The present study was approved by the Ethics Committee of the Second Affiliated Hospital of Wenzhou Medical University, and informed consent was provided by each patient. Formalin-fixed, paraffin-embedded samples from 106 paired colon cancer tissues and peritumoral tissues were obtained from the Department of Pathology of the Second Affiliated Hospital of Wenzhou Medical University between 2010-2013. No patients received neoadjuvant chemotherapy before surgery. The histological grade was determined based on World Health Organization classification criteria by two independent pathologists. In addition, the clinical stage was determined according to Dukes classification system. The study consisted of 68 males and 38 females ranging in age from 24 to 91 years old (61.86±14.6). The clinicopathological features of the patients are summarized in Table I. The serum carcinoembryonic antigen (CEA) level was assessed by means of radioimmunoassay (RIA) (CEA-RIA kit; CIS Biointernational, China).

Patients were followed up with physical examination and assessment of their serum CEA level every 3–6 months in the first two years regularly. Abdominal computed tomography and colonoscopy were conducted every 6–12 months for surveillance of recurrence. In addition, we called upon the patients every three months to assess their level of discomfort. The overall survival (OS) time was defined as the time from surgery to death (the final event defined as death caused by the tumor or from complications) or the time from surgery to the last follow-up of patients. The median follow-up was 49.4 months (ranging from 1–71 months).

Tissue sections (4-µm thick) from paraffin-embedded colon cancer and corresponding peritumoral samples were placed onto slides coated with polylysine. ATOH8 expression in colon cancer samples was examined using immunohistochemistry. In brief, sections were immersed in xylene for 10 min 3 times, and subsequently immersed in 100% ethanol for 5 min twice for deparaffination, and then submerged in 95, 85 and 75% ethanol for 5 min/concentration at room temperature for rehydration. For antigen retrieval, the slides were immersed in 10 mM citrate buffer (pH 6.0), and heated to 120̊C and at a pressure of 103 kPa for 2 min. Then, the slides were immersed in 3% hydrogen peroxide (20 min, room temperature) to block endogenous peroxidase activity and 10% normal goat serum (30 min, room temperature) to block non-specific binding. The slides were then washed with phosphate-buffered saline (PBS) and treated with primary polyclonal rabbit ATOH8 antibody (ab106377; diluted 1:100; Abcam, Cambridge, MA, USA) at 4̊C in a humidified incubator overnight. Then, the slides were washed with PBS and incubated with a secondary antibody (goat anti-rabbit IgG; Zhongshan Bio Co., Ltd., Beijing, China) for 18 min followed by streptavidin-peroxidase conjugate for 22 min at room temperature. Subsequently, the samples were stained with a 3,5-diaminobenzidine (DAB) substrate kit (Zhongshan Bio Co., Ltd.) and haematoxylin for counterstaining. All of the samples were evaluated by two independent pathologists who were blinded to the clinical data of the patients. The inconsistent cases were reassessed on a double-headed microscope. Immunohistochemical evaluation of ATOH8 protein expression was performed as previously described, including staining intensity and extent (18). The intensity score was as follows: 0, negative; 1, weak; 2, moderate; and 3, strong. The extent of positivity score was quantified from the percentage of positive tumor cells: 0, <5%; 1, ≥5–25%; 2, ≥26–50%; 3, ≥51–75%; and 4, ≥76%. The final score was determined by multiplying the intensity and extent scores, which ranged between 0 and 12; scores ≤4 indicated low expression.

Total RNA was extracted from cultured cells with TRIzol reagent (Superfec Bio Co., Ltd., Shanghai, China) according to the manufacturer's instructions. Then, an M-MLV reverse transcriptase kit (Promega Bio Co., Ltd., Beijing, China) was used for reverse transcription. To determine the transcripts of the target genes, quantitative real-time polymerase chain reaction (qRT-PCR) was conducted with a SYBR Premix Ex Taq (RibBio Co., Ltd., Guangzhou, China) on an Agilent MX3000p Bioanalyzer (Applied Biosystems Co., Ltd., CA, USA). qRT-PCR conditions were as follows: 95̊C for 30 sec; 45 cycles of 95̊C for 5 sec, 60̊C for 30 sec, and 95̊C for 15 sec; 55̊C for 30 sec; and 95̊C for 15 sec. Three independent experiments were run in triplicate. The relative amount of ATOH8 mRNA was normalized to the control GAPDH. The primer sequences were as follows: ATOH8, 5′-TGGGCAGAAGCTGTCCAAACT-3′ and GTGGTCGGCACTGTAGTCAAG, and GAPDH, 5′-TGACTTCAACAGCGACACCCA-3′ and 5′-CACCCTGTTGCTGTAGCCAAA-3′.

CRC cells were harvested and washed with cold PBS and lysed with radio-immunoprecipitation assay (RIPA) lysis buffer (Beyotime Bio Co., Ltd., Haimen, China). Cell debris was centrifuged and total protein in the supernatants was assessed with a BCA protein assay kit (Beyotime). Amounts equal to 50 µg of protein were separated on a 10% SDS-PAGE gel, then transferred to a polyvinylidene fluoride (PVDF) membrane (Beyotime) and incubated with the ATOH8 (ab106377; diluted 1:800) and GAPDH (ab8245; diluted 1:5,000) (both from Abcam) primary antibodies at 4̊C overnight. Then, the membrane was incubated with the HRP-labelled goat anti-rabbit IgG secondary antibody (diluted 1:1,000; Beyotime) at room temperature for 2 h. Proteins were visualized with enhanced chemiluminescence detection reagents (Applygen Technologies, Beijing, China). The relative amount of ATOH8 protein was normalized to the control GAPDH.

Four types of human colon carcinoma cell lines (HCT116, SW620, RKO and LoVo) were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. All of the cancer cell lines were cultured in high-glucose Dulbecco's modified Eagles medium (DMEM) with 10% foetal bovine serum (FBS) (Atlanta Biologicals, Lawrenceville, GA, USA) at 37̊C in 5% CO₂ moist incubator. All experiments were performed on exponentially growing cells. Based on the sequence of ATOH8 (NM_032827.6), we designed three different small interfering RNAs (siRNAs) (siRNA#1, 5′-CGTCAATTTCACACGTAAT-3′; siRNA#2, 5′-ACGGCCTTAAGAAGCTCAA-3′; and siRNA#3, 5′-TGAGGATCGCCTGTAACTA-3′), and a negative control (NC) siRNA (5′-TTCTCCGAACGTGTCACGT-3′). The ATOH8-specific and negative control lentiviral packaging plasmids were purchased from GeneChem Biotechnologies, Co., Ltd. (Shanghai, China). The lentiviral vectors which expressed green fluorescent protein (GFP) were transfected into the CRC cell lines using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer's instructions. Α fluorescence microscope (Olympus-BX53; Olympus, Tokyo, Japan) confirmed whether the target cells were transfected with the lentiviral vectors.

Cells were seeded into a 96-well plate at a density of 2.0×10⁴ cells/ml and incubated in a humidified environment of 5% CO₂ at 37°C. On day 1–5, the medium was removed and 20 µl of 5 mg/ml MTT (Genview, Tallahassee, FL, USA) was added to each well, respectively. Four hours later, the MTT reagent was removed and replaced with 100 µl of dimethyl sulfoxide (DMSO) to stop the reaction, and then the plates were agitated for 5 min. Subsequently, the absorbance of the samples was assessed at 490 nm with a microplate reader.

Cell chemosensitivity to 5-fluorouracil (5-FU) was determined by MTT assay. Approximately 2×10⁴ cells/well were seeded in 96-well plates, allowed to attach overnight, and exposed to different concentrations of 5-FU from 1 to 150 µg/ml for 24 h. Then, an MTT assay was performed as aforementioned.

Following five days of transfection, apoptosis was assessed by the Annexin V-APC apoptosis detection kit (eBioscience, San Diego, CA, USA) according to the manufacturer's instructions. At first, cells seeded in 6-well dishes were trypsinized, collected and incubated in 80% ethanol at 4̊C overnight. Then, the cells were stained with Annexin V-APC at room temperature in the dark. The apoptosis rate was analysed by flow cytometry (BD Biosciences, San Diego, CA, USA) within 1 h. Cells positive for Annexin V-APC were considered to be apoptotic cells.

SW620 cells (2×10⁶) were seeded in 6-cm dishes and trypsinized, collected and washed with PBS twice. Prior to staining with propidium iodide (PI), the cells were incubated in 80% ethanol at 4̊C overnight. Subsequently, the stained cells were assessed by flow cytometry. The fraction of cells in the G0/G1, S and G2/M phases was analysed using CellQuest software programs.

In the cell motility assay, stably-transfected ATOH8-siRNA cells were cultured until cell confluence reached 90%. Then, a 200 µl pipette tip was used to draw a wound at the bottom of each well. The cells were washed with PBS, and then further cultured in 0.5% FBS at 37̊C with 5% CO₂. Wound closure was observed after 8 and 24 h. We used the relative migration rate to evaluate the motility of cells. Relative migration rate = distance of migration/the width at 0 h (%). Distance of migration = the width at 0 h - the width at time (mm).

All statistical analyses were performed with SPSS 22.0 (SPSS, Inc., Chicago, IL, USA). For numerical variables, the data was expressed as the means ± SEM. The significance of the differences between the values was determined by Student's t-test. The correlation between ATOH8 and the clinicopathological features was assessed by Chi-squared and Fisher's exact tests. The OS time was calculated by the Kaplan-Meier method, and the differences were analysed by the log-rank test. A P-value <0.05 was considered to indicate a statistically significant result.

To explore the role of ATOH8 in colon cancer, we surveyed the expression of ATOH8 in 106 paired colon cancer samples using immunohistochemistry. Our results indicated that ATOH8 displayed either diffuse or localized patterns in the cytoplasm of both cancer and peritumoral tissues (Fig. 1A and B). According to our evaluation criteria, the ATOH8 protein was highly expressed in 58/106 (54.7%) of colon cancer samples but only 7/106 (6.6%) of peritumoral samples (P=0.000). Based on the level of ATOH8 expression in the tumor-cell cytoplasm, patients were divided into an ATOH8 low expression group (including negative and low expression) and a high expression group (high expression; Fig. 1B). We explored the relationship between the expression level of ATOH8 and clinicopathological features. High expression of ATOH8 was significantly associated with a high serum CEA level, but there was no connection between the expression level of ATOH8 with age, gender, tumor location, tumor size, histological grade or Dukes' stage (Table I). We also compared the serum CEA level with the prognosis of CRC patients by Kaplan-Meier survival analysis. It suggested that the patients with a high level of pre-surgery CEA had a shorter OS time (95% CI, 37.3–54.1 months vs. 95% CI, 56.9–65.6 months, P=0.0003; Fig. 2A). Moreover, when comparing the expression of ATOH8 with OS, the high expression group was observed to have statistically worse OS (95% CI, 45.2–57.7 months vs. 95% CI, 56.7–67.0 months; P=0.024, Fig. 2B).

The expression of ATOH8 mRNA was analysed in the four colon cancer cell lines HCT116, SW620, LoVo and RKO with qRT-PCR. The relative expression ratio of ATOH8 mRNA in the four cancer cell lines was normalized to LoVo cells. The relative expression levels of ATOH8 mRNA in the four cancer cell lines were 26.58±1.75, 23.85±1.74, 0.81±0.19 and 0.23±0.06 in the HCT116, SW620, LoVo and RKO cells, respectively (Fig. 3A). Expression in the SW620 and HCT116 cells was relatively high, so we chose these two cell lines in the following experiment. Then, we designed a negative control siRNA (NC) and three different ATOH8 siRNAs (KDs) (siRNA#1, siRNA#2, siRNA#2) and cloned them into GFP-lentiviral vectors. The groups transfected with NC and KDs were visible in the dark under fluorescence microscopy, while the non-transfected control group (CON) was invisible, which means the lentiviral vectors were successfully transfected into the SW620 (Fig. 3B) and HCT116 cells (data not shown). Then, we screened the expression of ATOH8 mRNA in SW620 and HCT116 cells using qRT-PCR to ascertain the knockdown efficiency. The results suggested that ATOH8 expression was effectively downregulated by siRNA#1 (KD1, decreased to 71.6±11.9% and 81.6±7.3%; P<0.05) and siRNA#2 (KD2, decreased to 50.3±10.0% and 65.0±5.0%; P<0.001) in the SW620 and HCT116 cells, respectively, compared to the controls. However, siRNA#3 (KD3) did not decrease ATOH8 expression in either the SW620 (109.7±8.2%) or HCT116 (104.4±7.3%) cells (Fig. 3C). As the knockdown efficiency of KD2 in SW620 cells was the highest, we chose the siRNA#2-SW620 cells in the following experiments. Before additional in vitro experiments, the expression of ATOH8 of the CON, NC and KD groups was confirmed by qRT-PCR (Fig. 3D; P<0.001) and western blotting (Fig. 3E; P<0.01).

We performed an MTT assay to investigate the effect of ATOH8 knockdown on the proliferation ability of SW620 cells. As shown in Fig. 4, the proliferation of the KD group on day 4 and 5 was markedly decreased compared with the CON and NC group (P<0.001).

Following five days of transfection, the confluence of the cells reached ~85% in the CON, NC and KD groups, and then we performed Annexin V-APC single staining assay (Fig. 5A and B). As shown in Fig. 5C, the percentage of apoptotic cells in the KD group (10.04±0.178%) was significantly increased compared to the CON group (3.8±0.445%; P<0.001) and NC group (4.3±0.342%; P<0.001).

To investigate the role of ATOH8 knockdown in cell cycle progression, flow cytometry was performed, which revealed that ATOH8 knockdown arrested the cell cycle in SW620 cells. As shown in Fig. 6, the percentage of the G1 phase cells (CON vs. NC vs. KD, 48.87 vs. 51.87 vs. 42.93%, respectively; P<0.001) and the G2/M phase cells (32.15 vs. 32.12 vs. 26.69%; P<0.01) was significantly decreased in the ATOH8-knockdown group while the percentage of cells in the S phase (19.49 vs. 16.02 vs. 30.38%; P<0.001) was increased. Collectively, these data demonstrated that ATOH8 knockdown led to cell cycle arrest during the S phase.

The wound healing assay was used to determine the effects of ATOH8 downregulation on cell motility. As shown in Fig. 7, the wound healing assay indicated ATOH8 knockdown had no effect on the cell migration rate of SW620 cells. The relative migration rate at 8 h of NC and KD group was 21±2 and 22±8%, respectively, P>0.05; and migration rate at 24 h was 44±5 and 53±9%, respectively, P>0.05.

The effect of ATOH8 knockdown on drug sensitivity was performed by evaluating the cytotoxicity of 5-FU in SW620 cells. The inhibitory effect of various concentrations of 5-FU was assessed by MTT assay following 24 h of treatment. The inhibitory effect of 5-FU was dose-dependent in the CON, NC and KD groups (Fig. 8). In addition, the inhibitory rate of the KD group was increased more significantly than the CON and NC groups as the drug concentration increased, which meant that ATOH8 knockdown increased the sensitivity of SW620 to 5-FU.