The human ovarian cancer cell line A2780 and SKOV3 were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA) and were cultured in RPMI-1640 medium with 10% fetal bovine serum (FBS). All cells were maintained at 37°C in a humidified atmosphere containing 5% CO₂.

Grifolin was kindly provided by Kunming Institute of Botany, the Chinese Academy of Science and prepared at a concentration of 100 mmol/l stock solution in dimethyl sulfoxide (DMSO). Both chloroquine disphosphate (CQ) and acridine orange were obtained from Abcam (Cambridge, UK). The antibodies to p-Akt, Akt, p-mTOR, mTOR, p-p70S6K, p70S6K, p-S6, S6, p-4E-BP1 and 4E-BP1 were all purchased from Cell Signaling Technology (Danvers, MA, USA), the antibodies to LC3B, P62, Atg7, Beclin-1 and β-actin were obtained from Abcam. The cell culture media and other reagents were obtained from HyClone Laboratories (Logan, UT, USA).

Cell viability was measured by MTT assay. The A2780 and SKOV3 cells were seeded at a density of (4–5)×10³ on 96-well plates and was allowed to adhere overnight. The cells were then treated with various concentration of the drugs (0, 20, 40, 60, 80 and 100 µM) to cells for 24, 48 and 72 h. At indicated time-points, the cells in the 96-well plate were incubated with 20 µl MTT and after 4 h at 37°C. The formazan product was dissolved in 100 µl DMSO and evaluated at 490 nm with a microplate reader called infinite M200 PRO (Bio-Rad Laboratories, Hercules, CA, USA.)

The ovarian cancer cells were treated with grofolin with different concentrations (0, 25, 50 and 75 µM) for 24 h and then stained with acridine orange (1 µg/ml) in PBS at 37°C for 15 min in dark. Then the cells were washed with cold PBS twice and re-suspended in PBS for analysis in 1 h. The data were analyzed by CellQuest software.

Analysis of LC3B protein localization: the cells were plated in 24-well plates and treated with 50 µM grifolin for 24 h. The cells were then fixed with 4% paraformaldehyde for 15 min at room temperature and were permeabilized with 0.2% Triton 150–200 µl in PBS for 10 min. After that, the cells were blocked with indicated anti-LC3B antibody (1:200) overnight and related secondary antibody (1:250) for 1 h in dark and then stained with 4,6-diamidino-2-pheny-lindole (DAPI) for 5 min in dark and at room temperature. At last, the fluorescence images were observed using a DP71 fluorescence microscope (Olympus, Tokyo, Japan).

The grifolin-treated cells were used to detect the induction of autophagy in ovarian cancer. The cells were treated with 50 µM grifolin for 48 h and harvested by trypsinization and then fixed with cold fixative containing 2.5% glutaraldehyde and 2% paraformaldehyde in 0.1 M cacodylate buffer. Then the samples were post-fixed in 1% osmium tetroxide buffer (OsO₄). We observed the representative areas (90 nm thin sections were cut) with a JEM-1010 transmission electron microscope (JEOL USA, Inc., Peabody, MA, USA) at 80 kV.

Vehicle- or drug-treated cells were lysed in a mixed buffer which contained RIPA, NaF, PMSF, and the supernatants were collected and the protein levels were measured. Protein (20 µg) were resolved by 12 or 10% SDS-PAGE and transferred to PVDF membranes (Immobilon P; Millipore, Bedford, MA, USA). After blocking for 2 h using 5% non-fat milk, the stripes were incubated with the indicated primary antibodies overnight at 4°C. This was followed by incubation with secondary antibodies at room temperature for 1–2 h. The protein signals were then detected by ImageQuent LAS 4000.

Cells were plated in 6-well cell culture plates at the confluence of 1×10⁵ cells/well and incubated at 37°C temperature with 5% CO₂ overnight. Then the cells were transfected with GFP-LC3 plasmid using Olifectamine and Opti-MEM medium according to the manufacturer's protocol. shRNA transfection. ShRNA was used to silence LC3B protein expression in A2780 and SKOV3 cells. Establishment of A2780-plko.1-shLC3B, A2780-plko.1-NC, SKOV3-plko.1-shLC3B and SKOV3-plko.1-NC cell lines (shRNA-Forward primer CCGGCGCTTACAGCTCAATGCTAATCTCGAGATTAGCATTGAGCTGTAAGCGTTTTTG and shRNA-Reverse primer AATTCAAAAACGCTTACAGCTCAATGCTAATCTCGAGATTAGCATTGAGCTGTAAGCG).

T-test and one-way ANOVA were performed to determine significance by using the software SPSS 18.0. Statistical significance was determined at P<0.05. All the experiments were performed in triplicate.

We examined the effect of grifolin on cell viability of A2780 and SKOV3 cells which did decrease cell viability in the two cell lines in a dose- and time-dependent manner, as shown in Fig. 1.

The induction of autophagy by grifolin was confirmed by flow cytometry using acridine orange staining. As shown in Fig. 2, grifolin-treated cells increased formation of AVOs in a dose-dependent manner.

In the grifolin-treated cells, autophagy could cause ultrastructural changes. In Fig. 3, we observed autophagy in grifolin-treated cells by transmission electron microscopy. The cells were treated with 50 µM grifolin for 48 h, after which, we were able to observe the characteristics of cells undergoing autophagy.

It has been well-established that the microtubule-associated protein 1 light chain 3 (LC3) is a protein associated with the autophagosomal membrane (10). After being treated with 50 µM grifolin for 24 h, the number and intensity of punctuate LC3B fluorescence increased as shown in Fig. 4. Next, we investigated the expression of autophagy-related genes by western blot analysis. We found a significant increase in LC3B, Atg7, Beclin-1 and a decrease in P62 in a dose-dependent manner as shown in Fig. 5.

For further studying the role of grifolin in inducing autophagy in human ovarian cancer cell lines, the effect of grifolin on autophagy was confirmed by a GFP-LC3 puncta formation assay. As shown in Fig. 6, we find increased number of GFP-LC3 puncta in the grifolin-treated A2780 and SKOV3 cells.

Next, we used the autophagy inhibitor chloroquine (CQ) to investigate whether grifolin induced ovarian cancer cell death through the induction of autophagy. CQ is a well-known inhibitor of autophagy and inhibits lysosome acidification and degradation (11). We used MTT assay to detect cell viability (as shown in Fig. 7) using 10 µM of CQ which was able to significantly reduce the cell death in A2780 and SKOV3 cell lines. To prove the role of LC3B on autophagy in the grifolin-treated human ovarian cancer cells, we silenced the expression of LC3B and measured the autophagy level by flow cytometry-AVO analysis. As demonstrated in Fig. 8A and B, we found that transfection with shLC3B blocked the autophagic effect of grifolin-treated A2780 and SKOV3 cells. Then we measured the level of LC3B by western blot analysis. Fig. 8C demonstrates that knockdown of LC3B in A2780 and SKOV3 cells significantly decreased its expression level, and the expression level of LC3B protein in grifolin-treated shLC3B cells expressed was higher than the negative control group. These results suggested that grifolin could reduce autophagic cell death in human ovarian cancer cell lines.

Researchers have found that the inhibition of Akt/mTOR/S6K pathway is associated with autophagy in various cancer cells (12–14). Thus, we examined whether the pathway is associated with grifolin-treated ovarian cancer cell autophagic death using western blot analysis (Fig. 9). The results demonstrated that grifolin caused a decrease in levels of the phosphorylated form of Akt, mTOR, p70S6K, S6 and 4E-BP1 while the total of these proteins remained unaffected by the treatment. Those results suggested that grifolin could induce autophagic cell death by inhibiting the activity of Akt/mTOR/S6K pathway.