OROncology Reports1021-335X1791-2431D.A. Spandidos10.3892/or.2016.5276or-37-01-0333ArticlesCOL11A1 is overexpressed in gastric cancer tissues and regulates proliferation, migration and invasion of HGC-27 gastric cancer cells in vitroLiAiqing12*LiJun12*LinJinping2ZhuoWei3SiJianmin12Department of Gastroenterology, Sir Run Run Shaw Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, P.R. ChinaInstitution of Gastroenterology, Zhejiang University, Hangzhou, Zhejiang, P.R. ChinaLaboratory of Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, P.R. ChinaCorrespondence to: Dr Jianmin Si, Department of Gastroenterology, Sir Run Run Shaw Hospital, Zhejiang University School of Medicine, 3 East Qingchun Road, Hangzhou, Zhejiang 310016, P.R. China, E-mail: jianmin_si@zju.edu.cn
The role of COL11A1 in carcinogenesis is increasingly recognized. However, the biological role and potential mechanisms of COL11A1 in gastric cancer have not been elucidated. In the present study, the COL11A1 mRNA expression in 57 patients with gastric cancer was measured by reverse transcription quantitative PCR (RT-qPCR), and the biological effects of COL11A1 suppression were determined using MTS, monolayer colony formation, flow cytometry and Transwell assays. In addition, the potential molecular mechanisms of COL11A1 in gastric cancer were analyzed by western blotting and cDNA microarray analysis. Compared with matched adjacent non-tumor tissue, COL11A1 mRNA was significantly overexpressed in tumor tissue and was positively related to age, tumor invasion depth, tumor size and lymph node positivity. Moreover, in vitro experiments demonstrated that COL11A1 suppression by short hairpin RNA (shRNA) significantly inhibited the proliferation, migration and invasion of HGC-27 cells and that COL11A1 suppression promoted cell apoptosis, induced G1-phase cell cycle arrest and led to a significant downregulation of cyclin D1 and upregulation of p21 and cleaved caspase-3. In addition, the cDNA microarray analysis of HGC-27 cells with and without COL11A1 suppression indicated that COL11A1 may regulate multiple genes responsible for cell growth and/or invasion, including downregulation of CDK6, TIAM1, ITGB8 and WNT5A and upregulation of RGS2 and NEFL following suppression of COL11A1 expression in HGC-27 cells, validated with RT-qPCR assays. Taken together, our findings demonstrate that COL11A1 might be an oncogene in GC and is a promising therapeutic target in cancer treatment.
Gastric cancer (GC) ranks the third cause of cancer mortality and the fifth most common cancer worldwide (1), while most patients with GC are diagnosed at the advanced stage which means a relatively poor prognosis of overall survival (2). As is well recognized, cancer results from accumulation of multiple molecular alterations in the same cells or their descendants (3). Hence, the identification of genes with oncogenic potential or tumor-suppressing activity may be of great use for diagnosis and treatment.
Previously, Zhao et al used an oligonucleotide microarray containing 38,500 genes in 11 patients with GC to distinguish malignant lesions from premalignant and normal ones, and type XI collagen α1 (COL11A1) gene expression was found upregulated in malignant tissue compared to premalignant tissue (4). As a member of minor fibrillar collagens, COL11A1, encoded by COL11A1 gene located on chromosome 1p21, can be produced by cartilage and a variety of non-cartilaginous tissues, such as bone, vitreous, skin, and heart (5). Alterations of COL11A1, including at least four mRNA variants, can lead to several diseases such as Stickler syndrome type 2 (6), Marshall syndrome (7,8) and lumbar disc disease (9).
Besides, COL11A1 has also been reported to be upregulated in various cancers, including colorectal, pancreatic, and ovarian cancer. Fischer et al first reported that COL11A1 mRNA expression was significantly increased in colorectal cancer tissue compared with normal colonic tissue (10), and studies in pancreatic cancer (11), non-small cell lung cancer (12) and breast cancer (13) have also demonstrated increased levels of COL11A1 in tumor tissue compared with normal tissue. Recent studies have implicated COL11A1 in cancer cell growth and tumorigenicity. For example, COL11A1 knockdown in head and neck squamous cell cancer gave rise to a reduction in cell growth and invasion in vitro (14), and COL11A1 knockdown in ovarian cancer cells led to a decrease in cell proliferation and invasion in vitro and the metastasis of an ovarian tumor xenograft (15). Thus, COL11A1 may represent a potential therapeutic target in need of further investigation.
Considering the limited studies regarding the relationship between COL11A1 and GC, we evaluated the COL11A1 mRNA expression in GC tissue, investigated the possible role of COL11A1 in GC proliferation, cell cycle, apoptosis and invasion and explored the potential molecular mechanisms of COL11A1 in GC cells in the present study.
Materials and methodsEthics statement and clinical tissue samples
This study was approved by the Clinical Research Ethics Committee of Sir Run Run Shaw Hospital of Zhejiang University (Hangzhou, Zhejiang, China) (permit number: 20110225-3200). Giving their informed consents to use their gastric tissue and publish their case details, all 57 consecutive patients who underwent surgery for GC in Sir Run Run Shaw Hospital were enrolled in this study. The histologic classification of gastric carcinoma is based on the 2010 WHO classification system and the clinicopathologic parameters including age, gender, tumor size, depth of invasion and lymph node positivity were obtained. The matched tumor tissues and adjacent non-tumor tissue samples were frozen immediately in liquid nitrogen and were stored at −80°C until RNA extraction.
Cell culture
A total of four poorly differentiated (AGS, MKN-45, BGC-823 and MGC-803), one moderately differentiated (SGC-7901), one undifferentiated (HGC-27) and one well differentiated (MKN-28) gastric cancer cell line were included for the purposes of this study. These cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA) and Type Culture Collection of China Academic Science (Shanghai, China). One normal immortalized gastric epithelial cell line (GES-1) was obtained from the Beijing Institute for Cancer Research (Beijing, China). The cells were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Sijiqing, Huzhou, Zhejiang, China) and were incubated at 37°C in 5% CO2.
Total RNA was extracted using TRIzol reagent (CW Biotech, Beijing, China), and the reverse transcription reaction was performed using 1 µg RNA with a reverse transcription kit (Takara, Otsu, Japan). RT-qPCR reactions were performed using a SYBR green PCR kit (Takara) in a LightCycler® 480 II Real-Time PCR System according to the manufacturer's instructions (Roche Diagnostics, Basel, Switzerland). U6 and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as endogenous controls for tissues and cells, respectively. The RT-qPCR conditions are as follows: one cycle of 95°C for 30 sec, 40 cycles of 95°C for 15 sec and 60°C for 60 sec, melting curve analysis. The mRNA expression levels were determined using the 2−∆Ct method for tissues and the 2−∆∆Ct method for cells. The forward primer sequence is 5′-AGTGGCATCGGGTAGCAATCA-3′ (located in exon 3–4, nt 806–826) and the reverse one is 5′-TGTCCCCCTCAAAAACTTCTTCAT-3′ (located in exon 4–5, nt 953–976). The other primer sequences for the RT-qPCR assays are listed in Table I. All experiments were performed in triplicate.
Western blotting
The cells were washed in cold PBS and lysed in RIPA lysis buffer (Beyotime, Jiangsu, China) on ice for 30 min. The cell lysates were centrifuged at 13,000 × g for 15 min at 4°C, and the total protein concentration was analyzed with the BCA Protein Assay kit (Beyotime). Equal amounts of protein samples were separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels (SDS-PAGE). The proteins were then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 5% nonfat milk and incubated with primary antibodies at 4°C overnight. The proteins were detected using chemiluminescence with a Las-4000 Imaging System (Fujifilm, Tokyo, Japan). The following primary antibodies were used: COL11A1 (1:1000; Abcam, Cambridge, UK), pro-caspase-3 (1:1000; Cell Signaling Technology Inc., Danvers, MA, USA), cleaved caspase-3 (1:1000; Cell Signaling Technology Inc.), cyclin D1 (1:1000; Cell Signaling Technology Inc.), p21 (1:1000; Cell Signaling Technology Inc.), p27 (1:1000; Cell Signaling Technology Inc.), cyclin-dependent kinase 2 (CDK2) (1:500; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), cyclin-dependent kinase 4 (CDK4) (1:500; Santa Cruz Biotechnology Inc.) and β-tubulin (1:1000; CW Biotech). All experiments were performed in triplicate.
Plasmid transfection of stable cell lines
The COL11A1 short hairpin RNA (shRNA) plasmids (HSH002603-2-mH1, GeneCopoeia, Rockville, MD, USA) and COL11A1 vector plasmids (CSHCTR001-mH1, GeneCopoeia) were purchased and transfected into HGC-27 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) to establish stable cell lines. After 48 h, the transfectants were selected with 3 µg/ml puromycin (Amresco, Cleveland, OH, USA) for 2 weeks. A positive stably transfected clone was isolated and allowed to grow. Decreased COL11A1 expression was confirmed by RT-qPCR and western blotting. All experiments were performed in triplicate.
Cell proliferation assay
A total of 3×103 stably transfected cells in 100 µl medium were seeded into 96-well plates and incubated for 96 h. Then, 20 µl of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Madison, WI, USA) reagent was added to each well and incubated for 2 h. The absorbance values were measured by a multi-well plate reader (Molecular Devices, Sunnyvale, CA, USA) at 490 nm. All experiments were performed in triplicate.
Colony formation assay
A total of 6×102 cells were plated into six-well plates in triplicate. The plates were incubated at 37°C in 5% CO2 for 10 days, and then the colonies were fixed with methanol and stained with crystal violet before counting. Values are presented as the mean percentage ± SD from three individual experiments, and the number for the COL11A1 vector cells was set to 100%. All experiments were performed in triplicate.
Cell migration and invasion assays
Cell migration was assessed using Transwell migration assays (Corning, Inc., Corning, NY, USA). Briefly, 5×104 cells were plated in the upper chamber in 200 µl medium containing 1% FBS. The lower chamber contained 600 µl medium containing 10% FBS. After 13 h of incubation, the non-migratory cells in the upper chamber were carefully removed with a cotton swab. The migrated cells were fixed with methanol and stained with DAPI. The cell numbers were counted in five random fields (×400 magnification) using a fluorescence microscope. All experiments were performed in triplicate.
Cell invasion was performed in Transwell chambers (Corning, Inc.) coated with BD Matrigel. For this assay, 1×105 cells were plated in the upper chamber in 200 µl of medium containing 1% FBS. The lower chamber was filled with 600 µl of culture medium with 10% FBS. After 24 h, the membranes were fixed with methanol and stained with gentian violet. The cell numbers were counted by microscope in five random fields (×200 magnification). All experiments were performed in triplicate.
Cell apoptosis and cell cycle analysis
For cell apoptosis analysis, 2×105 stable transfected cells were washed in cold PBS and suspended in 1X Annexin V Binding Buffer. Then, 5 µl FITC Annexin V (Becton Dickinson, San Jose, CA, USA) and 5 µl PI (Becton Dickinson) solutions were added. After incubation for 15 min, the stained cells were analyzed by flow cytometry on a FACScan analyzer (Becton Dickinson). All experiments were performed in triplicate.
For cell cycle analysis, 2×105 stably transfected cells were harvested and washed in PBS. Cellular DNA was stained in the dark by a Cell Cycle Staining kit (Multisciences Biotech, Hangzhou, Zhejiang, China) for 30 min at room temperature. The cells were then analyzed by flow cytometry, and the cell cycle distribution was determined using ModFit LT software (Verity Software House, Topsham, ME, USA). All experiments were performed in triplicate.
cDNA microarray analysis
Total RNA was extracted from stably transfected HGC-27 cells with COL11A1 shRNA and COL11A1 vector. Total RNA was amplified, labeled and purified to obtain biotin-labeled cDNA. The labeled cDNA were hybridized to probes on Affymetrix U133 plus 2.0 arrays (Shanghai Biotechnology Corporation, Shanghai, China). The microarray data were analyzed using Gene Spring Software 11.0. We selected fold change (shRNA/vector) >3 or <0.333 as the threshold for upregulation or downregulation. The potential target genes were verified with RT-qPCR.
Statistical analysis
Wilcoxon matched pairs test was performed to compare paired data, Mann-Whitney U test was used to analyze and compare the medians of continuous variables, and Student's t-test was performed to compare two independent data. A value of p<0.05 was considered statistically significant. All data were analyzed using IBM SPSS Statistics 20.0.
Results
We used RT-qPCR analysis to measure the COL11A1 mRNA expression and found that the COL11A1 mRNA expression level was significantly overexpressed in 57 GC tissues compared to matched adjacent non-tumor gastric tissue (p<0.0001, Fig. 1).
In 2/57 patients distant metastases occurred (liver and peritoneum, respectively), and 56/57 patients were diagnosed with gastric cancer of the adenocarcinoma subtype, while the remaining patient was diagnosed with an undifferentiated gastric carcinoma. The relationship between clinicopathological features and COL11A1 expression in GC is shown in Table II. COL11A1 mRNA expression was significantly positively related to age, tumor invasion depth, tumor size and lymph node positivity (p<0.05, p<0.01, p<0.05 and p<0.05, respectively), while there were no significant associations between COL11A1 expression and patient gender (p>0.05) and degree of differentiation (p>0.05) in GC.
To determine which cell lines to use for further study, we compared COL11A1 mRNA and protein expression levels in seven GC cell lines (SGC-7901, MGC-803, BGC-823, HGC-27, AGS, MKN-28, and MKN-45) with expression levels in normal immortalized epithelial cells (GES-1) by RT-qPCR and western blotting. The results showed that the relative COL11A1 mRNA expression was higher in HGC-27 cells but lower in the other six GC cells (Fig. 2A), while similar results were observed by western blotting (Fig. 2B). Hence, HGC-27 was the only chosen GC cell line for further analysis.
To validate whether COL11A1 contributed to GC proliferation, migration and invasion, we transfected HGC-27 cells with a plasmid encoding COL11A1-silencing shRNA (COL11A1 shRNA) or COL11A1 vector shRNA (COL11A1 vector). The decreased COL11A1 mRNA and protein expression levels were confirmed by RT-qPCR and western blotting (Fig. 3A).
Then, we examined whether COL11A1 contributed to GC cell proliferation. The results of MTS assays showed significant cell growth inhibition in COL11A1 shRNA HGC-27 cells compared with COL11A1 vector cells (p<0.01 at 48, 72 and 96 h) (Fig. 3B). Consistently, the number of surviving colonies formed on the plates in COL11A1 shRNA HGC-27 cells was also significantly reduced compared with COL11A1 vector cells (p<0.01) (Fig. 3C). Thus, COL11A1 contributed to cell proliferation in GC cells in vitro.
Next, Transwell migration and invasion assays were performed, and the results demonstrated that COL11A1 knockdown in HGC-27 cells significantly suppressed migration (p<0.01) and invasion (p<0.01), respectively (Fig. 3D and E).
Cumulatively, these results indicated that COL11A1 played a role in cell proliferation, migration and invasion of HGC-27 GC cells in vitro.
To explore the underlying mechanisms of the growth inhibition by COL11A1 knockdown, we assessed cell apoptosis and cell cycle by flow cytometry. COL11A1 suppression significantly induced apoptosis compared with COL11A1 vector (Fig. 4A and Table III), and a significant accumulation of cells in G1 phase was observed in COL11A1 knockdown cells compared to that in COL11A1 vector cells (Fig. 4B and Table III). Then, we further evaluated expression levels of several cell cycle and apoptosis-related proteins, and we found that COL11A1 suppression led to upregulation of the cell cycle inhibitor p21 but not p27 and reduced cyclin D1 but not CDK2 and CDK4. We also found activation of the apoptotic protein caspase-3 (Fig. 4C).
cDNA microarray in HGC-27 cells with and without COL11A1 knockdown was performed to identify potential downstream genes of COL11A1 in GC, and the results indicated that COL11A1 suppression altered the expression of multiple genes involved in cell proliferation and invasion (Fig. 5A). The results of RT-qPCR further confirmed that CDK6, TIAM1, XIAP, ITGB8 and WNT5A were downregulated, and RGS2 and NEFL were upregulated by COL11A1 suppression in HGC-27 cells (Fig. 5B). These results suggested that COL11A1 may play a role in tumor development and progression through regulation of these genes.
Discussion
The gradual accumulation of genetic alternations contributes to the development and progression of cancers. In the present study, we observed that overexpression of COL11A1 mRNA was related to tumor age, tumor size, depth of invasion and lymph node positivity, and that COL11A1 could regulate cell proliferation, migration and invasion through several potential downstream genes.
Several lines of evidence indicate that COL11A1 expression is upregulated in various cancers such as ovarian (15), colorectal (10), breast (13), pancreatic (16) and head and neck squamous cell (14) cancers, suggesting an oncogenic role of COL11A1 in carcinogenesis. However, the role of COL11A1 in GC has not been elucidated. This study demonstrated that COL11A1 mRNA was overexpressed in 57 GC tissues compared with matched non-tumor tissues by RT-qPCR analysis, which is consistent with previous studies (4). In addition, we analyzed the relationship between COL11A1 mRNA expression and clinicopathological characteristics. Consistent with a previous report in GC by Affymetrix analysis (17), COL11A1 mRNA expression in the advanced GC was significantly higher than that in the early GC. Besides, high COL11A1 expression was positively related to tumor age, tumor size and lymph node positivity, which indicates COL11A1 may be involved in GC growth and invasion. These results supports that COL11A1 may play a role in GC proliferation and invasion.
To study the biological effects of COL11A1 in GC, we examined COL11A1 expression in seven GC cell lines and one GES-1 cell line and found that HGC-27 was the only cell line showing COL11A1 upregulation compared to GES-1. The reason why COL11A1 is overexpressed in only one cancer cell line, out of seven, compared to normal cells needs further explanation. From our perspective, one explanation may be that HGC-27, a kind of undifferentiated and relatively less attached cell, is much more aggressive than the other six cells. Finally, we chose HGC-27 for the next study.
Based on depletion experiments in vitro, we found that silencing of COL11A1 significantly decreased the proliferation, migration and invasion of HGC-27 cells, which is consistent with two previous reports in ovarian cancer (15) and head and neck squamous cell cancer (14). Furthermore, we studied the cell cycle and apoptosis using flow cytometry, and the results showed that COL11A1 suppression significantly induced cell cycle arrest at G1 phase and promoted cell apoptosis. G1/S phase transition is a major checkpoint for cell cycle progression. Cyclin D1, forming functional kinase complexes with CDK4 or CDK6, is a periodic regulatory protein that governs cell cycle transit from G1 phase into S phase and is abnormally expressed in many human cancers (18,19). There are also inhibitory proteins preventing the cell cycle. Among these inhibitors, p21, a potent cyclin-dependent kinase inhibitor binds and inhibits the activity of cyclin D1-CDK4/6 complexes controlling the transition from G1 to S phase (20). In the present study, western blotting demonstrated that suppression of COL11A1 decreased cyclin D1 expression and increased p21 expression. However, there was no significant effect on CDK2, CDK4 or p27. These results suggest that G1/S cell cycle arrest induced by COL11A1 suppression is mediated through the p21 and cyclin D1 pathway. In addition, caspase-3 is a well-recognized indicator of cellular apoptosis (21) and is activated in apoptotic cells by both the extrinsic and intrinsic pathways (22). Our data indicated that COL11A1 suppression increased cleaved caspase-3 levels in HGC-27 cells, and thus promoted apoptosis of HGC-27 cells. Further studies are required to determine whether the extrinsic or intrinsic pathway is involved. Despite several attempts, we failed to establish a successful nude mouse model to investigate the role of COL11A1 in vivo.
The molecular mechanisms of COL11A1 action in cancers remain unclear, and the only pathway studied is the COL11A1-TGF-β1-MMP3 axis through which COL11A1 promotes ovarian cancer aggressiveness. Therefore, we studied the molecular mechanisms of COL11A1 in GC by cDNA microarray. Numerous genes were altered in cells with COL11A1 knockdown compared to cells with COL11A1 vector, and the representative potential target genes have been previously reported to participate in cell growth, migration and invasion. As a member of the inhibitor of apoptosis protein gene family, XIAP can inhibit caspases and suppress apoptosis, and a previous study showed that downregulation of XIAP induced apoptosis was related to activation of caspase-3 in GC (23). CDK6, important for the G1 phase progression and G1/S transition, was upregulated in many cancers (24). Another COL11A1 potential target gene, RGS2, was also involved in cell growth in breast cancer (25) and prostate cancer (26). In addition to the regulation of cell proliferation pathways, COL11A1 downregulation decreased TIAM1 which was involved in cell invasion in retinoblastoma (27) and gastric cancer (28). Furthermore, NEFL, a putative tumor suppressor gene, can inhibit cell proliferation and invasion in head and neck squamous cell carcinoma (29) and neuroblastoma (30). We further validated that CDK6, TIAM1, XIAP, ITGB8 and WNT5A were downregulated, while RGS2 and NEFL were upregulated in HGC-27 cells with COL11A1 suppression using RT-qPCR analysis. Thus, the identification of potential target genes of COL11A1 supported the hypothesis that COL11A1 may modulate potential downstream genes to regulate cell proliferation and invasion in GC.
In conclusion, our study indicates that COL11A1 may play an oncogenic role in the proliferation, migration and invasion in gastric cancer and may be a promising therapeutic target in cancer treatment. Further study is needed to clarify the potential specific molecular mechanisms of COL11A1 in gastric cancer.
Acknowledgements
This study was supported by the National Natural Science Foundation of China (81101836, 81372623), Zhejiang Province Key Science and Technology Innovation Team (2013TD13), and Zhejiang Province medicine health platform and study plan (YH52013004).
ReferencesFerlayJSoerjomataramIDikshitREserSMathersCRebeloMParkinDMFormanDBrayFCancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012Int J Cancer136E359E386201510.1002/ijc.2921025220842RohatgiPRYaoJCHessKSchnirerIRashidAMansfieldPFPistersPWAjaniJAOutcome of gastric cancer patients after successful gastrectomy: Influence of the type of recurrence and histology on survivalCancer10725762580200610.1002/cncr.2231717075877VogelsteinBKinzlerKWThe multistep nature of cancerTrends Genet9138141199310.1016/0168-9525(93)90209-Z8516849ZhaoYZhouTLiAYaoHHeFWangLSiJA potential role of collagens expression in distinguishing between premalignant and malignant lesions in stomachAnat Rec (Hoboken)292692700200910.1002/ar.2087419306436YoshiokaHGreenwelPInoguchiKTruterSInagakiYNinomiyaYRamirezFStructural and functional analysis of the promoter of the human alpha 1(XI) collagen geneJ Biol Chem270418424199510.1074/jbc.270.1.4187814404RichardsAJYatesJRWilliamsRPayneSJPopeFMScottJDSneadMPA family with Stickler syndrome type 2 has a mutation in the COL11A1 gene resulting in the substitution of glycine 97 by valine in alpha 1 (XI) collagenHum Mol Genet513391343199610.1093/hmg/5.9.13398872475KhalifaOImtiazFAllamRAl-HassnanZAl-HemidanAAl-ManeKAbuharbGBalobaidASakatiNHylandJA recessive form of Marshall syndrome is caused by a mutation in the COL11A1 geneJ Med Genet49246248201210.1136/jmedgenet-2012-10078322499343GriffithAJSprungerLKSirko-OsadsaDATillerGEMeislerMHWarmanMLMarshall syndrome associated with a splicing defect at the COL11A1 locusAm J Hum Genet62816823199810.1086/30178995293471377029MioFChibaKHiroseYKawaguchiYMikamiYOyaTMoriMKamataMMatsumotoMOzakiKA functional polymorphism in COL11A1, which encodes the alpha 1 chain of type XI collagen, is associated with susceptibility to lumbar disc herniationAm J Hum Genet8112711277200710.1086/522377179993642276353FischerHStenlingRRubioCLindblomAColorectal carcinogenesis is associated with stromal expression of COL11A1 and COL5A2Carcinogenesis22875878200110.1093/carcin/22.6.87511375892BadeaLHerleaVDimaSODumitrascuTPopescuICombined gene expression analysis of whole-tissue and microdissected pancreatic ductal adenocarcinoma identifies genes specifically overexpressed in tumor epitheliaHepatogastroenterology5520162027200819260470ChongIWChangMYChangHCYuYPSheuCCTsaiJRHungJYChouSHTsaiMSHwangJJGreat potential of a panel of multiple hMTH1, SPD, ITGA11 and COL11A1 markers for diagnosis of patients with non-small cell lung cancerOncol Rep16981988200617016581FengYSunBLiXZhangLNiuYXiaoCNingLFangZWangYZhangLDifferentially expressed genes between primary cancer and paired lymph node metastases predict clinical outcome of node-positive breast cancer patientsBreast Cancer Res Treat103319329200710.1007/s10549-006-9385-717123152SokJCLeeJADasariSJoyceSContrucciSCEgloffAMTrevellineBKJoshiRKumariNGrandisJRCollagen type XI α1 facilitates head and neck squamous cell cancer growth and invasionBr J Cancer10930493056201310.1038/bjc.2013.624242319533859935WuYHChangTHHuangYFHuangHDChouCYCOL11A1 promotes tumor progression and predicts poor clinical outcome in ovarian cancerOncogene3334323440201410.1038/onc.2013.30723934190García-PraviaCGalvánJAGutiérrez-CorralNSolar-GarcíaLGarcía-PérezEGarcía-OcañaMDel Amo-IribarrenJMenéndez-RodríguezPGarcía-GarcíaJde Los ToyosJROverexpression of COL11A1 by cancer-associated fibroblasts: Clinical relevance of a stromal marker in pancreatic cancerPLoS One8e78327201310.1371/journal.pone.0078327241949203808536VecchiMNuciforoPRomagnoliSConfalonieriSPellegriniCSerioGQuartoMCapraMRoviaroGCAvesaniE ContessiniGene expression analysis of early and advanced gastric cancersOncogene2642844294200710.1038/sj.onc.121020817297478HunterTPinesJCyclins and cancerII: Cyclin D and CDK inhibitors come of age. Cell795735821994KozarKSicinskiPCell cycle progression without cyclin D-CDK4 and cyclin D-CDK6 complexesCell Cycle4388391200510.4161/cc.4.3.155115738651YoonMKMitreaDMOuLKriwackiRWCell cycle regulation by the intrinsically disordered proteins p21 and p27Biochem Soc Trans40981988201210.1042/BST2012009222988851SalvesenGSCaspases: Opening the boxes and interpreting the arrowsCell Death Differ935200210.1038/sj.cdd.440096311803369GhavamiSHashemiMAndeSRYeganehBXiaoWEshraghiMBusCJKadkhodaKWiechecEHalaykoAJApoptosis and cancer: Mutations within caspase genesJ Med Genet46497510200910.1136/jmg.2009.06694419505876TongQSZhengLDWangLZengFQChenFMDongJHLuGCDownregulation of XIAP expression induces apoptosis and enhances chemotherapeutic sensitivity in human gastric cancer cellsCancer Gene Ther12509514200515706355WiedemeyerWRDunnIFQuayleSNZhangJChhedaMGDunnGPZhuangLRosenbluhJChenSXiaoYPattern of retinoblastoma pathway inactivation dictates response to CDK4/6 inhibition in GBMProc Natl Acad Sci USA1071150111506201010.1073/pnas.1001613107205345512895056LyuJHParkDWHuangBKangSHLeeSJLeeCBaeYSLeeJGBaekSHRGS2 suppresses breast cancer cell growth via a MCPIP1-dependent pathwayJ Cell Biochem116260267201510.1002/jcb.2496425187114WolffDWXieYDengCGatalicaZYangMWangBWangJLinMFAbelPWTuYEpigenetic repression of regulator of G-protein signaling 2 promotes androgen-independent prostate cancer cell growthInt J Cancer13015211531201210.1002/ijc.26138215001903155664SubramanianNNavaneethakrishnanSBiswasJKanwarRKKanwarJRKrishnakumarSRNAi mediated Tiam1 gene knockdown inhibits invasion of retinoblastomaPLoS One8e70422201310.1371/journal.pone.0070422239509313737373ZhuJMYuPWDownregulation of T-cell lymphoma invasion and metastasis-inducing factor 1 induces cytoskeletal rearrangement and inhibits the invasive capacity of gastric cancer cellsMol Med Rep8425433201323754572HuangZZhuoYShenZWangYWangLLiHChenJChenWThe role of NEFL in cell growth and invasion in head and neck squamous cell carcinoma cell linesJ Oral Pathol Med43191198201410.1111/jop.1210923992471CapassoMDiskinSCimminoFAciernoGTotaroFPetrosinoGPezoneLDiamondMMcDanielLHakonarsonHCommon genetic variants in NEFL influence gene expression and neuroblastoma riskCancer Res7469136924201410.1158/0008-5472.CAN-14-0431253122694253722
RT-qPCR analysis of COL11A1 mRNA expression in GC patients. The relative expression of COL11A1 mRNA was significantly increased in GC tissues compared with matched adjacent non-tumor tissues by RT-qPCR (n=57, p<0.0001).
COL11A1 expression in seven GC cell lines compared with normal immortalized epithelial cells (GES-1). (A) The COL11A1 mRNA expression was higher in HGC-27 cells but lower in the other six GC cells (SGC-7901, MGC-803, BGC-823, AGS, MKN-28, and MKN-45) compared with GES-1 by RT-qPCR analysis. (B) COL11A1 protein expression levels were higher in HGC-27 cells but lower in the other six GC cells (SGC-7901, MGC-803, BGC-823, AGS, MKN-28, and MKN-45) compared with GES-1 by western blotting.
Suppressing COL11A1 inhibits the proliferation, migration and invasion of HGC-27 cells in vitro. (A) Decreased COL11A1 expression in HGC-27 GC cells was confirmed by RT-qPCR (left) and western blotting (right). (B) The MTS assays showed that COL11A1 suppression significantly inhibited proliferation. (C) The monolayer colony formation assays showed that COL11A1 suppression significantly inhibited proliferation. (D) Transwell migration assays of COL11A1 downregulated HGC-27 cells showed that silencing COL11A1 significantly inhibited cell migration. (E) Transwell invasion assays of COL11A1 downregulated HGC-27 cells showed that suppressing COL11A1 significantly inhibited cell invasion. The asterisk indicates statistical significance (*p<0.05, **p<0.01).
COL11A1 suppression induces cell apoptosis and cell cycle inhibition in HGC-27 cells. (A) The rate of cell apoptosis was increased in cells with COL11A1 suppression. Region A1 indicates early apoptotic cells, while region A2 indicates late apoptotic cells. (B) Suppression of COL11A1 significantly increased the proportion of cells at G1 phase from 28.57±0.24% to 36.34±0.38%. (C) COL11A1 suppression arrested cells at G1 phase of the cell cycle by downregulating protein expression of cyclin D1 and upregulating protein expression of p21, while induced apoptosis by upregulating protein expression of cleaved caspase-3. Band densities were normalized to β-tubulin expression.
Gene expression changes by COL11A1 suppression in HGC-27 cells. (A) The representative gene expression profiles in HGC-27 cells with stably transfected COL11A1 shRNA compared with COL11A1 vector are indicated on the right side of this heatmap image. Green indicates small values, progressing to red for higher values. (B) The expression of nine potential target genes was verified by RT-qPCR. Log2 fold change of relative expression levels in COL11A1 shRNA HGC-27 cells were compared with that in COL11A1 vector, which was normalized to 1. ◻, RT-qPCR data; ◼, results of cDNA microarray.
The forward and reverse primer sequences used in experimental procedures.
Gene name
Primer sequences
XIAP
F: GACAGTATGCAAGATGAGTCAAGTCA
R: GCAAAGCTTCTCCTCTTGCAG
NEFL
F: AGCTGGAGGACAAGCAGAAC
R: TGCCATTTCACTCTTTGTGG
RGS2
F: GTTGGGTAGTGAATCAGGAAGC
R: GACCACCTATTCCCTTCTTGC
ITGB8
F: GGCCAAGGTGAAGACAATAGA
R: ATCCTCTTGAACACACCATCC
WNT5A
F: ATCAATTCCGACATCGAAGG
R: CGTTCACCACCCCTGCT
CDK6
F: GTGCCCTGTCTCACCCATAC
R: GACCCATAAGCCACCAAGG
TIAM1
F: CAGGTGTTTGGAGAGGGAAC
R: AATGTCGCAGTCAGGGTTG
U6
F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
GAPDH
F: GAAGGTGAAGGTCGGAGT
R: GAAGATGGTGATGGGATTTC
F, forward; R, reverse.
Clinicopathological characteristics and COL11A1 mRNA expression in gastric cancer samples.
Variables
Total
COL11A1 expression (2−∆Ct) (median)
P-value
Age (years)
≤63
27 (47%)
0.00113
0.031a
≥64
30 (53%)
0.00548
Gender
Male
39 (68%)
0.00193
0.352
Female
18 (32%)
0.00356
Invasion depth
T2–4
44 (77%)
0.00403
0.0004b
T1
13 (23%)
0.000409
Tumor size (cm)
<5
27 (47%)
0.000878
0.024a
≥5
30 (53%)
0.00630
Degree of differentiation
Poorly
37 (65%)
0.00159
0.261
Moderately/Well
20 (35%)
0.00630
Lymph node positivity
Yes
36 (63%)
0.00455
0.019a
No
21 (37%)
0.000739
p<0.05
p<0.01.
The influences of cell apoptosis and cell cycle by COL11A1 knockdown.