The human glioma and normal brain specimens from patients were collected at the Department of Neurosurgery, the Second Affiliated Hospital of Soochow University. All glioma specimens were confirmed by pathological diagnosis and classified according to the World Health Organization (WHO) criteria. The study comprised of 6 WHO I, 22 WHO II, 16 WHO III and 18 WHO IV glioma samples. Ten normal brain tissues were obtained from patients with cerebral injury. Specimens were immediately snap-frozen in liquid nitrogen after surgical removal and stored at −80°C before use. Informed consent was obtained from all patients, and the study was approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University.

Human glioma cell lines (U87, U251, U343, A172, T98G and LN229) were purchased from the Cell Bank of Chinese Academy of Science. Primary normal human astrocytes (NHA) were kindly provided by Professor Ming Li (Department of Neurosurgery, The Second Affiliated Hospital of Soochow University, Suzhou, China). The glioma cells were maintained in Dulbeccos modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics (100 U/ml penicillin and 100 U/ml streptomycin; Gibco, Grand Island, NY, USA). Cells were grown in a 37°C incubator with 5% CO₂. Primary human astrocytes were maintained in astrocyte media (Sciencell Research Laboratories, Carlsbad, CA, USA) containing 10% FBS, 1% astrocyte growth supplement and 1% penicillin/streptomycin.

Total RNA was extracted from cell lines and frozen tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Complementary DNA (cDNA) was synthesized using an miRNA reverse transcription kit (Shanghai GenePharma Co., Ltd., Shanghai, China) according to the manufacturers instructions. Then, the expression levels of miR-543 were quantified using a QuantiNova SYBR-Green PCR kit (Qiagen, Hilden, Germany) with the ABI 7900HT Fast system (Applied Biosystems, Foster City, CA, USA). Primer sequences of miR-543 were CAGTGCTAAAACATTCGCGG (forward) and TATGGTTGTTCACGACTCCTTCAC (reverse). The U6 gene was used as an internal reference. The primer sequences were synthesized by Shanghai GenePharma. The reaction was performed for 40 cycles under following conditions: denaturation at 95°C for 3 min, 95°C for 10 sec and 55°C for 30 sec. The relative expression ratio of miR-543 was calculated using the 2^−ΔΔCT method.

U87 and U251 cells were transfected with the miR-543 mimic and the corresponding negative control (miR-NC), which were obtained from Shanghai GenePharma. The sequences were as follows: miR-543 mimic, 5-UGGCG GAGAACUGAUAAGGGUCCUUAUCAGUUCUCCGUCC AUU-3; negative control (miR-NC), 5-UUCUCCGAACGUG UCACGUTTACGUGACACGUUCGGAGAATT-3.

miR-543 mimic or miR-NC was transfected into the glioma cells when the cells reached 60–70% confluence using Lipofectamine 3000 (Invitrogen) according to the manufacturers instructions. Transfection efficiencies were determined in every experiment at 48 h after transfection by qRT-PCR.

The number of viable cells was assayed using a Cell Counting kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan) per the manufacturers protocol. The cells were seeded into 96-well plates at a density of 2×10³ cells/well. Then, 10 µl of the CCK-8 solution was added to each well every day for 6 days, and the plates were incubated for 1 h at 37°C. The optical density (OD) at 450 nm was measured using a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA).

The colony formation rate was measured using the plate colony formation assay. Then, 1,000 cells of each group were added to each well of the 6-well plates and cultured for 10 days in DMEM medium containing 10% FBS. Then, the cells were washed with phosphate-buffered saline (PBS) and fixed using a crystal violet cell colony staining kit (Genemed, Shanghai, China). Images of the colonies were taken and the colonies were counted under a microscope (Olympus, Tokyo, Japan).

For cell cycle analysis, cells in each group were fixed with cold 70% ethanol at 4°C for 12 h. The cells were washed twice with PBS and then stained with propidium iodide (PI) with RNase in PBS. The treated cells were then evaluated by flow cytometry (Beckman Coulter, Inc., Brea, CA, USA).

Cellular apoptosis levels were detected using an Annexin V-PE apoptosis detection kit PE (BD Biosciences, San Diego, CA, USA) by flow cytometer (Beckman Coulter). Cells in each group were collected and resuspended in 400 µl of 1X binding buffer containing 50 µl Annexin V-PE and 7-AAD (7-amino-actinomycin D) at 4°C in the dark for 15 min.

The wound healing assay was conducted to detect cell migration. Cells were seeded in 6-well plates and cultured to 80% confluence. A 10-µl pipette tip was applied to generate a linear wound. Then, cells were cultured for 24 h and observed under a microscope (Olympus). The widths of wounds were determined at 0 and 24 h.

For the cell invasion assay, Transwell chambers (Corning, Inc., Corning, NY, USA) were covered with Matrigel (BD Bioscience), and 3×10⁴ cells suspended in 150 µl of serum-free medium were added to the upper chambers. The lower chambers were filled with 600 µl of DMEM with 10% FBS. After 24 h of incubation, the cells on the upper surface were removed, and the cells on the lower surface were stained with 0.1% crystal violet for 15 min. The stained cells were counted in 10 randomly selected fields under a microscope (magnification, ×400; Olympus).

All procedures and experiments involving animals in this study were approved by the Institutional Animal Care and Use Committee and the Local Ethics Board. Female immunodeficient nude mice of 4–5 weeks of age were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China) and maintained under specific pathogen-free (SPF) conditions. U87 and U251 cells and glioma cells (2×10⁶) harboring miR-543 or miR-NC were separately injected subcutaneously (s.c.) into the flanks of nude mice (n=5). Growth curves and tumor volumes were measured every other day. The tumor volume was determined according to the following formula: TV (mm³) = 1/2 × width² × length. On the 35th day after the injection, the mice were sacrificed and the tumors were removed, weighed and photographed.

U87 cells were transfected with miR-543 mimic or miR-NC. Prepared samples were first frozen to a dry powder with a vacuum freeze drier. The freeze-dried powder was dissolved in 200 µl of TEAB (tetraethylammonium bromide) dissolution buffer and 800 µl of cold acetone containing 10 mM DTT (dithiothreitol). Then, the resuspended powder was incubated for ~2 h. After centrifugation at 13,000 r/min for 20 min at 15°C, the precipitate was collected and mixed with 800 µl of cold acetone containing a solution of 10 mM DTT for 1 h at 56°C to break the protein disulfide bonds. The sample was centrifuged at 13,000 r/min for 20 min at 15°C. The precipitate was collected, dried and stored at −80°C for later use.

Total protein concentration was measured using the Bradford method (14). For each sample, 100 µg of protein was dissolved in 500 µl of dissolution buffer and then diluted with 500 µl of 50 mM NH₄HCO₃. After reduction and alkylation, 2 µg of trypsin was added and then incubated overnight at 37°C for protein digestion. After protein digestion, an equal volume of 0.1% FA (formic acid) was added for acidification. Peptides were purified thrice using a Strata-X C18 pillar, washed with 0.1% FA + 5% ACN (acetonitrile) twice, and eluted with 1 ml of 0.1% FA + 80% ACN. Eluted peptides were dried with a vacuum concentration meter.

LC-MS/MS analysis was performed on an AB SCIEX NanoLC-MS/MS system (Triple TOF 5600 plus; AB Sciex, Framingham, MA, USA). Samples were chromatographed using a 120-min gradient from 2 to 35% (buffer A 0.1% (v/v) FA, 5% (v/v) ACN, buffer B 0.1% (v/v) FA, 95% (v/v) ACN] after direct injection onto a 20-cm PicoFrit emitter (New Objective, Inc., Woburn, MA, USA) packed to 20 cm with a Magic C18 AQ 3-µm 200-Å stationary phase. MS1 spectra were collected in the range from 360 to 1,460 m/z for 250 ms. The 40 most intense precursors with a charge state of 2–5 were selected for fragmentation, and MS2 spectra were collected in the range 50–2,000 m/z for 100 ms. Precursor ions were excluded from reselection for 15 sec.

The original MS/MS file data were submitted to ProteinPilot Software v4.5 for data analysis. For protein identification, the Paragon algorithm (15), which was integrated into ProteinPilot, was compared against the uniprot homo database for database searching. The parameters were set as follows: the instrument was TripleTOF 5600 plus, cysteine modified with iodoacetamide; biological modifications were selected as ID focus and trypsin was selected for protein digestion. For false discovery rate (FDR) calculation, an automatic decoy database search strategy was employed to estimate FDR using the PSPEP (Proteomics System Performance Evaluation Pipeline Software, integrated in the ProteinPilot Software). Only unique peptides with global FDR values of fit <1% were considered for further analysis. Skyline v2.5 software was employed for peptide and protein quantification. For differentially expressed protein (DEP) determination, fold-changes were calculated as the average comparison pairs among biological replicates. Proteins with a fold-change >2 or <0.5 were considered to be significantly differentially expressed.

To determine the biological and functional properties of the identified proteins, the identified protein sequences were mapped with Gene Ontology terms. A homology search was first performed for all the identified sequences with a localized NCBI BLASTP program against the NCBInr Homo database. The e-value was set to <1e-5, and the best hit for each query sequence was considered for Gene Ontology (GO) term matching. The GO term matching was performed with Blast2GO v4.5 pipeline (16). In addition, an enrichment analysis of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways was performed. To identify candidate biomarkers, we employed a hypergeometric test to perform pathway enrichment. A P<0.05 was set as the threshold value.

Data from at least three independent experiments are presented as the mean ± standard deviation (SD). Statistical analyses were performed using Statistical Package for the Social Sciences (SPSS) software version 19.0 (SPSS, Inc., Chicago, IL, USA). The differences between the groups were analyzed using the Students t-test or the one-way analysis of variance (ANOVA). A P<0.05 was considered to be statistically significant.

To explore the potential role of miR-543 in glioma progression, the expression levels of miR-543 in six glioma cell lines and normal human astrocytes (NHA) were first analyzed by quantitative real-time PCR (qRT-PCR). The expression level of miR-543 was significantly reduced in all of the six analyzed glioma cell lines compared with NHA (P<0.01; Fig. 1A). Furthermore, miR-543 expression was further investigated in 62 glioma tissues and 10 normal brain tissues. As shown in Fig. 1B, the expression of miR-543 was markedly reduced in glioma samples compared with normal brain tissues (P<0.01). In addition, miR-543 expression in high-grade (grades III and IV) gliomas was significantly decreased compared with low-grade (grades I and II) gliomas (P<0.01; Fig. 1C). Taken together, these findings indicate that miR-543 might be a hallmark of glioma and associated with the progression of glioma.

To further examine the role of miR-543 in glioma cells, U87 and U251 cells were transfected with miR-543 mimic or miR-NC. For subsequent assays, U87-miR-543 and U251-miR-543 represent the glioma cells transfected with miR-543 mimic. The negative controls U87-miR-NC and U251-miR-NC represent the glioma cells transfected with miR-NC. U87 and U251 cells were used as the blank control. Increased expression of U87-miR-543 and U251-miR-543 were confirmed using qRT-PCR (Fig. 2A). Then, glioma cell growth was detected in vitro. CCK-8 assays showed that the overexpression of miR-543 significantly inhibited cell proliferation in U87 and U251 cells compared with control groups (Fig. 2B). Furthermore, the overexpression of miR-543 markedly inhibited colony formation in glioma cells (Fig. 2C). These results suggested that miR-543 contributed to the reduced proliferation of glioma cells.

Furthermore, flow cytometry was used to examine the effects of miR-543 on cell apoptosis and cell cycle distribution. The results showed that the proportion of apoptotic cells transfected with miR-543 was significantly increased compared with control cells (Fig. 3A). In addition, as shown in Fig. 3B, miR-543 overexpression increased the percentage of cells in the S phase (P<0.01). The result showed that miR-543 overexpression in U87 and U251 cells significantly induced cell cycle arrest at the S phase. Collectively, these findings indicate that miR-543 acts as a tumor suppressor in the growth of glioma, likely via modulating cell cycle progression.

To further clarify the effect of miR-543 on the migration and invasion ability of U87 and U251 cells, wound healing and Transwell invasion assays were performed. As shown in Fig. 4A, a significant difference between the migration of miR-543 overexpression cells and control cells was noted (P<0.01). The Transwell invasion assay showed that the overexpression of miR-543 significantly decreased the number of glioma cells capable of invasion (Fig. 4B; P<0.01). These results suggest that miR-543 inhibits the migration and invasion of glioma cells in vitro.

The in vitro study indicated that miR-543 inhibits glioma cell proliferation and invasion; therefore, the growth inhibitory effect of miR-543 in vivo was evaluated using a subcutaneously xenografted glioma model. U87 and U251 cells were chosen for the in vivo study. The glioma cells stably expressing miR-543 or miR-NC were subcutaneously inoculated into nude mice. Tumor volumes were estimated in the subcutaneous model every week after injection. Five weeks after inoculation, the mice were sacrificed and tumor tissues were extracted. Tumors formed by miR-543 overexpressing cells were visibly smaller than those formed by control cells (Fig. 5B and D). The average volume and weight of tumors formed by miR-543 overexpressing cells were significantly decreased compared with control cells (both P<0.01; Fig. 5). The results demonstrated that miR-543 could suppress the growth of glioma xenografts.

Given that miR-543 was downregulated in U87 cells, we hypothesized that the upregulation of miR-543 alters the expression of its target genes. A label-free quantitative proteomics approach was used to identify dysregulated proteins in U87 glioma cells with or without miR-543 overexpression. The workflow in the quantitative proteomics approach is presented in Fig. 6A. A total of 2,446 proteins were quantified according to the criteria described in Materials and methods. Among all the quantified proteins, 339 proteins were differentially expressed after miR-543 overexpression. Of these, 165 were upregulated and 174 were downregulated. The identified differentially expressed proteins included CKAP5, SYNJ2, POMP, CSN5, NOL7 and GOLM1. Table I presents the previously noted 20 upregulated and downregulated proteins.

Based on the results of the proteomic analysis, the miR-543-regulated proteins were classified by their GO cellular components, biological process and molecular function to achieve an overview of the GO distribution (Fig. 6B). GO cellular component classification results revealed that many miR-543-regulated proteins were assigned to cells, cell parts, organelle and organelle parts. GO biological process analysis revealed that the miR-543-regulated proteins were involved in diverse biological processes, such as cellular process, metabolic process, biological regulation, regulation of biological process and cellular component organization or biogenesis. In the GO molecular function category, binding, catalytic activity, enzyme regulator activity and molecular transducer activity were noted as the main classifications. As a whole, this bioinformatic information indicated that miR-543 may act as an important regulator of different cellular functions across extensive biological processes.

To gain insights into the function of miR-543, the enrichment analysis of KEGG pathways among miR-543 regulated proteins was performed. Fig. 6C showed the pathways associated with miR-543 regulated proteins with the bioinformatic analysis. Moreover, according to the P-values obtained with hypergeometric tests, we identified pathways markedly enriched and likely involved in miR-543-mediated tumorigenesis. The enriched pathways included pyrimidine metabolism, base excision repair, RNA degradation, inositol phosphate metabolism, adipocytokine signaling pathway and regulation of the actin cytoskeleton. These results may indicate the involvement of miR-543 in intricate physiological and pathological systems.