The human ovarian cancer cell line, HO8910, was kindly provided by Dr Qixiang Shao of Jiangsu University (Zhenjiang, China). HO8910 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) (both from Gibco, Grand Island, NY, USA) at a temperature of 37°C under 5% CO₂. HEK 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco) containing 10% FBS at a temperature of 37°C under 5% CO₂.

The pLKO-Tet-On, pLVX-tight-puro, pHR′-CMV-8.2ΔVPR, and pHR′-CMV-VSVG vectors were kind gifts from Dr Changdeng Hu (Purdue University, West Lafayette, in, USA). LSD1, E-cadherin, Snail, vimentin, N-cadherin and MMP-2 antibodies were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA). The α-tubulin and horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibodies were obtained from Bioworld Technology (Shanghai, China). Electrochemiluminescence (ECL) reagents were purchased from Millipore Corp. (Billerica, MA, USA). H3K4me2 antibody was purchased from upstate biotechnology Inc. (Lake Placid, NY, USA). Polybrene, doxycycline (Dox), puromycin and G418 were purchased from Sigma-Aldrich (St. Louis, MO, USA). The LSD1 inhibitor tranylcypromine (TCP) was obtained from Biomol International (Plymouth Meeting, PA, USA).

For generation of the shRNA-LSD1 plasmid, annealed short hairpin oligonucleotides (the RNAi Consortium collection TRCN0000046072; Sigma-Aldrich) targeting CCACGAGTCAAACCTTTATTT in the coding regions (CDS) of LSD1 were cloned into pLKO-Tet-On by AgeI and EcoRI sites to produce pLKO-Tet-On-shLSD1 as described previously (30,31). The constructs were confirmed by DNA sequencing. All transfections were performed using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions.

To generate lentiviral particles, 293T cells were seeded in 6-cm dishes and transfected with 2 µg of pLKO-Tet-On-shLSD1, 1.5 µg of pHR′-CMV-8.2ΔVPR and 0.5 µg of pHR′-CMV-VSVG using Lipofectamine 2000 reagent. The supernatant containing the lentiviral particles was harvested 24, 48 and 72 h post-transfection, and then centrifuged (124 × g for 5 min) to remove cell debris. HO8910 cells cultured in 6-cm dishes were infected by adding 1 ml lentiviral supernatant and 3 ml complete medium containing 8 µg/ml Polybrene. After the infection (twice), cells were selected with 2.0 µg/ml puromycin for 3 days and then maintained with 1.0 µg/ml puromycin for one week.

To generate rTet-repressor expressing (rtTA) cell line, 293T cells were transfected with 2 µg of pLVX-Tet-On, 1.5 µg of pHR′-CMV-8.2ΔVPR and 0.5 µg of pHR′-CMV-VSVG using Lipofectamine 2000 reagent. After transfection (24 h), the viral supernatant was harvested and used to infect HO8910 cells. After the infection (twice), HO8910 cells were selected with 200 µg/ml G418 for 1 week. The cells that survived were stable rtTA. HO8910-rtTA cells were then infected with the lentiviral particles packaged with pLVX-tight-puro-LSD1. After infection twice, HO8910-rtTA cells were selected with 2.0 µg/ml of puromycin for 3 days, and then maintained in the presence of 1.0 µg/ml of puromycin for one week. The surviving cells were considered as stable clones. The stable clones were further confirmed by western blot analysis.

Total RNA was isolated from the cells using RNAiso plus (Takara, Shiga, Japan) and reverse-transcribed using the PrimeScript RT reagent kit (Takara) to generate cDNAs. Then the cDNAs were subjected to qRT-PCR as described previously (32). qRT-PCR was performed with SYBR-Green PCR Master Mix (Takara) on a Bio-Rad CFX96 system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The primer sequences used were: LSD1 (GenBank accession no. NM 015013.3), 5′-CAAGTGTCAATTTGTTCGGG-3′ (forward) and 5′-TTCTTTGGGCTGAGGTACTG-3′ (reverse); and GAPDH (GenBank accession no. NM001256799.1), 5′-GCAAATTCCATGGCACCGTC-3′ (forward) and 5′-TCGCCCCACTTGATTTTGG-3′ (reverse). The relative quantification of mRNA levels was normalized to levels of GADPH and calculated by comparative 2^−ΔΔCt.

Protein lysates were extracted from the cells and blotted as described previously (33). Equal amounts of soluble proteins were electrophoresed by SDS-PAGE and transferred to 0.45-µm PVDF membranes. The membranes were blocked with 5% nonfat-dry milk for 1 h at room temperature (RT). After incubation with the primary antibodies against LSD1 (1:1,000), E-cadherin (1:500), Snail (1:500), vimentin (1:500), N-cadherin (1:500) or MMP-2 (1:500) overnight at 4°C and with the corresponding secondary antibodies (1:5,000) for 1 h at RT, the immunoblots were developed by ECL method.

For the invasion assay, each Boyden chamber (BD Biosciences, Bedford, MA, USA) was coated with 60 µl Matrigel diluted with DMEM (1:30) and incubated at 37°C for 4–6 h. Cells (1.5×10⁵) were resuspended with DMEM containing Dox or TCP in the upper chamber. Then, 10% FBS-containing medium was placed in the lower chamber to act as a chemoattractant. After a 24-h incubation, the non-invading cells remaining on the upper surface were removed, and the cells on the lower surface were fixed with 4% formaldehyde for 30 min, and stained with 0.1% crystal violet for 15 min. At least 5 fields for each chamber were photographed (×200 magnification) and counted, and the invading cells were counted in each field. The cell migration assay was performed using Boyden chambers without Matrigel coating. All experiments were performed at least in triplicate.

All reagents were provided by Upstate Biotechnology (EZ-ChIP™ kit 17-371). Cells were fixed with 1% formaldehyde to cross-link proteins. The reaction was stopped by adding 10X glycine. Cross-linked cells were washed with PBS twice, pelleted and resuspended in SDS lysis buffer at a concentration of 1×10⁷ cells/ml. Aliquots of 400 µl were sonicated with 4–6 sets of 5-sec pulses (32% output) on ice. Then sonicated lysates were centrifuged and divided into 100 µl aliquots for each ChIP assay (1×10⁶ cells/IP), and precleared with protein G-agarose. After incubation with the antibodies overnight at 4°C, immune complexes were collected with protein G-agarose, and then washed with low salt immune complex wash buffer, high salt immune complex wash buffer, and finally TE buffer. The immune complexes were eluted with 20% SDS, and 1 M NaHCO₃. The crosslinks were reversed overnight at 65°C, then the DNA was purified using spin columns, and finally subjected to qRT-PCR. Chromatin eluted from the IPs with IgG and anti-RNA polymerase were used as the negative and positive control, respectively. Two previously described primers of E-cadherin promoter for ChIP (34,35) were as follows: E-ca01 5′-GGGCAATACAGGGAGACACA-3′ (forward) and 5′-GGGCTTTTACACTTGGCTGA-3′ (reverse); E-ca02 5′-CACAACAGCATAGGGAGACATT-3′ (forward) and 5′-TGTAGAGCTTCATGGGTTAGTGA-3′ (reverse).

All values are presented as the mean ± SEM. The data were analyzed using the Student's t-test with SPSS 11.5 software (SPSS Inc.). P-values with a 95% confidence interval were obtained from at least three independent experiments. A p-value <0.01 was considered to indicate a statistically significant result.

To investigate the contribution of LSD1 to the migration and invasion of ovarian cancer HO8910 cells, we generated stable LSD1-knockdown (LSD1-KD) clones and LSD1-overexpressing (LSD1-OE) clones from the HO8910 cells. Total RNA and proteins were extracted from these stable cells treated with increasing doses of Dox for 24 or 48 h. Our results showed the mRNA and protein expression of the LSD1 gene was decreased in the LSD1-KD cells in a dose-dependent manner (Fig. 1A and B), whereas the levels of LSD1 mRNA and protein expression were increased in the LSD1-OE cells (Fig. 1C–E).

To understand the effect of LSD1 expression on cell migration and invasion, we performed Transwell assays to measure the migratory capacity of these two transfected cell lines. The LSD1-KD cells displayed less migration and invasion in comparison with the control (Fig. 2A and B), whereas the LSD1-OE cells had a higher rate of migration and invasion as compared to the control (Fig. 2C and D).

To further determine the role of LSD1 in cell migration, we utilized a known potent inhibitor, TCP (30,36), to suppress the demethylase activity of LSD1 in HO8910 cells. Inhibition of LSD1 decreased the migration activity of the HO8910 cells in a dose-dependent manner (Fig. 3A and B). Taken together, these data suggest that LSD1 is essential for cell migration and invasion in HO8910 ovarian cancer cells.

As epithelial-mesenchymal transition (EMT) is involved in tumor migration and invasion, we examined the expression of several EMT markers in the LSD1-KD and LSD1-OE HO8910 cells. We found that knockdown of LSD1 upregulated the expression of the epithelial marker E-cadherin and downregulated the expression of the mesenchymal markers N-cadherin, vimentin and MMP-2 (Fig. 4A). LSD1 knockdown also caused a decrease in the expression of the transcription factor Snail (Fig. 4A). Furthermore, inhibition of LSD1 induced an increase in E-cadherin expression and a decrease in the expression of N-cadherin, vimentin, MMP-2 and Snail in a dose-dependent manner (Fig. 4C). On the contrary, overexpression of LSD1 induced a decrease in E-cadherin expression, with a concomitant increase in the expression of N-cadherin, Vimentin, MMP-2 and Snail in the HO8910 cells (Fig. 4B).

Given that knockdown of LSD1 was accompanied by the upregulation of E-cadherin at the transcriptional level (Fig. 5A) and inhibition of migration of ovarian cancer cells (Fig. 2A and B), we speculated that LSD1 could enhance migration by downregulating E-cadherin expression via demethylation of H3K4me2, a major substrate of LSD1 in ovarian cancer cells (30). To confirm this speculation, Chip assays were performed in the LSD1-KD HO8910 cells incubated with the anti-H3K4me2 antibody. Quantitative analysis indicated that the enrichment of H3K4me2 at the promoter of the e-cadherin gene was significantly higher in the LSD1-KD cells than that in the control cells (Fig. 5B). Collectively, our data revealed that the expression of LSD1 caused a decrease in H3K4me2 levels at the E-cadherin promoter, reduced E-cadherin expression, and consequently contributed to the migration of HO8910 cells.