Contributed equally
Angiogenesis is a key event in the progression of gliomas. Exosomes, as signaling extracellular organelles, modulate the tumor microenvironment and promote angiogenesis and tumor progression. We previously demonstrated that long intergenic non-coding RNA CCAT2 (linc-CCAT2) was overexpressed in glioma tissues and functioned to promote glioma progression. Therefore, this study aimed to explore an underlying mechanism of glioma cell-affected angiogenesis. First, qRT-PCR was used to determine the expression level of linc-CCAT2 in 4 glioma cell lines and 293T cells, and the results revealed that the U87-MG cells exhibited the highest expression level. Subsequently, the pro-angiogenesis function of exosomes that were derived from negative control shRNA-treated U87-MG cells (ncU87-Exo) and linc-CCAT2 shRNA-treated U87-MG cells (shU87-Exo) was evaluated
Angiogenesis is a complex process by which new vessels sprout from existing vasculature to form a vascular network that supplies nutrients and/or metabolites to tissues, thus playing a fundamental role in many physiological and pathological conditions (
Exosomes are a subcategory of microvesicles defined as cup-shaped vesicles that are 40–100 nm in size. They are formed by the inward budding of the multivesicular body (MVB) membrane (
Long non-coding RNAs (lncRNAs) are non-protein coding transcripts that are longer than 200 nucleotides and regulate gene expression at epigenetic transcriptional and post-transcriptional levels (
In the present study, we demonstrated that exosomes that were released by glioma cell lines U87-MG (U87-Exo) were enriched in linc-CCAT2 and could be internalized by human umbilical vein endothelial cells (HUVECs). The exosomes were able to promote HUVEC angiogenesis by stimulating angiogenesis-related gene and protein expression. In addition, we found that U87-Exo could alleviate HUVEC apoptosis that was induced by hypoxia. Furthermore, we employed gain-/loss-of-function experiments to reveal that the overexpression of linc-CCAT2 in HUVECs activated VEGFA and TGFβ and promoted angiogenesis as well as Bcl-2 expression and inhibited Bax and caspase-3 expression to decrease apoptosis. Downregulation of linc-CCAT2 revealed the opposite effect. These findings demonstrated that glioma cells could transfer linc-CCAT2 via exosomes to endothelial cells to promote angiogenesis, which sheds new light on the progression of gliomas. Therefore, exosomes and linc-CCAT2 may be used as putative therapeutic targets in the treatment of glioma.
The protocols employed in this study and the use of human tissues were approved by the Ethics Committee of the Second Affiliated Hospital of Nanchang University. This study was conducted in full accordance with ethical principles, including the World Medical Association Declaration of Helsinki, and the local legislation. All experimental protocols were carried out in accordance with the relevant guidelines and regulations.
Human glioma cell lines (A172, U87-MG, U251, and T98G) were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). All glioma cell lines and 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (FBS) (both from Gibco, Grand Island, NY, USA). HUVECs were isolated from human umbilical cords and cultured in medium 200 (M200) supplemented with 2% low serum growth supplement (M200+LSGS; Cascade Biologics, Portland, OR, USA), as previously described (
To obtain the shCCAT2-expressing U87-MG cells, pGV248-CCAT2 shRNA and scramble shRNA from GenePharma (Shanghai, China) were transfected into 293T cells along with the packaging plasmids. The lentivirus partials were harvested and the knockdown efficiency was determined by qRT-PCR 48 h after co-transfection. The lentiviruses with pGV248-CCAT2 shRNA or scramble shRNA were used to infect U87-MG cells to construct stable expression in the cell lines for the following experiments. On the other hand, the full-length complementary DNA of human linc-CCAT2 was cloned into the lentiviral expression vector pLVX-IRES-neo; the shRNA of the human linc-CCAT2 was provided by GenePharma. The lentiviruses with pLVXIRES-neo-linc-CCAT2 and pLVX-IRES-neo-shRNA were used to infect HUVECs to construct stable expression in the cell lines for the following experiments (
U87-MG glioma cells were grown with 10% depleted FBS (FBS was pre-depleted of bovine exosomes by ultracentrifugation at 4°C, 100,000 × g, 16 h). When cells were 70% confluent, they were rinsed three times with phosphate-buffered saline (PBS) and cultured for 48 h with 10% depleted FBS. Exosomes were isolated and purified from the U87-MG cell supernatant as previously described (
Transmission electron microscopy (TEM) was used to identify the morphology of exosomes as previously described (
RNAzol RT (Molecular Research Center, USA) was used to extract total RNA from glioma cell lines, HUVECs and exosomal sources (
Western blotting was used to identify the U87-MG exosome markers Alix, Tsg101, CD9 (
Immunofluorescence staining was performed to confirm that HUVECs could take up exosomes. U87-MG cells were labeled with 3,3′-dihexadecyloxacarbocyanine perchlorate (CM-Dio; Invitrogen, Grand Island, NY, USA), according to the supplier's instructions. Exosomes derived from Dio-labeled U87-MG cells were routinely collected, and then HUVECs were incubated with 100 µg/ml of exosomes for 6 h. Next, HUVECs were rinsed with PBS and fixed with 4% paraformaldehyde at room temperature for 30 min and then pre-incubated with sodium borohydride (1 mg/ml in PBS) to decrease autofluorescence. The cells were then incubated overnight at 4°C with a CD31 primary antibody (mouse monoclonal anti-CD31, 1:100; Abcam) and then incubated for 1 h with a secondary antibody conjugated to Alexa Fluor 594 (1:200; Abcam). Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI, 0.5 µg/ml; Invitrogen). Images were obtained with a fluorescence microscope (Leica, Solms, Germany).
The scratch-wound assay was used to analyze the migration ability of HUVECs. Briefly, 2×105 cells were seeded into 12-well plates and were maintained at 37°C to permit cell adhesion and the formation of a confluent monolayer. Next, these confluent monolayers were ‘scratch’-wounded with a p200 pipet tip. The medium was removed and rinsed once with PBS to remove the debris and to smooth the edge of the scratch. The medium was then was replaced with fresh M200+LSGS medium that contained 100 µg/ml of ncU87-Exo, shU87-Exo, or control medium. HUVEC-negative control, HUVEC-linc-CCAT2 overexpression, and dowregulated HUVEC-linc-CCAT2 cells were cultured with M200+LSGS. Wound closure was monitored via the collection of digital images at 0 and 24 h. The wound closure was analyzed with MetaMorph software (Molecular Devices, Sunnyvale, CA, USA), and the wound area at each time-point was normalized to its corresponding area at 0 h.
A Cell Counting Kit-8 assay (CCK-8; Dojindo) was used to assess cell proliferation. Briefly, HUVECs were seeded at 5×104 cells/ml (100 µl/well) in a 96-well plate. After quiescence for 12 h, the cells were treated with fresh M200+LSGS medium containing 100 µg/ml ncU87-Exo, shU87-Exo, or control medium. HUVEC-negative control, HUVEC-linc-CCAT2 overexpression, and downregulated HUVEC-linc-CCAT2 cells were cultured with M200+LSGS. At days 0, 1, 2, 3, 4, and 5, 10 µl of CCK-8 solution was added to the HUVECs and incubated for 3 h at 37°C. The absorbance was assessed at 450 nm with a microplate reader. All experiments were performed in triplicate and repeated at least three times.
The CAM assay was performed to confirm the effect of exosomes on blood vessel formation in developing fertilized chicken eggs (
To determine the level of VEGF, TGF-β, and FGF secreted by HUVECs, 8×105 cells were seeded into 6-well plates and cultured with fresh M200+LSGS medium containing 100 µg/ml ncU87-Exo, shU87-Exo, or control medium for 48 h. HUVECs-negative control, HUVEC-linc-CCAT2 overexpression, and downregulated HUVEC-linc-CCAT2 cells were cultured with M200+LSGS. Then, the cell supernatants were collected, centrifuged to remove the cells and stored at −80°C. Specific VEGF, TGF-β, and FGF ELISA kits (all from Westang Bio-Tech, Shanghai, China) were used to identify protein levels.
For cell hypoxia experiments, 8×105 HUVECs were seeded into 6-well plates and quiescence followed for 12 h. The cells were then cultured with M200+LSGS medium and exposed to normoxia with 21% O2 and 5% CO2 or cultured with fresh M200+LSGS medium containing 100 µg/ml ncU87-Exo, shU87-Exo, or control medium in a hypoxic incubator with 1% O2, 94% N2, and 5% CO2 (Forma Series II Water Jacketed CO2 incubator; Thermo Fisher) for 48 h. Concomitantly, HUVEC-negative control, HUVECs-linc-CCAT2 overexpression, and downregulated HUVEC-linc-CCAT2 cells were also cultured with M200+LSGS under hypoxic conditions for 48 h as described aforementioned.
Flow cytometry was performed according to the operation instructions of the Annexin V-FITC/PI apoptosis detection kit (Dojindo, Kumamoto, Japan). Briefly, 5×105 cells were harvested and suspended in 200 µl of binding buffer, and then 10 µl of Annexin V-FITC and 5 µl of PI were added for a 15-min light cycle, avoiding incubation at room temperature. Finally, the cells were resuspended in 250 µl of binding buffer and analyzed with the Guava® easyCyte™ system (Millipore, Billerica, MA, USA). All of these experiments were performed in triplicate and repeated at least three times.
Statistical analysis was performed with the SPSS Graduate Pack, version 11.0, statistical software (SPSS). Differences between two groups were analyzed by Student's t-test. Data are expressed as the means ± standard deviations (SDs) of three independent experiments. P-values of <0.05 were considered to be statistically significant.
Our previous research (
The glioma cell line U87-MG exhibited the highest expression level of linc-CCAT2 among the four cell lines, thus we used U87-MG cells in the following experiment.
Furthermore, the morphology of ncU87-Exo and shU87-Exo cells was observed by TEM; ncU87-Exo was similar to shU87-Exo (50–100 nm in diameter), and each vesicle revealed a classical cup- or round-shaped appearance (
In addition, qRT-PCR was used to identify the expression level of linc-CCAT2 in ncU87-Exo and shU87-Exo, as shown in
Exosomes must be internalized by recipient cells and release their cargo to achieve their function. Therefore, we explored whether ncU87-Exo and shU87-Exo could be internalized by HUVECs. As shown in
Tumor angiogenesis is important for tumor progression, so we further investigated the function of ncU87-Exo and shU87-Exo in the regulation of HUVEC migration, proliferation, and tube formation
To investigate the possible underlying mechanism in the promotion of angiogenesis from exosomes derived from glioma cells, we incubated HUVECs with 100 µg/ml ncU87-Exo, shU87-Exo, and control medium and applied qRT-PCR and ELISA to detect the expression level of angiogenesis-related genes (VEGF, TGFβ, FGF, KDR, Angio, ICAM, and FGFR) and proteins (VEGF, TGFβ, and FGF) in HUVECs. As shown in
In the next step, we performed flow cytometric analysis to quantify the number of apoptotic or necrotic HUVECs after treatment with hypoxia. As shown in
To investigate the possible mechanism of exosome release by glioma cells in the decrease of HUVEC apoptosis induced by hypoxia, we incubated HUVECs with 100 µg/ml ncU87-Exo, shU87-Exo, and control medium under hypoxic conditions for 48 h, and applied qRT-PCR and western blot assays to detect the expression level of apoptosis-related factors (Bcl-2, Bax, and caspase-3) in HUVECs. As shown in
Our research indicated that ncU87-Exo cells were enriched in linc-CCAT2 and could upregulate their expression level in HUVECs as well as stimulate VEGF, TGFβ, FGF, and KDR gene expression and VEGF, TGFβ, and FGF protein secretion, which promoted HUVEC angiogenesis
Furthermore, we investigated the expression level of angiogenesis-related genes (VEGF, TGFβ, FGF, KDR, Angio, ICAM and FGFR) and proteins (VEGF, TGFβ and FGF) for linc-CCAT2 overexpression and downregulation in HUVECs. As shown in
Flow cytometric analysis was also used to quantify the number of apoptotic or necrotic HUVECs in the negative control, downregulated and overexpressed groups when exposed to hypoxia. As shown in
Similar to our ncU87-Exo results, as shown in
Despite advances in surgical and medical therapy for glioma in recent years, the prognosis of patients with malignant glioma is extremely poor (
It has been recently reported that lncRNAs demonstrate incredible functions in the control of gene expression and chromatin structure, including the recruitment of chromatin-modifying proteins, the modulation of protein-DNA binding, the organization of nuclear architecture, the regulation of mRNA stability and translation, and the modulation of mRNA levels, among other functions (
It has been demonstrated that most solid tumors rely on angiogenesis for continuous growth, and tumor blood vessels provide nutrition and oxygen to the tumor, resulting in tumor progression (
In the present study, we first assessed the expression level of linc-CCAT2 in 4 glioma cell lines. We found that U87-MG glioma cells expressed the highest level of linc-CCAT2 and therefore used these cells in our experiments. Subsequently, we applied shRNA transfection technology to inhibit linc-CCAT2 expression in U87-MG cells, and we found that silencing linc-CCAT2 expression in U87-MG cells significantly decreased its expression in exosomes but did not influence exosome size or concentration. Thirdly, we investigated the function of ncU87-Exo and shU87-Exo in the regulation of HUVEC angiogenesis, and we found that both ncU87-Exo and shU87-Exo could be effectively internalized by HUVECs. However, we also found that the linc-CCAT2 expression level in the shU87-Exo-treated HUVECs was significantly lower than in the ncU87-Exo-treated HUVECs, which was possibly due to linc-CCAT2 overexpression in HUVECs. Angiogenesis functional assays revealed that ncU87-Exo cells exhibited an improved ability to promote HUVEC migration, proliferation, and tubular-like structure formation
Our previous study (
The growth of blood vessel networks occurs by angiogenesis; the inhibition of endothelial cell apoptosis that provides endothelial cell survival is thought to be an essential mechanism during angiogenesis (
In conclusion, the present study demonstrated that glioma cell-derived exosomes transfer linc-CCAT2 as a key mediator in noncontact cell-to-cell communication and in the regulation of glioma angiogenesis. In light of several studies that have highlighted the importance of exosomes in cancer biology and the results described here, we suggest that targeting exosomes and linc-CCAT2 may represent two new therapeutic applications in glioma treatment and recommend that these factors be further explored for future clinical use.
This study was supported by the National Scientific Foundation of China grant nos. 81560411 and 81560193.
Characterization of exosomes released by ncU87-MG cells and shU87-MG cells. (A) linc-CCAT2 expression levels were evaluated by qRT-PCR in the following four glioma cell lines: U87-MG, U251, A172, and T98G; non-glioma 293T cells were used as controls. U87-MG cells exhibited the highest expression level of linc-CCAT2 (compared with the 293T cells, *P<0.01; compared with the U251, A172, and T98G cells, #P<0.05). (B) The knockdown effects of linc-CCAT2 were assessed by qRT-PCR in U87-MG cells transfected with the shRNA or negative controls; the linc-CCAT2 shRNA3 was the most efficient in silencing linc-CCAT2 mRNA (compared with the normal and negative controls, *P<0.01; compared with shRNA1 and shRNA2, #P<0.05). (C) ncU87-Exo cells were highly enriched in linc-CCAT2 transcripts compared with shU87-Exo (*P<0.01). (D and E) The nanoparticle size distribution and concentrations for ncU87-Exo and shU87-Exo were obtained via NTA, and the morphology of ncU87-Exo and shU87-Exo was observed by TEM. (F) The ncU87-Exo and shU87-Exo concentrations were normalized to final cell counts; there were no significant differences observed between ncU87-Exo and shU87-Exo cells (P>0.05). (G) Western blot analysis of exosomal markers Alix, Tsg101, and CD9 in ncU87-Exo and shU87-Exo; equal amounts of exosomes (300 ng) were used for the assay. qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction; NTA, Nanoparticle Tracking Analysis; TEM, transmission electron microscopy.
ncU87-Exo and shU87-Exo are internalized by HUVECs. (A) Immunofluorescence images of DAPI (blue)-CD31 (red) HBMECs co-cultured with CM-Dio (green) labeled ncU87-Exo and shU87-Exo at 6 h. (B) qRT-PCR was applied to determine linc-CCAT2 expression levels in HUVECs when incubated with 100 µg/ml ncU87-Exo and shU87-Exo for 24 h; the linc-CCAT2 expression level in ncU87-Exo-treated HUVECs was significantly higher than that in the shU87-Exo-treated HUVECs (*P<0.01). HUVECs, human umbilical vein endothelial cells; qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction.
ncU87-Exo and shU87-Exo regulates HUVEC migration, proliferation, and tube formation
ncU87-Exo and shU87-Exo regulate angiogenesis related-genes and protein expression in HUVECs. (A) qRT-PCR analysis of the expression level of angiogenesis-related genes in HUVECs treated by ncU87-Exo and shU87-Exo. Compared with the shU87-Exo group, ncU87-Exo significantly upregulated VEGF, TGFβ, FGF and KDR gene expression. (B) ELISA analysis of the secretion level of angiogenesis-related proteins in HUVECs treated by ncU87-Exo and shU87-Exo. Compared with the shU87-Exo group, ncU87-Exo significantly increased VEGF, TGFβ, and FGF protein secretion. (*P<0.05 when compared to the control medium; #P<0.05 when compared to shU87-Exo). HUVECs, human umbilical vein endothelial cells; qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction; VEGF, vascular endothelial growth factor; TGFβ, transforming growth factor β.
ncU87-Exo and shU87-Exo decrease HUVEC apoptosis induced by hypoxia
ncU87-Exo and shU87-Exo regulate the expression of apoptosis-related factors in HUVECs induced by hypoxia. (A) qRT-PCR analysis of the expression level of apoptosis-related factors Bcl-2, Bax, and caspase-3 in HUVECs treated by ncU87-Exo and shU87-Exo after hypoxia. Compared with the control medium group and the shU87-Exo group, ncU87-Exo significantly upregulated Bcl-2 gene expression and inhibited Bax and caspase-3 gene expression. (B and C) Western blot analysis revealed that both ncU87-Exo and shU87-Exo increased Bcl-2 expression and decreased Bax and caspase-3 expression, while ncU87-Exo was more efficient. (*P<0.05 when compared to the control medium; #P<0.05 when compared to shU87-Exo). HUVECs, human umbilical vein endothelial cells; qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction; Bcl-2, B-cell leukemia 2; Bax, Bcl-2 associated X protein.
linc-CCAT2 regulates HUVEC migration, proliferation, and tube formation
linc-CCAT2 regulates angiogenesis-related genes and protein expression in HUVECs. (A) qRT-PCR analysis of the expression level of angiogenesis-related genes in linc-CCAT2 overexpression, downregulation and negative control HUVECs. linc-CCAT2 overexpression in HUVECs increased the gene expression of VEGF, TGFβ, and KDR, while downregulation of linc-CCAT2 inhibited VEGF, TGFβ, and KDR expression. (B) ELISA analysis of the level of secreted angiogenesis-related proteins in linc-CCAT2 overexpression, downregulation and negative control HUVECs. linc-CCAT2 overexpression in HUVECs increased VEGF and TGFβ protein secretion, while downregulation of linc-CCAT2 inhibited VEGF and TGFβ protein secretion. (*P<0.05 when compared to the negative control; #P<0.05 when compared to the negative control). HUVECs, human umbilical vein endothelial cells; qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction; VEGF, vascular endothelial growth factor; TGFβ, transforming growth factor β.
linc-CCAT2 decreases HUVEC apoptosis induced by hypoxia
linc-CCAT2 regulates apoptosis-related factor expression in HUVECs induced by hypoxia. (A) qRT-PCR analysis of the expression level of apoptosis-related factors Bcl-2, Bax and caspase-3 in linc-CCAT2 overexpression, downregulation and negative control HUVECs. Compared with the negative control HUVECs, overexpression promoted Bcl-2 gene expression and inhibited Bax and caspase-3 gene expression, while downregulation of linc-CCAT2 in HUVECs inhibited Bcl-2 gene expression and promoted Bax and caspase-3 gene expression. (B and C) Western blot analysis of the expression level of Bcl-2, Bax, and caspase-3 in HUVECs. Compared with the negative control HUVECs, linc-CCAT2 overexpression improved Bcl-2 protein expression and decreased Bax and caspase-3 protein expression, while downregulation of linc-CCAT2 decreased Bcl-2 protein expression and increased Bax and caspase-3 protein expression. (*P<0.05 when compared to the negative control; #P<0.05 when compared to the negative control). HUVECs, human umbilical vein endothelial cells; qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction; Bcl-2, B-cell leukemia 2; Bax, Bcl-2 associated X protein.
Primers used for qRT-PCR.
Genes | Forward primer (5′-3′) | Reverse primer (5′-3′) |
---|---|---|
h-linc-CCAT2 | CCCTGGTCAAATTGCTTAACCT | TTATTCGTCCCTCTGTTTTATGGAT |
h-FGF | CAATTCCCATGTGCTGTGAC | ACCTTGACCTCTCAGCCTCA |
h-FGFR | GACGGCTCCTACCTCAA | GCTGTAGCCCATGGTGTTG |
h-VEGF | CGCTCGGTGCTGGAATTTGA | AGTGGGGAATGGCAAGCAAA |
h-KDR | GTGATCGGAAATGACACTGGAG | CATGTTGGTCACTAACAGAAGCA |
h-TGFβ | TTGAGGGCTTTCGCCTTAGC | TGAACCCTGCGTTGATGTCC |
h-ICAM | AACCCATTGCCCGAGC | GGTGAGGATTGCATTAGGTC |
h-Angio | CTCGCTTCGGCAGCACA | GGTGGTCGGAGATTCGTAGC |
h-Bcl-2 | TTTGAGTTCGGTGGGGTCAT | TGACTTCACTTGTGGCCCAG |
h-Bax | TGGCAGCTGACATGTTTTCTGAC | TCACCCAACCACCCTGGTCTT |
h-caspase-3 | GCACTGGAATGTCAGCTCGCA | GCCACCTTCCGGTTAACACGA |
h-GAPDH | ATCCCATCACCATCTTCC | GAGTCCTTCCACGATACCA |
qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction; VEGF, vascular endothelial growth factor; TGFβ, transforming growth factor β; ICAM-1, intercellular adhesion molecule-1; Angio, angiogenin; Bcl-2, B-cell leukemia 2; Bax, Bcl-2 associated X protein.