Eighty-four paired TSCC and corresponding non-tumor control tissues were obtained from patients through surgical dissection at the Tianjin Cancer Hospital and Institute. This study was approved by the Ethics Committee of the Tianjin Cancer Hospital and Institute, and written informed consent was obtained from all patients.

Human tongue cancer cell lines (UM1, UM2, Cal27, SCC1, SCC15 and SCC25) were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). The cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen), supplemented with 10% fetal bovine serum (FBS); all cell lines were maintained at 37°C in 5% CO₂, respectively.

TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to isolate total RNAs from frozen tissues and TSCC cells according to the manufacturer's protocol. Expression of miRNAs was analyzed by mirVana qRT-PCR miRNA detection assay (Ambion) or TaqMan miRNA assay (Applied Biosystems) according to the manufacturer's protocol. TaqMan microRNA assays for U6 was used to normalize the relative abundance of miRNA in the tissues and cell lines.

Cell transfection with anti-miR-NC, anti-miR-24, si-NC or si-FBXW7 was conducted by using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

Specific miRNA-expression plasmids were created by PCR amplification of human genomic DNA fragments. The primers were: miR-24 sense, TGGAAGTTTGAGAGTTGAGCCG and antisense, ACCTTCAAACTCTCAACTCGGC. The PCR products (pre-miRNAs) were cloned into the pcDNA3.1/V5-His-TOPO expression vector (Invitrogen) and confirmed by DNA sequencing. The expression of miRNA was carried out by transfection of the plasmid into the cells using Lipofectamine 2000.

SCC15, SCC25 and Cal27 cells were seeded onto 96-well plates (2×10⁴ cells/well), respectively. The cells were transfected with anti-miR-NC, anti-miR-24, miR-NC, miR-24, si-NC, si-FBXW7, empty vector, FBXW7 vector or cotransfected with the miR-24 and FBXW7 vectors, respectively. After 48 h, cell proliferation was analyzed using Cell Counting Kit-8 (CCK-8; Beyotime) according to the manufacturer's protocol.

SCC15, SCC25 and Cal27 cells were cultured and transfected with anti-miR-NC, anti-miR-24, miR-NC, miR-24, si-NC, si-FBXW7, empty vector, FBXW7 vector or co-transfected with miR-24 and FBXW7 vectors, respectively. Cell migration and invasion assays were performed by using Transwell chambers (Millipore, Billerica, MA, USA). Filters for the invasion assay were precoated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) in the upper compartment. Cells (5×10⁵) were seeded in the upper compartment, and the lower compartment was filled with DMEM supplemented with 10% FBS. After 24 h of incubation, the migratory and invasive cells adherent to the undersurface of the filters were fixed, stained with crystal violet and four random fields were counted for each group.

A FBXW7 3′UTR luciferase reporter was created. Briefly, complementary 48-mer DNA oligonucleotides containing the putative binding site of miR-24 were synthesized with flanking MluI and HindIII restriction enzyme digestion sites. The pmirGLO Dual-Luciferase miRNA Target expression vector (Promega, Madison, WI, USA; E1910 expressing both firefly and Renilla) was employed to construct the luciferase reporter vector. Double-stranded oligonucleotides corresponding to the wild-type (wt-3′UTR) or mutant (mu-3′UTR) miR-24 binding site in the FBXW7 3′UTR were synthesized (Sangon Biotech) and ligated between the XolI and SbfI restriction sites of the reporter plasmid pmirGLO (Promega). The sequences of inserted fragments were confirmed by sequencing.

HEK293T cells were transfected with wild-type pmir-FBXW7-3′UTR or mutant pmir-FBXW7-3′UTR, and the Renilla luciferase control vector (pRL-TK; Promega) using Lipofectamine 2000, and then the cells were transfected with miR-NC or miR-24, respectively. Luciferase activities were measured at 24 h after transfection by using a dual-luciferase assay kit (E1330; Promega). Firefly luciferase activities were normalized to Renilla luciferase activities.

To isolate the proteins, cells harvested from 6-well plates were washed once in phosphate-buffered saline and lysed in lysis buffer. Protein lysates were separated on 10% Tris-glycine polyacrylamide gel and then transferred to a polyvinylidene fluoride (PVDF) membrane (Zhongshan Biotechnology Co. Ltd., Beijing, China). Then, the membrane was incubated with monoclonal antibodies against FBW7, c-Myc and c-Jun, followed by incubation with HRP (horse-radish peroxidase)-labeled goat-anti-mouse IgG (Santa Cruz Biotechnology, Inc., TX, USA). β-actin was used as a protein loading control. The intensity of the protein was quantified with the Quantity software LANE-1D analyzer (SmartGel; Sage Creation).

Data were analyzed using the Statistical Package for the Social Sciences (SPSS, Chicago, IL, USA), version 17.0. All values are presented as mean ± standard deviation (SD). One-way ANOVA and two-tail Student's t-test were used to analyze the results. A p-value <0.05 was considered to indicate statistical significance.

To detect whether there was any difference in the miR-24 expression level between TSCC tissues and adjacent non-tumor tissues, a total of 84 paired TSCC tissues and adjacent non-tumor tissue samples were subjected to qRT-PCR. Compared with the matched non-tumor tissues, the expression level of miR-24 was significantly increased in the TSCC tissues (Fig. 1A). Furthermore, the association of miR-24 with clinicopathologic factors of the TSCC cases was examined. miR-24 overexpression was associated with advanced clinical stage (Fig. 1B). Kaplan-Meier survival analysis showed that the overall survival of TSCC patients with high miR-24 expression was significantly shorter than that with low miR-24 expression (Fig. 1C). In additional, miR-24 expression was significantly higher in six TSCC cell lines (UM1, UM2, Cal27, SCC1, SCC15 and SCC25) compared with that in the non-tumorigenic cells (NHOK) (Fig. 1D).

To determine whether miR-24 promotes the proliferation, migration and invasion potential of TSCC cells, we carried out experiments using CCK-8, migration and invasion assays. Briefly, SCC15 and SCC25 cells were transfected with anti-miR-NC or anti-miR-24 for 24 h, and Cal27 cells were transfected with miR-NC or miR-24 for 24 h, followed by analysis of the proliferation, migration and invasion of the cells, respectively. The data showed that expression of miR-24 in the SCC15 and SCC25 cells transfected with anti-miR-24 was significantly decreased by qRT-PCR (Fig. 2A), whereas expression of miR-24 was markedly increased in the Cal27 cells (Fig. 2E). Furthermore, transfection of anti-miR-24 significantly suppressed the proliferation, migration and invasion of the SCC15 and SCC25 cells compared to these parameters in the control group (Fig. 2B–D), whereas miR-24 markedly enhanced the proliferation, migration and invasion of Cal27 cells (Fig. 2F–H). Together, miR-24 regulates the proliferation, migration and invasion of TSCC cells.

To explore the molecular mechanism of miR-24 in TSCC, we searched for candidate target genes using bioinformatics algorithms of TargetScan. We focused on tumor-suppressor gene FBXW7, which has one potential miR-24 binding site within its 3′UTR.

To identify whether FBXW7 is a target of miR-24, we constructed vectors containing the wild-type 3′UTR or mutant 3′UTR of FBXW7 mRNA, which was individually fused directly downstream of the firefly luciferase gene (Fig. 3A). For the luciferase assays, the wild-type or mutant vector was co-transfected into HEK293T cells with miR-NC or miR-24. Luciferase reporter assay showed that miR-24 could inhibit the luciferase activity of the wild-type 3′UTR of the FBXW7 reporter vector but not the mutant 3′UTR (Fig. 3B). Furthermore, we confirmed that overexpression of miR-24 could decrease FBXW7 mRNA levels, whereas inhibition of miR-24 increased the FBXW7 mRNA levels (Fig. 3C). Moreover, FBXW7 protein abundance was also negatively regulated by miR-24 (Fig. 3D). Together, miR-24 downregulated FBXW7 expression by directly targeting the 3′UTR of FBXW7.

To investigate the effect of FBXW7 on tumorigenicity, we designed experiments in which the SCC15 and SCC25 cells were transfected with si-NC, si-FBXW7, empty vector and FBXW7 vector. The results showed that the growth and motility of the SCC15 and SCC25 cells were markedly promoted or suppressed after transfection with si-FBXW7 or the FBXW7 vector, respectively (Fig. 4A–C), suggesting that FBXW7 suppresses the proliferation, migration and invasion of TSCC cells. To further assess whether the effect of miR-24 on tumorigenicity was via targeting FBXW7, we carried out functional experiments. Briefly, the SCC15 and SCC25 cells were transfected with miR-NC, miR-24 or co-transfected with miR-24 and FBXW7. The growth and motility of the SCC15 and SCC25 cells were significantly enhanced after transfection with miR-24 compared with the control group, whereas the restoration of FBXW7 antagonized miR-24 in regards to the migration, invasion and proliferation (Fig. 4D–F). Furthermore, western blotting showed that FBXW7 expression was markedly decreased in the TSCC cells after transfection with miR-24, and was restored when the TSCC cells were co-transfected with miR-24 and FBXW7, and subsequently inversely regulated its downstream targets c-Myc and c-Jun (Fig. 4G). Together, these findings suggest that miR-24 promotes the proliferation, migration and invasion, at least partially by targeting FBXW7.