Contributed equally
Fat mass and obesity associated (FTO) is a protein-coding gene. FTO gene is an obesity related gene, also known as the obesity gene. It has been reported previously that FTO is associated with a variety of malignant cancers, such as breast, thyroid and endometrial cancer. The aim of the present study was investigate the FTO expression of human gastric cancer and to investigate its clinical value. FTO expression was determined by immunohistochemical analysis with tissue microarrays in GC tissues and corresponding adjacent non-tumor tissues. Moreover, the results in protein and mRNA level were confirmed by the real-time PCR and western blot analysis. The relationship between the FTO expression and the pathological characteristics of GC patients was also explored. In addition, by using MTT, clone formation and Transwell assays, we studied the effects of FTO expression on biological function of GC cells
Gastric cancer (GC) is the fifth most common cancer and the third most common cause of cancer-related death worldwide (
FTO also known as ALKBH9, it is localized on chromosome 16q12.2, FTO belongs to the non-heme Fe II/α-KG-dependent dioxygenase AlkB family proteins that also includes ABH1 to ABH8 (
To date, no research has been reported on whether FTO is associated with GC. The aim of this study was to investigate the FTO expression in GC patient specimens and to appraise the clinicopathological implications of FTO expression in GC. Our efforts are aimed at discovering the potential influence of FTO in carcinogenesis and progression of GC.
Gastric cancer (GC) specimens were collected from 128 patients with primary gastric cancer during surgery in Hospital Affiliated of Nantong University from January 2010 to February 2011, and the patients were enrolled in this study. After surgical resection, randomly selected carcinoma adjacent tissue specimens and GC tissues were obtained from 128 patients. The carcinoma adjacent tissues were assessed microscopically for the presence of normal cells and absence of dysplastic cells, and taken >3 cm distance from the tumor margin. Immediately the fresh sample was divided into two parts, frozen in liquid nitrogen, one was maintained at −80°C until use real-time PCR and western blot analysis, the other was embedded in paraffin after fixation in 10% formalin (24–48 h) fixed for immunohistochemical diagnosis. Clinical data were also collected on sex, age, tumor size, TNM stage, and lymph node metastasis. Distant metastasis was determined by radiological examination. Staging and grading referred to the classification of International Union Against Cancer criteria (UICC). The patients who participated in the study did not receive radiotherapy or chemotherapy before surgery. This study was conducted with the approval of the institutional ethics board of the Hospital Affiliated of Nantong University.
Paired cancer tissue and carcinoma adjacent tissue of 24 cases were randomly chosen from 128 gastric cancer patients for western blot analysis. The whole protein was extracted by lysis buffer which contained protease inhibitors (Promega, Madison, WI, USA). The 10% sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to isolate equal amounts of protein, and these proteins were then transferred into a polyvinylidene fluoride (PVDF) membrane. Then the membranes were blocked for 2 h with 5% non-fat milk in TBST (Tris-buffered saline containing 0.1% Tween-20) and incubated with the primary antibodies overnight at 4°C; monoclonal mouse anti-human FTO at 1:1,000 dilution (Abcam, Cambridge, UK) or monoclonal mouse anti-β-actin as internal reference, at 1:2,000 dilution (Sigma-Aldrich, St. Louis, MO, USA). The membranes were washed three times in TBST, for 5 min each time. Then, incubated with IRDye 680 CS-conjugated goat anti-mouse secondary antibody (1:1,000 dilution; Sigma-Aldrich) for 2 h at room temperature according to the manufacturers instructions. Eventually signals were scanned with an Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, usa) and analyzed with PDQuest 7.2.0 software (Bio-Rad Laboratories, Hercules, CA, USA).
A total of 128 GC tissues, 62 matched adjacent non-cancerous tissues specimens were prepared and used in this study. We used tissue microarray (TMA) system (Quick-Ray UT06; Unitma Co., Ltd., Seoul, Korea) in the Department of Clinical Pathology. Core tissue biopsies (2 mm in diameter) were taken from individual paraffin-embedded sections and arranged in recipient paraffin blocks. TMA specimens were cut into 4 µm sections and placed on super frost-charged glass microscope slides. TMA analysis was used as a quality control for hematoxylin and eosin staining. Tissue sections were deparaffinized and rehydrated in graded ethanol. Antigen retrieval was performed by boiling sections in ethylene diaminetetra-acetic acid buffer, pH 6.0, for 3 min in a pressure cooker. Endogenous peroxidase activity was quenched with 3% hydrogen peroxide for 30 min. TMA slides were stained using monoclonal mouse anti-FTO antibody (Abcam) at 4°C overnight. Then, by incubation with a horseradish-peroxidase-conjugated goat anti-mouse secondary antibody (Sigma-Aldrich) at 37°C for 30 min. Slides were then processed using horseradish peroxidase and 3,3-diaminobenzidine chromogen solution and counterstained with hematoxylin. The semiquantitative H-score method was used to convert the expression of FTO to continuous intensity values, based on both the staining intensity and the percentage of cells at that intensity. According to the traditional semi-quantitative pathology scoring, staining intensity was scored as follows: 0 (−, no staining), 1 (+, weak staining), 2 (++, moderate staining), or 3 (+++, intense staining). The percentage of cells stained at a certain intensity was determined and multiplied by the intensity score to generate an intensity percentage score. The final staining score of each tissue sample was the sum of the four intensity percentage scores, and these scores ranged from 0 (no staining) to 300 (100% of cells with +++ staining intensity).
Firstly, the TRIZol (Gibco, Grand Island, NY, USA) was used to extract total RNAs from tumor tissue samples. Then quantitative real-time PCR was performed using HotStart-IT SYBR-Green qPCR Master Mix (2X; USB Corp., Cleveland, OH, USA). In the light of the HotStart-IT protocol, 25 µl actions were run of with 2 µl cDNA. We perform RT-PCR experiments in a LightCycler 480 system (Roche Applied Sciences). PCR steps: first hot start at 95°C for 10 min; then 40 cycles of amplification/quantification at 95°C for 10 sec, next 60°C for 30 sec and 72°C for 30 sec during the time fluorescence was measured. Melting curve analysis was implemented using continuous fluorescence acquisition from 65 to 97°C. These cycling parameters produced single amplicons for both primer sets used on the basis of the presence of a single melt peak. We use the β-actin as the internal reference. The primer sequences are as follows: a 169-bp segment of the FTO gene 5-TGGTGTCCCAAGAAATCGTG-3 (sense) and 5-TGCAGGCCGTGAACCAC-3 (antisense), a 107-bp segment of the β-actin gene 5-AACTTCCGTTGCTGCCAT-3 (sense) and 5-TTTCTTCCACAGGGCTTTG-3 (antisense). All quantitative real-time PCRs were repeated 3 times for each gene, and each sample was done in triplicate.
Four human GC cell lines (BGC823, MKN45, SGC7901 and AGS) and the human normal stomach epithelial mucosa cell line (GES) from the Cell Bank of the Committee on Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). These cell lines were grown in Dulbeccos modified Eagles medium (DMEM; Invitrogen, Carlsbad, CA, USA) or RPMI-1640 medium (Gibco) containing with 10% fetal bovine serum (FBS; HyClone Laboratories, Inc., Logan, UT, USA) and were cultured in humidified incubator at 37°C with 5% CO2.
The siRNA oligos for FTO were designed and purchased from Shanghai GenePharma Co., Ltd., (Shanghai, China). The targeting sequence was FTO-siRNA1: GCAGTGTATCTGAGGAGCTCCATAA, FTO-siRNA2: CGGTATCTCGCATCCTCATTGGTAA and FTO-siRNA3: TCAGCGGTGGCAGTGTACAGTTATA. A FTO overexpression plasmid (pcDNA3.1-FTO) containing the coding sequence was constructed using PCR-generated fragments and pcDNA 3.1(+) vector. Then the PCR products were cloned into the mammalian expression vector pcDNA 3.1(+). All constructs were confirmed by DNA sequence analysis. We use the stable transfectant of the pcDNA 3.1(+) vector as the control group. During the course of transfection, the FTO siRNA and pcDNA 3.1(+)-FTO expression plasmids were transfected into GC cells using Lipofectamine 2000 (Invitrogen) according to the manufacturers instructions. The western blot assay was used to evaluate the level of FTO expression after transfection.
MTT assay was used to assess the cell viability. Firstly, we use the 96-well plates at 5×103 cells/well in complete medium for the cells. The cells were cultured for 24 h. Next, the culture medium was replaced with a medium which contained 10% FBS. Then, 10 µl MTT was added to each corresponding test and the cells were kept in culture for 4 h. Finally, all samples were measured at 490 nm spectrophotometric absorbance.
Cell migratory capacity was confirmed by Transwell assay (BD Biosciences, San Jose, CA, USA) according to the manufacturers instructions. These transfected cells were harvested 24 h after transfection. Then 3.0×105 transfected cells or untreated cells were added to each upper insert in serum-free medium. To the matched lower chamber, 500 µl of medium containing 10% FBS was added. After incubation, non-migrated cells were removed from the upper surface of the transwell membrane with a cotton swab, and the migrated cells on the lower membrane surface were fixed in methanol. Lastly, 0.1% crystal violet was used to stain cells, then photographed and counted. The above experiments were performed in triplicate and repeated three times.
Cells (5×104/well) were plated in a 24-well plate after transfection. After 24 h, the cells collected and seeded (1,000–1,500/well) in a fresh 6-well plate for 12 days. Surviving colonies (>50 cells/colony) were counted after fixed with methanol/acetone (1:1) and stained with 5% gentian violet (ICM Pharma, Singapore). After washing three times with phosphate-buffered saline (PBS) to remove excess dye, the cells were photographed and counted. The experiment was carried out in triplicate wells three times.
All data were analyzed using statistical analyses performed using the SPSS 17.0 (SPSS, Inc., Chicago, IL, USA). The relationship between the FTO expression level and the clinicopathological characteristics was subjected to χ2 analysis. Survival analysis was calculated using the Kaplan-Meier method and curves were assessed using the log-rank test. Coxs proportional hazards model was used to carry out the multivariate analysis of several prognostic factors. The results are presented as the mean ± SD of at least three independent experiments and P<0.05 was considered to be statistically significant.
The expression of FTO was determined by TMA-based immunohistochemistry (IHC) studies. We showed that the expression level of FTO in GC tissues and adjacent tissues were different, FTO expression was significantly elevated in GC patients but negative or low in non-tumor tissues (
The above results were further tested by western blot analysis in 24 random pairs of GC and corresponding carcinoma adjacent tissues. Furthermore, the representative western blot results in 6 cases are shown in
We use the χ2 test to analyze the correlation between the FTO expression in GC tissues and various clinicopathological characteristics of GC patients are listed in
To investigate the prognostic effect of FTO expression on overall survival rate of GC patients, Kaplan-Meier survival curves and the log-rank test was used to compare the 5-year survival rate of patients with high or low FTO expression level. According to the immunohistochemical results of FTO staining in tumors cells, GC patients were divided into two groups including FTO low expression group and high expression group. We found that the group with the high FTO expression levels had a poorer prognosis than the group with low levels of FTO expression (χ2=8.415, P<0.001;
Univariate and multivariate analysis was used to estimate the independent prognostic factors of FTO (
Thus, based on the above, we hypothesized that FTO played the role as a cancer promoting gene. We used the MTT and colony formation assays to identify the effect of FTO on cell viability and proliferation. MKN45 cells have the highest FTO expression in the four GC cells (
The effects of FTO on the viability, proliferation, migration and invasion of GC cells were evaluated. AGS cell line was selected to investigate whether overexpression of FTO affected cell viability, proliferation, migration and invasion in GC. In addition, the FTO expression level of AGS cell line was the lowest in the four GC cell lines. Thus, AGC cells were transfected with recombinant plasmids containing the full ORF of the wild-type FTO. Western blot analysis confirmed that the cells transfected with the FTO recombinant plasmid showed higher expression levels of the FTO protein compared with cells transfected with the empty vector control pEGFP-N1 (
Despite the incidence of gastric cancer is declining, gastric cancer imposes a significant health burden around the world. GC is often diagnosed in advanced stages and carries a poor prognosis (
FTO is mapped on chromosome 16p12.2 and is widely expressed in many tissues of human body, with highest levels are detected in the brain, pancreatic islets, and the digestive organs (
In the present study, the FTO protein expression was detected by western blot analysis. We found that FTO protein was upregulated in the GC tissues compared with the carcinoma adjacent tissues. Moreover, we use quantitative PCR to analyze the mRNA level of FTO. PCR results showed that the mRNA levels of FTO in the GC tissues were obviously higher compared with the corresponding carcinoma adjacent tissues. To further confirm the results of western blot analysis and qPCR, we used immunohistochemical staining to examine the FTO expression in GC tissues and to estimate whether the FTO expression level has links with clinicopathological parameters and the prognosis of GC patients. We also found that FTO expression in GC tissues was significantly higher than the adjacent non-cancerous tissues. In addition, FTO expression was positively correlated with histological differentiation, lymph node metastasis and TNM stage in GC. Therefore, as well as in breast, thyroid and endometrial cancer, FTO overexpression may promote the occurrence of GC and the abnormal expression of FTO might be associated with GC tumor progression and metastasis. Moreover,
According to the Kaplan-Meier analysis, the overall 5-year survival of GC patients and the level of FTO expression were negatively correlated. High FTO expression had a significant relationship with shorter survival time of GC patients. Based on the above experimental results, we can conjecture that FTO may play more vital role in advanced cancer of the stomach and the FTO protein may have a direct effect on the invasion of GC. Multivariate analysis indicated that in overall survival of GC patients, FTO expression was an independent prognostic indicator, and high expression of FTO gene may indicate poor prognosis. Recently, FTO has been shown to contribute to the development of several cancer types (
In conclusion, our data indicate that the overexpression of FTO is involved in cancer progression and dedifferentiation in gastric carcinoma patients and the detection of increased FTO expression might help confirm GC patients with a poor prognosis. However, the exact mechanism of FTO gene in gastric cancer and other tumors is not completely understood. Therefore, further large studies are needed to figure out the relationship of FTO expression with GC and to investigate the mechanisms underlying the relationship.
The present study was funded by a grant from the Nantong Science and Technology Project (MS22016033).
fat mass and obesity associated
gastric carcinoma
tumor node metastasis
Representative patterns of FTO expression in GC tissues and adjacent non-cancerous tissue as determined with IHC analysis with tissue microarrays. (A) Negative staining in adjacent non-tumor tissues, scored as FTO (−). (B) Weak staining in well-differentiated GC tissues, scored as FTO (+). (C) Moderate staining in moderately differentiated GC tissues, scored as FTO (++). (D) Strong staining in poorly differentiated GC tissues, scored as FTO (+++). Original magnification, ×40 or ×200.
FTO gene expression is significantly upregulated in GC tissues. (A) Western blot analysis of six representative paired samples of GC (T) and their matched adjacent non-cancerous tissues (N). Total proteins were prepared from tissue specimens obtained from gastric cancer and adjacent non-cancerous tissues, sequentially probed with anti-FTO and anti-β-actin antibodies. (B) Relative average FTO protein expression levels were remarkably upregulated in 18 of 24 (75%) GC tissues compared with the corresponding adjacent non-cancerous tissues (P=0.024). (C) FTO mRNA expression level in GC tissues and paired adjacent non-cancerous tissues were determined by real-time RT-PCR and normalized to β-actin. The expression of FTO was significantly augmented in gastric carcinoma samples as compared with that in adjacent non-cancerous tissues (P<0.001).
Association of FTO with patient prognosis in gastric cancer. Kaplan-Meier survival curves of the study population showing that patients with high FTO expression had a significantly poorer prognosis than those with low FTO expression (P<0.001, log-rank test).
The FTO protein expression levels by western blot analysis in four GC cell lines and a gastric epithelial mucosa cell line (GES).
Knockdown of FTO expression inhibits GC cell viability, proliferation, migration and invasion
Overexpression of FTO promotes the viability, proliferation, migration and invasion of GC cells
FTO expression compared in gastric cancer and adjacent non-tumor tissues.
FTO expression | ||||
---|---|---|---|---|
Clinical parameters | N | Low level | High level | P-value |
Gastric cancer tissues | 128 | 56 | 72 | 0.023 |
Adjacent non-tumor tissues | 62 | 38 | 24 |
P<0.05 was considered statistically significant. FTO, fat mass and obesity associated.
Clinicopathological correlation of FTO expression in gastric cancer patients.
FTO expression | ||||
---|---|---|---|---|
Clinical parameters | Total (n=128) | Low level (n=56) | High level (n=72) | P-value |
Sex | 0.929 | |||
Male | 68 | 30 | 38 | |
Female | 60 | 26 | 34 | |
Age (years) | 0.169 | |||
<50 | 42 | 22 | 20 | |
≥50 | 86 | 34 | 52 | |
Tumor size (cm) | 0.052 | |||
<4 | 54 | 29 | 25 | |
≥4 | 74 | 27 | 47 | |
Location | 0.681 | |||
Cardia | 50 | 23 | 27 | |
Body/antrum | 78 | 33 | 45 | |
Differentiation | <0.001 |
|||
Well/moderate | 52 | 13 | 39 | |
Poor | 76 | 43 | 33 | |
Depth of invasion | 0.907 | |||
T1/2 | 45 | 20 | 25 | |
T3/4 | 83 | 36 | 47 | |
Lymph node metastasis | 0.029 |
|||
Negative | 46 | 26 | 20 | |
Positive | 82 | 30 | 52 | |
TNM stage | <0.001 |
|||
I/II | 69 | 40 | 29 | |
III/IV | 59 | 16 | 43 | |
Distant metastasis | 0.270 | |||
Negative | 120 | 54 | 66 | |
Positive | 8 | 2 | 6 | |
0.766 | ||||
Negative | 36 | 15 | 21 | |
Positive | 92 | 41 | 51 |
FTO, fat mass and obesity associated
P<0.05 was considered statistically significant.
Cox proportional hazards model analysis of prognostic factors.
Univariate analysis | Multivariate analysis | |||||
---|---|---|---|---|---|---|
Variables | HR | 95% CI | P-value | HR | 95% CI | P-value |
FTO expression (low vs. high) | 0.544 | 0.384–0.865 | <0.001 |
0.627 | 0.476–0.926 | <0.001 |
Sex (male vs. female) | 1.028 | 0.928–1.658 | 0.580 | – | – | – |
Age (<50 vs. ≥50 years) | 1.016 | 0.930–1.806 | 0.925 | – | – | – |
Tumor size (<4 vs. ≥4 cm) | 1.037 | 0.710–1.416 | 0.064 | – | – | – |
Location (cardia vs. body/antrum) | 1.325 | 1.085–2.140 | 0.904 | – | – | – |
Differentiation (poor vs. well/mod) | 0.863 | 0.526–1.376 | 0.007 |
0.830 | 0.516–1.526 | 0.353 |
Distant metastasis (+ vs. -) | 1.089 | 0.790–1.682 | 0.626 | – | – | – |
Depth of invasion (T3/T4 vs. T1/T2) | 1.140 | 0.850–1.783 | 0.072 | – | – | – |
TNM stage (III + IV vs. I + II) | 1.056 | 0.784–2.021 | 0.002 |
0.949 | 0.650–1.458 | 0.001 |
Lymph node metastasis (+ vs. -) | 1.956 | 1.264–2.560 | 0.030 |
1.418 | 0.850–1.813 | 0.552 |
HR, hazard ratio; CI, confidence interval
P<0.05 was considered statistically significant.