Eighty cases of breast cancer tissues including 65 cases of breast cancer and 15 cases of non-tumor tissues were collected from the Department of Clinical Laboratory, Nanjing Medical University Cancer Hospital and Jiangsu Cancer Hospital from 2008 to 2010. The clinical staging of breast cancer was evaluated by the tumor-node-metastasis (TNM) staging systems. The samples were used with the written informed consent from patient and approval of the Ethics Committee of Nanjing Medical University Cancer Hospital and Jiangsu Cancer Hospital. All tissue samples were paraffin-embedded, dewaxed and rehydrated. The sections were then microwaved for antigen rerieval. For immunohistochemical staining, slides were treated with hydrogen peroxide (H₂O₂) for 10 min, washed with water and placed in phosphate-buffered saline (PBS) buffer. Anti-cyclin Y (1:150; #ab114086; Abcam) was then applied for incubation at room temperature. Biotinylated goat anti-rabbit IgG was used as the secondary antibody. The immunoreactions were detected by staining with 3,3′-diaminobenzidine (DAB). All stained slides were evaluated under a light microscope. In each sample section, at least 5 visual field areas were examined. The proportion of positive tumor cells was recorded according to the following classification: 0, no cells stained; 1, <30% of cells stained; 2, 30–60% of cells stained and 3, >60% of cells stained. The intensity of the coloring was recorded according to the following classification: 0, no coloring; 1, stramineous; 2, buffy; and 3, dark brown. The two scores were combined to obtain the final one: scores equal to 0 indicate negative (−), 1–2 indicate slightly positive (+), 3–4 indicate moderately positive (++), and 5–6 indicate strongly positive (+++).

Human breast cancer cell lines BT-474, MDA-MB-231, T-47D and MCF-7 and human embryonic kidney cell line 293T were obtained from the Cell Bank of Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). BT-474 cells were cultured in RPMI-1640 medium (HyClone) supplemented with 10% fetal bovine serum (FBS) in 5% CO₂ at 37°C. MDA-MB-231, T-47D and 293T cells were grown in Dulbecco's modified Eagle's medium (DMEM; HyClone) supplemented with 10% FBS in 5% CO₂ at 37°C. MCF-7 cells were cultured in DMEM supplemented with 10% FBS, 1% sodium pyruvate and 0.01 mg/ml bovine insulin in 5% CO₂ at 37°C.

A short hairpin RNA (shRNA) sequence (CCGGCAGGACAAATAGCAAGGAAATCTC GAGATTTCCTTGCTATTTGTCCTGTTTTTTG) was designed for human cyclin Y gene (NM_145012.3). The non-silencing siRNA sequence (TTCTCCGAACGTGTCACGT) was used as control. The stem-loop-stem oligos (shRNAs) were ligated into the pFH-L vector containing a GFP reporter (Shanghai Hollybio, China). 293T cells were transfected with pFH-L-cyclin Y shRNA or control shRNA along with two helper plasmids pVSVG-I and pCMV∆R8.92 (Shanghai Hollybio, China) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Lentiviruses were harvested 72 h after transfection. The lentiviruses were purified using ultracentrifugation, and the titer of the lentiviruses was determined. MDA-MB-231 (5×10⁴ cells/well) and MCF-7 (5×10⁴ cells/well) cells were cultured in 6-well plates and infected with the lentivirus constructs at a multiplicity of infection (MOI) of 40 and 30, respectively. The transfection efficiency was determined by fluorescence microscopy 96 h after infection.

After infection for 96 h, MDA-MB-231 and MCF-7 cells were collected for RNA extraction by TRIzol (Invitrogen, Carlsbad, CA, USA). Total RNA (2 µg) was reverse transcribed using an M-MLV reverse transcriptase kit (Promega) according to the manufacturer's protocol. In quantitative real-time PCR, two sets of primers were applied: cyclin Y sense, 5′-GTCAGTCAACCAAACCTCAAG-3′ and antisense, 5′-AACAGTGTCCGAACGAACC-3′; β-actin sense, 5′-GTGGACATCCGCAAAGAC-3′ and antisense, 5′-AAAGGGTGTAACGCAACTA-3′. Relative expression levels of cyclin Y mRNA were calculated by normalizing to the level of β-actin mRNA using comparative threshold cycle method, in which the fold difference = 2 − (Δct of target gene − Δct of reference). Each sample was performed in triplicate. All results were analyzed with LightCycler software version 3.5 (Roche Diagnostics).

After infection with recombined lentiviruses (Lv-shCCNY and Lv-shCon), MDA-MB-231 (2×10³ cells/well) or MCF-7 (2×10³ cells/well) cells were reseeded into 96-well plates, and were collected at 1-day intervals to perform the methylthiazol tetrazolium (MTT) proliferation assay. In brief, 10 µl of MTT solution (5 mg/ml; Sigma) was added into each well and incubated at 37°C for 4 h. Acidic isopropanol (10% SDS, 5% isopropanol and 0.01 mol/l HCl) was then added to dissolve the crystals. After 10 min, the absorbance of each sample was recorded at 595 nm.

MDA-MB-231 (400 cells/well) or MCF-7 (200 cells/well) cells were reseeded in 6-well plates after lentivirus infection. The medium was changed at three-day intervals. After 6 days of culture for MDA-MB-231 cells and 8 days of culture for MCF-7 cells, the colonies formed were washed with PBS and fixed with 4% paraformaldehyde for 30 min at room temperature. The fixed cell samples were stained with crystals violet for 10 min. The total number of colonies (>50 cells/colony) was counted.

Fluorescence dye propidium iodide (PI) (Sigma) was used to analyze the DNA contents in different cell cycle phases. MDA-MB-231 (2×10⁵ cells/well) cells infected with Lv-shcyclin Y and Lv-shCon were reseeded into 6-cm dishes and cultured for 40 h and harvested after trypsinization, washed with PBS and fixed with 70% cold ethanol. The fixed cells were pelleted, re-suspended in PBS containing PI (100 µg/ml) and RNase A (10 µg/ml) for at least 30 min in the dark. The percentages of cells in G0/G1, S and G2/M phases were determined by FACSCalibur (BD Biosciences, USA).

Phosphorylation and proteolysis are two widespread covalent post-translational modifications. Detection of these modifications on a set of cellular proteins that play a well-understood role in cell biology can provide a broad snapshot of intracellular signaling. The alteration of signaling molecules in MDA-MB-231 cells was detected by PathScan^® intracellular signaling array kit (#7323; Cell Signaling Technology) according to the protocol provided by CST.

The results of immunohistochemical staining were evaluated by Pearson's χ² test and the other data were evaluated by Student's t-test and expressed as the mean ± SD of three independent experiments. A p-value of <0.05 was considered to indicate a statistically significant result.

The expression patterns of cyclin Y protein in 65 stage I-III breast cancer and 15 normal breast tissues were analyzed by immunohistochemistry. Representative immunohistochemical staining is shown in Fig. 1. The rate of strong cyclin Y expression (+++) in breast cancer tissues was significantly higher than that in normal breast tissues (Table I; p<0.05; χ² test). Moreover, the expression of cyclin Y in breast cancer was associated with lymph node metastasis (Table II; p<0.001; χ² test). These results suggest that the high cyclin Y expression may contribute to breast cancer development and progression.

The expression levels of cyclin Y in four human breast cancer cell lines were analyzed by RT-qPCR (Fig. 2A). The MCF-7 (ER-positive) cells with high cyclin Y expression and MDA-MB-231 (ER-negative) cells with low cyclin Y expression were chosen for further investigation. The cells were treated with Lv-shcyclin Y and Lv-shCon. To determine the transfection efficiency, fluorescent cells were examined and photographed. As shown in Fig. 2D, >80% of cells were GFP-positive, indicating that both MCF-7 and MDA-MB-231 cells were successfully transfected. The mRNA levels of cyclin Y were then measured to assess the knockdown efficiency of Lv-shcyclin Y. As compared to Lv-shCon, the Lv-shcyclin Y conferred ~60% knockdown efficiency in both MDA-MB-231 (Fig. 2B) and MCF-7 cells (Fig. 2C). The results indicated that the lentivirus constructs were able to efficiently suppress cyclin Y expression in both MDA-MB-231 and MCF-7 cells.

To evaluate the biological effect of cyclin Y knockdown in regulating breast cancer cell proliferation, MTT and colony formation assays were used. As shown in Fig. 3, the growth curves of Lv-shcyclin Y groups were much lower than those of Lv-shCon and control groups in both MDA-MB-231 and MCF-7 cells. The results showed that the Lv-shcyclin Y had a short-term inhibitory effect on cell proliferation. Moreover, we further determined its relative long-term function on cell proliferation by colony formation assay. As revealed in Fig. 4A, the size of single colony in the Lv-shcyclin Y group was much smaller than that in Lv-shCon and control groups. Also, the total number of colonies formed in MDA-MB-231 cells was markedly reduced by over 80% in the Lv-shcyclin Y group (Fig. 4B). These results indicated that cyclin Y knockdown inhibited the proliferation of breast cancer cells.

To investigate whether cyclin Y regulates cell cycle progression directly, we then examined the cell cycle distribution of MDA-MB-231 cells after cyclin Y knockdown by flow cytometry. As shown in Fig. 5, compared with control and Lv-shCon groups, the proportion of cells increased in the G0/G1 phase and decreased in the G2/M phase, indicating that cyclin Y could be involved in the cell cycle regulation.

To explore the underlying signaling pathways mediated by cyclin Y in breast cancer cells, PathScan^® intracellular signaling array kit was utilized to test whether alterations of modifications occurred in proteins involved in cell proliferation, growth, cell cycle, survival or apoptosis (Fig. 6). The detection of signaling pathways contained the MAPK/ERK cascade, p38 and JNK MAPKs, Stat1 and Stat3, Akt, mTOR, AMPK, HSP27, p53, and caspase-3. To our surprise, knockdown of cyclin Y in MDA-MB-231 cells resulted in a series of phosphorylation, including Bad (Ser112), p53 (Ser15), GSK3β (Ser9), as well as cleavage of PARP and caspase-3 (Table III). These data indicated that the above signaling pathways could contribute to the regulation of cyclin Y in breast cancer cell growth.