancer Res364602460919761000505 GoyaLMaiyarACGeYFirestoneGLGlucocorticoids induce a G1/G0 cell cycle arrest of Con8 rat mammary tumor cells that is synchronously reversed by steroid withdrawal or addition of transforming growth factor-alphaMol Endocrinol71121113219938247014 RubiśBGrodecka-GazdeckaSLecybyłROciepaMKrozowskiZTrzeciakWHContribution of protein kinase A and protein kinase C signalling pathways to the regulation of HSD11B2 expression and proliferation of MCF-7 cellsActa Biochim Pol519199242004 SongXSiriwardhanaNRathoreKLinDWangHCGrape seed proanthocyanidin suppression of breast cell carcinogenesis induced by chronic exposure to combined 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone and benzo[a]pyreneMol Carcinog494504632010201462483152701 KoyamaKMylesKSmithRKrozowskiZExpression of the 11beta-hydroxysteroid dehydrogenase type II enzyme in breast tumors and modulation of activity and cell growth in PMC42 cellsJ Steroid Biochem Mol Biol76153159200110.1016/S0960-0760(00)00157-611384873 RabbittEHGittoesNJStewartPMHewisonM11beta-hydroxysteroid dehydrogenases, cell proliferation and malignancyJ Steroid Biochem Mol Biol85415421200310.1016/S0960-0760(03)00224-312943730 LipkaCMankertzJFrommMLübbertHBühlerHKühnWRagoschVHundertmarkSImpairment of the antiproliferative effect of glucocorticosteroids by 11beta-hydroxysteroid dehydrogenase type 2 overexpression in MCF-7 breast-cancer cellsHorm Metab Res36437444200410.1055/s-2004-82572415305225 Smith-KirwinSMO'ConnorDMDe JohnstonJLanceyEDHassinkSGFunanageVLLeptin expression in human mammary epithelial cells and breast milkJ Clin Endocrinol Metab8318101813199810.1210/jcem.83.5.49529589698 O'brienSNWelterBHPriceTMPresence of leptin in breast cell lines and breast tumorsBiochem Biophys Res Commun259695698199910.1006/bbrc.1999.084310364481 SheffieldLMalignant transformation of mammary epithelial cells increases expression of leptin and leptin receptorEndocr Res33111118200810.1080/07435800802539976 IshikawaMKitayamaJNagawaHEnhanced expression of leptin and leptin receptor (OB-R) in human breast cancerClin Cancer Res1043254331200410.1158/1078-0432.CCR-03-074915240518 TessitoreLVizioBJenkinsODe StefanoIRitossaCArgilesJMBenedettoCMussaALeptin expression in colorectal and breast cancer patientsInt J Mol Med5421426200010719061 ClearyMPPhillipsFCGetzinSCJacobsonTLJacobsonMKChristensenTAJunejaSCGrandeJPMaihleNJGenetically obese MMTV-TGF-alpha/Lep(ob)Lep(ob) female mice do not develop mammary tumorsBreast Cancer Res Treat77205215200310.1023/A:102189182539912602920 HuXJunejaSCMaihleNJClearyMPLeptin - a growth factor in normal and malignant breast cells and for normal mammary gland developmentJ Natl Cancer Inst9417041711200210.1093/jnci/94.22.170412441326 GallagherEJLeRoithDMinireview: IGF, insulin, and cancerEndocrinology15225462551201110.1210/en.2011-023121540285 CohenDHLeRoithDObesity, type 2 diabetes, and cancer: The insulin and IGF connectionEndocr Relat Cancer19F27F45201210.1530/ERC-11-037422593429 TomblinJKSalisburyTBInsulin like growth factor 2 regulation of aryl hydrocarbon receptor in MCF-7 breast cancer cellsBiochem Biophys Res Commun44310921096201410.1016/j.bbrc.2013.12.112243808543932621 SalisburyTBMorrisGZTomblinJKChaudhryARCookCRSantanamNAryl hydrocarbon receptor ligands inhibit igf-ii and adipokine stimulated breast cancer cell proliferationISRN Endocrinol2013104850201310.1155/2013/104850241711173793317 DillonRLBrownSTLingCShiodaTMullerWJAn EGR2/CITED1 transcription factor complex and the 14-3-3sigma tumor suppressor are involved in regulating ErbB2 expression in a transgenic-mouse model of human breast cancerMol Cell Biol2786488657200710.1128/MCB.00866-07179382052169423 SweeneyCFambroughDHuardCDiamontiAJLanderESCantleyLCCarrawayKLIIIGrowth factor-specific signaling pathway stimulation and gene expression mediated by ErbB receptorsJ Biol Chem2762268522698200110.1074/jbc.M10060220011297548 AndersonEClarkeRBHowellAEstrogen responsiveness and control of normal human breast proliferationJ Mammary Gland Biol Neoplasia32335199810.1023/A:1018718117113 YangXRFigueroaJDHewittSMFalkRTPfeifferRMLissowskaJPeplonskaBBrintonLAGarcia-ClosasMShermanMEEstrogen receptor and progesterone receptor expression in normal terminal duct lobular units surrounding invasive breast cancerBreast Cancer Res Treat137837847201310.1007/s10549-012-2380-2 McKianKPReynoldsCAVisscherDWNassarARadiskyDCVierkantRADegnimACBougheyJCGhoshKAndersonSSNovel breast tissue feature strongly associated with risk of breast cancerJ Clin Oncol2758935898200910.1200/JCO.2008.21.5079198056862793038

Anatomic sites of the human normal main duct and TDLUs. Clinical samples from these two compartments were collected to compare their gene expression profiles. TDLUs, terminal ductal lobular units.

Cluster analysis of genes with significantly different expression in the 8 matched pairs of breast duct and TDLU tissues. Green, downregulated genes; red, upregulated gene. TDLU, terminal ductal lobular unit.

Quantitative RT-PCR validation of 17 differentially expressed genes identified by microarray. Gene expression levels of each gene were measured in triplicate and are shown as average fold-change relative to GADPH used as the internal control. R indicates the Pearson's linear correlation coefficient value.

Primers for qRT-PCR validation of differentially expressed genes.

Gene GeneBank no. Primer sequences (5′ to 3′)
ADIPOQ NM_004797.3 F: GCCTTCCGCAGTGTAGGCTT, R: AGCCAGATGGTGTGGCTTGG
ADORA2B NM_000676.2 F: GCTACACCTCACAAGGAAAT, R: ATCCTTGGAGCCTACTACTG
BMP7 NM_001719.2 F: ACCCGTGGCTGTCTCTTCA, R: AGGCAAGGCAGGCTTACAC
CA4 NM_000717.3 F: GAAATTGCGGTGCTGGCCT, R: AGCGGAAGTAGTGCCTCAGT
CCL19 NM_006274.2 F: GGGTGCCTGCTGTAGTGTTC, R: CTCGGTTCCCCAGGTTAGGT
CCL21 NM_002989.2 F: GCCTTGCCACACTCTTTCTC, R: TCCTGCTGCCTCCTCTCAT
CEL NM_001807.3 F: TGCCAAGAGTGCCAAGACC, R: TCTCCAGGTAGCCGCTGTT
ECSCR NM_001077693.2 F: AGAGACGGAGGCACAAGCA, R: AGCACAGTCTCTGACGTGGG
FABP4 NM_001442.2 F: GTCACAGCACCCTCCTGAA, R: CCATGCCAGCCACTTTCCT
HSD11B2 NM_000196.3 F: CTGGCTGCTTCAAGACAGAGT, R: AGGCAGGTAGTAGTGGATGAA
ITGB3 NM_000212.2 F: GTGACCTGAAGGAGAATCTGC, R: TTCTTCGAATCATCTGGCC
LAMA1 NM_005559.3 F: TGGCTATCCTGCTGGTGTGA, R: CGAACGCTCTGCTGAAGTCA
LILRB3 NM_006864.2 F: CAGAGCCCACACGATGAAG, R: AGTCTCCTTCTGCTGAGTGT
LOX NM_001178102.1 F: ATCCCTGAAATGTCTGCCT, R: CCAGGAGGGGGATGAATGT
S100A8 NM_002964.4 F: TGAAGAAATTGCTAGAGAC, R: CTTTATCACCAGAATGAGGA
S100A9 NM_002965.3 F: ATGCTGATGGCGAGGCTAAC, R: ACTGTGGTCTTAGGGGGTGC
WNT5A NM_003392.3 F: CGTTAGCAGCATCAGTCCA, R: CTGTGCCTTCGTGCCTATT

F, forward; R, reverse.

List of hormone-related genes overexpressed in the TDLU samples enriched by GO term analysis.

Gene q-value (%) Fold-changea Description
CA4 0 3.66 Carbonic anhydrase IV
CYP26A1 0 3.36 Cytochrome P450, family 26, subfamily A, polypeptide 1
FABP4 0.54 2.87 Fatty acid binding protein 4, adipocyte
CRYM 1.01 2.61 Crystallin, mu
FAM3B 1.51 2.52 Family with sequence similarity 3, member B
ADCY1 1.51 2.01 Adenylate cyclase 1 (brain)
EGR2 1.83 2.04 Early growth response 2
HSD11B2 2.61 2.16 Hydroxysteroid (11-β) dehydrogenase 2
ADIPOQ 3.44 2.52 Adiponectin, C1Q and collagen domain containing
SCG5 4.11 2.66 Secretogranin V
IGF2 5.14 2.39 Insulin-like growth factor 2
HMGCS2 6.82 4.79 3-Hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
SERPINA1 7.52 2.56 Serpin peptidase inhibitor, clade A, member 1
CA2 8.38 2.43 Carbonic anhydrase II
LEP 8.38 2.28 Leptin
SERPINA6 9.97 3.86 Serpin peptidase inhibitor, clade A, member 6
UGT2B11 11.20 4.27 UDP glucuronosyltransferase 2 family, polypeptide B11
DHRS2 11.49 4.02 Dehydrogenase/reductase (SDR family) member 2

Fold-change indicates gene expression levels in the terminal ductal lobular unit (TDLU) samples relative to the breast duct samples.