Surgical samples from 32 patients with endometrioid endometrial carcinoma were obtained at Saitama Medical University International Medical Center. Details of the patient characteristics are summarized in Table I. No patient received any chemotherapy before surgery. The study protocol was approved by the Institutional Review Boards of Saitama Medical University International Medical Center and The University of Chicago. Written informed consent was obtained from each of the study participants.

From the tumor tissues, total RNAs were obtained using an RNeasy Mini kit (Qiagen, Valencia, CA, USA). cDNA with 5-rapid amplification of cDNA ends (5-RACE) adapter was synthesized using SMART cDNA library construction kit (Clontech Laboratories, Inc., Mountain View, CA, USA). Quantitative real-time PCR was conducted using TaqMan gene expression assays (Thermo Fisher Scientific, Carlsbad, CA, USA) on the Applied Biosystems ViiA 7 Real-Time PCR system (Thermo Fisher Scientific) according to the manufacturers instructions. The following TaqMan gene expression assays were used; TCRβ (TRB) (forward, GAGCCATCAGAAGCAGAGATCTC and reverse; GGCCAGGCACACCAGTGT, MGB probe; ACACC AAAAGGC), CD8A (Hs00233520_m1), granzyme A (GZMA) (Hs00989184_m1), HLA-A (Hs01058806_g1), CD11c (ITGAX) (Hs00174217_m1) and PD-L1 (Hs01125301_m1). mRNA expression levels were normalized to GAPDH expression (Hs02758991_g1).

We obtained the mRNA expression dataset in endometrial cancer from The Cancer Genome Atlas (TCGA) database (12). The files with IlluminaHiSeq_RNASeqV2 and IlluminaGA_RNASeqV2 platform code were downloaded from the TCGA website (see https://tcga-data.nci.nih.gov/tcga/). Total of 546 cases were obtained from the TCGA website, and we excluded 6 cases from this analysis because of the lack of clinical information we needed.

The detailed method of library preparation for TCR sequencing was previously described (21). In brief, we used 957 to 1878 ng of total RNA. cDNAs were synthesized as described above, and performed two step PCRs to obtain sequence libraries. The first PCR was performed to amplify TCRβ cDNA using a forward primer corresponding to the SMART adapter sequence and a reverse primer corresponding to the constant region of TCRβ. The second PCR was done to add the index sequences for Illumina sequencer with barcode sequence using the Nextera Index kit (Illumina, San Diego, CA, USA). The prepared libraries were subjected to sequencing using the MiSeq Reagent v3 600-cycles kit on the MiSeq (Illumina).

Briefly, sequencing reads in fastq files were mapped to the TCR reference sequences derived from IMGT/GENE-DB (http://www.imgt.org) using Bowtie2 aligner (version 2.1.0) (23). The V, D and J genes were designated according to the nomenclature provided by the international ImMunoGeneTics information system (IMGT) (24,25). A CDR3 region was defined by identifying the second conserved cysteine encoded in the 3 portion of the V segment and the conserved phenylalanine or tryptophan encoded in the 5 portion of the J segment. TCRβ clonality was defined as the number of abundant TCRβ clonotypes adjusted by TRB mRNA expression, as shown below:

Survival analysis was performed using the Kaplan-Meier method and the log-rank test. Differences between two groups were evaluated by the Mann-Whitney U test. All statistical analyses including multivariate analysis were performed using JMP v11 (SAS, Inc., Cary, NC, USA) and GraphPad Prism 6 (GraphPad Software, La Jolla, CA, USA). In all statistical tests, differences were considered to be statistically significant at P<0.05.

To investigate any effects of expression levels of cancer immune-related genes on the prognosis of endometrial cancer patients, we measured mRNA expression levels of CD8, GZMA (one of molecular markers for cytolytic activity), HLA-A (one of major HLA class I molecules) and CD11c (one of markers for dendritic cells/macrophages) in the surgically-resected cancer tissues from 32 endometrial cancer patients. We classified the cases into two groups by the median expression level of each gene and then compared the progression-free survival (PFS). Higher mRNA expression of CD8 (P=0.039) and CD11c (P=0.046) was significantly associated with longer PFS (Fig. 1A). Expression levels of GZMA (P=0.14) and HLA-A (P=0.28) showed some tendencies although statistically not significant. In 540 cases from the TCGA dataset, we identified significant associations of higher expression level of CD8 (P<0.001), GZMA (P=0.003) and CD11c (P=0.048) with longer PFS (Fig. 1B). In addition, we explored other cancer immune-related genes such as HLA-B (HLA class I molecule), HLA-C (HLA class I molecule) and CD163 (a macrophage marker) using the 540 TCGA cases, but no significant association with prognosis was observed (Fig. 1C). These results imply the importance of the infiltration of CD8⁺ T cells and APCs into tumor tissues for prognosis in endometrial cancer patients.

To examine whether clonal expansion of TILs is related to prognosis of patients with endometrial cancer, we explored the TCR repertoire in the 32 endometrial cancer tissues. Through the cDNA sequencing of TCRβ, we obtained total sequence reads of 270,255 to 4,692,690 (average, 1,834,576), and identified 3,765 to 80,739 (average, 23,598) unique TCRβ CDR3 clonotypes (Table II). To evaluate the TCRβ clonality, the numbers of TCRβ clonotypes of >0.1% frequency were adjusted by TRB mRNA expression levels; this value is lower when certain T cells are enriched (defined as ‘CL_High’), and is higher when the number of enriched clones is limited (defined as ‘CL_Low’). In this classification, mRNA expression levels of CD8 (P=0.006) and GZMA (P=0.005) were significantly higher in patients with CL_High, and tend to have longer PFS (Fig. 2A-C).

Several recent reports indicated that expression of PD-L1 in tumor cells reflect the presence of antigen-induced antitumor immune pressure mediated by TILs (8–11). However, PD-L1 expression itself did not show any prognostic value in our 32 cases (P=0.45) or in 540 cases in TCGA database (P=0.60) (Fig. 2D and E). Among our 16 cases with CL_High, 11 cases showed higher PD-L1 expression than the median PD-L1 expression level of 32 cases, and we defined them as CL_High/PD-L1_High which is considered to have strong immune pressure in their tumor tissues (Fig. 2F). In these 11 CL_High/PD-L1_High cases, we observed significantly higher levels of CD8 (P<0.001), GZMA (P<0.001) and HLA-A (P=0.027) than in the remaining cases (Fig. 2G-I). In prognostic analysis, none of 11 cases in the CL_High/PD-L1_High group had recurrence while the remaining 21 cases showed the significantly higher relapse rate (P=0.015; Fig. 2J).

Finally, we examined the association of immune-related gene expression and TCRβ clonality with clinicopathological characteristics such as clinical stage, grade and age. Multivariable analysis revealed that CL_High/PD-L1_High was the only independent favorable prognostic factor in our results (Table III). Therefore, we examined the association between expression level of immune-related genes such as CD8, GZMA and HLA-A with clinicopathological characteristics. We found that the expression levels of CD8 (P=0.037), GZMA (P=0.027) and HLA-A (P=0.022) were significantly higher in early-stage cases than advanced-stage cases (Fig. 3A), while no significant difference was observed in grade (Fig. 3B) or age (young vs. elderly, classified by the median of 61 years; Fig. 3C). These results suggest that early-stage endometrial tumors are immunologically more active compared to advanced-stage tumors.