Bone marrow aspirates were collected from 10 MM patients and 10 healthy donors in Xi'an Jiaotong University Medical College Red Cross Hospital. The primary MM cells were isolated from bone marrow aspirates as previously described (41). Briefly, mononuclear cells were separated from bone marrow aspirates by Ficoll-Hypaque density gradient centrifugation (Amersham, Little Chalfont, UK). Then, the cells were suspended in ice-cold phosphate-buffered saline (PBS) and incubated with microbeads labeled with a mouse anti-human CD138 monoclonal antibody (Miltenyi Biotech, Auburn, CA, USA). The CD138⁺ cells were sorted on a BD fluorescence-activated cell sorting FACSAria flow cytometer (BD Biosciences, San Jose, CA, USA) in accordance with the manufacturers instruction. The collection and use of clinical samples were approved by the Institutional Human Experiment and Ethics Committee of Xi'an Jiaotong University Medical College Red Cross Hospital with written informed consents from all MM patients and healthy donors. The human MM cell lines including NCI-H929, U266 and MM1.R were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). The KMS-12-BM MM cell line was purchased from Beijing Abace Biology, Co., Ltd. (Beijing, China). The primary MM cells, human MM cell lines, and normal plasma cells (nPCs) were cultured in RPMI-1640 (Gibco, Rockville, MD, USA) in supplement with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin/streptomycin mix (Sigma-Aldrich, St. Louis, MO, USA) in a humidified atmosphere containing 5% CO₂ at 37°C.

Total RNA from tissues or cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Complementary DNA was synthesized using M-MLV reverse transcriptase (BioTeke, Beijing, China) for mRNA expression analysis or miScript reverse transcription kit (Qiagen, Dusseldorf, Germany) for miRNA expression analysis. PCR amplification was performed on an Applied Biosystems AB 7500 Real-Time PCR system (Applied Biosystems, In., Carlsbad, CA, USA) using Power SYBR-Green PCR Master Mix (Applied Biosystems). The primers used were as follows: miR-1271 forward, 5-CAGCACTTGGCACCTAGCA-3 and reverse, 5-TATGGTTGTTCTCCTCTCTGTCTC-3; U6 forward, 5-CGCTTCGGCAGCACATATACTAA-3 and reverse, 5-TATGGAACGCTTCACGAATTTGC-3; SMO forward, 5-TGCTCATCGTGGGAGGCTACTT-3 and reverse, 5-ATCTTGCTGGCAGCCTTCTCAC-3; Gli1 forward, 5-TATGGACCTGGCTTTGGA-3 and and reverse, 5-CCTATGTGAAGCCCTATTT GC-3; Ptch1, CTCTGGAGCAGATTTCCAAGG; Ptch1 forward, 5-CTCTGGAGCAGATTTCCAAGG-3 and reverse, 5-TGCCGCAGTTCTTTTGAATG-3 and GAPDH forward, 5-CCATGTTCGTCATGGGTGTG-3 and reverse, 5-GGTGCTAAGCAGTTGGTGGTG-3. U6 was used as the internal control of miR-1271 and GAPDH was used as the internal control of mRNA. The relative gene expression was determined by 2^−ΔΔCt method, normalized against GAPDH or U6, and then compared with control.

The miR-1271 mimics, miR-1271 inhibitor, and their scrambled controls (Scr) were purchased from Shanghai GenePharma (Shanghai, China). Cells were transfected with miR-1271 mimics or miR-1271 inhibitor at a final concentration of 50 nM using Lipofectamine 2000 (Invitrogen). The open reading frame of SMO without 3-UTR was inserted into pcDNA3.1 (BioVector, Beijing, China). For overexpression of SMO, the pcDNA/SMO constructs were transfected into cells using Lipofectamine 2000 (Invitrogen).

Cells were transfected with miR-1271 mimics or miR-1271 inhibitor for 48 h. Then, the cells (200 cells/well) were seeded in 6-well plates and grown in a medium containing 0.3% noble agar for 2 weeks at 37°C. After fixing with 100% methanol for 30 min, the cells were stained with 0.1% crystal violet (Sigma-Aldrich). The number of colonies was observed and counted under a microscope (Olympus Corp., Tokyo, Japan).

Cell proliferation was assessed by MTT assay. Briefly, cells were seeded into a 96-well plate at a density of 5×10³ cells/well and transfected with miR-1271 mimics or miR-1271 inhibitor for 24, 48 and 72 h. After replacement with fresh medium, 20 µl MTT (0.5 mg/ml in PBS; Sigma) was added to each well and incubated for 4 h at 37°C. Then, the supernatant was discarded and 200 µl dimethyl sulfoxide (Sigma-Aldrich) was added to each well. After incubation for 15 min, the absorbance at 490 nm was measured with a microplate reader (Thermo Fisher Scientific, Rockford, IL, USA).

Cell apoptosis was determined by the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and caspase-3 activity assay. For TUNEL assay, briefly, cells were fixed with 4% paraformaldehyde and permeabilized with 0.2% Triton X-100 followed by incubation with TUNEL reaction mixtures (Roche Diagnostics, Indianapolis, IN, USA) for 1 h at 37°C. The apoptotic cells were observed under a microscope (Olympus), and five fields per slide were randomly chosen to quantitatively calculate the apoptotic cells. For caspase-3 activity assay, cells were lysed and the protein concentration was measured. A total of 100 µg of protein with 50 µl of reaction buffer was treated with 5 µl DEVD-pNA substrate (4 mM; Roche Diagnostics) for 2 h at 37°C. The absorbance at 405 nm was measured with a microplate reader (Thermo Fisher Scientific).

The 3-UTR of SMO containing the target sequence of miR-1271 was inserted into pmirGLO vector (Promega, Madison, WI, USA) to obtain pmirGLO-SMO 3-UTR, and the 3-UTR of SMO containing mutant miR-1271 target sites was inserted into pmirGLO vector (Promega) to obtain pmirGLO-mutant SMO 3-UTR. NCI-H929 cells were co-transfected with pmirGLO-SMO 3-UTR or pmirGLO-mutant SMO 3-UTR and miR-1271 mimics, miR-1271 inhibitor or Scr controls. At 4 h after incubation, the luciferase activity was detected by a Dual-luciferase reporter assay system (Promega).

Total proteins were extracted, separated and transferred onto a nitrocellulose membrane (Bio-Rad Laboratories, Hercules, CA, USA). The membrane was blocked by 5% non-fat milk and incubated with primary antibodies at 4°C overnight. After three washes with Tris-buffered saline containing 0.1% Tween-20, the membrane was incubated with horseradish peroxidase conjugated secondary antibodies (1:2,000; Bosis, Beijing, China) for 1 h at 37°C. Then, the protein was detected using enhanced chemiluminescence (Millipore, Boston, MA, USA). The primary antibodies (anti-SMO and anti-GAPDH) used in this study were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The intensities of protein bands were quantified by Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA). The relative protein expression was normalized against GAPDH and then compared with the control.

All the data were reported as means ± standard deviation. Statistical analyses were analyzed by the Students t-test for two group comparison or one-way analysis of variance followed by Bonferroni post hoc for multiple group comparison (>2) using SPSS version 11.5 (SPSS, Inc., Chicago, IL, USA). At P<0.05, the difference was considered statistically significant.

To investigate whether miR-1271 plays a role in MM, we firstly examined the miR-1271 expression in primary MM cells isolated from MM patient bone marrow samples. The results showed that the expression of miR-1271 was significantly lower in MM primary cells than in plasma cells from healthy donors (Fig. 1A). We then evaluated miR-1271 expression in MM cell lines including NCI-H929, KMS-12-BM, U266 and MM1.R. As compared with normal plasma cells (nPCs), miR-1271 was significantly decreased in MM cell lines (Fig. 1B). These results suggest a tumor suppressor role of miR-1271 in MM.

To explore the biological role of miR-1271 in MM, we performed gain-of- and loss-of-function experiments in KMS-12-BM and NCI-H929 cells by transfection of miR-1271 mimics or miR-1271 inhibitor. The results showed that transfection of miR-1271 significantly increased the expression of miR-1271 in KMS-12-BM (Fig. 2A) and NCI-H929 (Fig. 2B) cells, whereas miR-1271 inhibitor markedly decreased miR-1271 expression. We then detected the effect of miR-1271 on cell proliferation by MTT assay. The results showed that overexpression of miR-1271 significantly suppressed MM cell proliferation and miR-1271 inhibition markedly promoted cell proliferation (Fig. 2C and D). Furthermore, the colony growth of KMS-12-BM (Fig. 2E) and NCI-H929 (Fig. 2F) cells was also significantly decreased or increased by miR-1271 overexpression or miR-1271 inhibition, respectively. These data indicate that miR-1271 inhibit MM cell proliferation.

To further investigate the function of miR-1271 in MM, we then evaluated its effect on cell apoptosis. TUNEL assay showed that miR-1271 overexpression markedly induced cell apoptosis of MM cells, whereas miR-1271 inhibition markedly suppressed MM cell apoptosis (Fig. 3A). Moreover, caspase-3 activity assay showed that the activity of caspase-3 was significantly upregulated by miR-1271 overexpression but decreased by miR-1271 inhibition (Fig. 3B). These results suggest that miR-1271 induces apoptosis of MM cells.

To understand the underlying mechanism by which miR-1271 inhibits proliferation and induces apoptosis of MM cells, we used bioinformatics analysis to seek the potential targets of miR-1271. Notably, we found that SMO, an important oncogene (42), was predicted as a potential target gene of miR-1271 (Fig. 4A). To verify the targeting relationship, luciferase reporter vectors containing wild-type (WT) or mutant (MT) SMO 3-UTR were constructed. The Dual-luciferase reporter assay showed that miR-1271 mimics significantly decreased the luciferase activity of SMO 3-UTR (WT), whereas miR-1271 inhibitor significantly increased the luciferase activity of SMO 3-UTR (WT) (Fig. 4B). However, neither miR-1271 mimics nor miR-1271 inhibitor showed significant effect on the luciferase activity of SMO 3-UTR (WT). Subsequently, we performed RT-qPCR and western blot analysis to detect the direct effect of miR-1271 on SMO expression. The results showed that expression of both mRNA (Fig. 5A and B) and protein (Fig. 5C and D) was significantly decreased by miR-1271 mimics or increased by miR-1271 inhibitor in MM cells. Taken together, these results indicate that miR-1271 inhibits SMO expression by directly targeting the 3-UTR of SMO.

Because SMO is the critical regulator of HH signaling pathway, we speculated that miR-1271 might affect the HH signaling pathway. To test this hypothesis, we detected the effect of miR-1271 on Gli1 and Ptch1 expression. The results showed that the mRNA expression of Gli1 (Fig. 6A) and Ptch1 (Fig. 6B) was significantly downregulated by miR-1271 overexpression. By contrast, suppression of miR-1271 markedly increased the expression of Gli1 (Fig. 6A) and Ptch1 (Fig. 6B) in MM cells. These results suggest that miR-1271 regulates the HH signaling pathway.

To validate whether miR-1271 functions through SMO, we constructed a SMO-overexpressing vector harboring no 3-UTR of SMO and performed a rescue experiment. The cells were co-transfected with miR-1271 mimics and SMO-overexpressing vector. The results showed that the decreased mRNA (Fig. 7A and B) and protein (Fig. 7C and D) expression induced by miR-1271 was significantly restored by SMO-overexpressing vector transfection. Notably, overexpression of SMO expression significantly restored MM cell proliferation, which was suppressed by miR-1271 (Fig. 8A). Furthermore, the promotion effect of miR-1271 on cell apoptosis was markedly reversed by SMO overexpression (Fig. 8B). In addition, the inhibitory effect of miR-1271 on Gli1 (Fig. 8C) and Ptch1 (Fig. 8D) expression was restored by SMO overexpression, thereby implying that SMO overexpression reversed the inhibitory effect of miR-1271 on HH signaling pathway.