Cells of the human colon cancer cell lines SW620 and SW480 were purchased from ATCC (Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM; Nissui, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA), and penicillin/streptomycin (Gibco, Carlsbad, CA, USA).

Cells were irradiated with X-rays or C-ions at room temperature. X-rays were produced by a PANTAK HF-320S generator (Shimadzu Corp., Kyoto, Japan), at 200 kVp and 20 mA, and filtered with 0.5 mm Al and 0.5 mm Cu (36). C-ions were accelerated by the Heavy-Ion Medical Accelerator in Chiba at the National Institute of Radiological Sciences, Chiba, Japan (37). The initial energy of the C-ion beams was 290 MeV/nucleon, and the LET value was 80 keV/µm with a monoenergetic beam (20). An outline of the experimental procedures after irradiation is shown in Fig. 1.

The cells were transiently transfected with siRNA specific for Fra-1 using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA), as previously described (8). The sequences of the Fra-1 siRNA were as follows: Sense, agaaaucugggcugcagcgagagau, and antisense, aucucucgcug cagcccagauuucu. Fra-1 protein expression was evaluated by western blotting, and Fra-1 downregulation was confirmed at 48 h after siRNA transfection by comparison with the Fra-1 expression level of the cells transfected with scrambled negative control siRNA (Invitrogen).

The coding sequence of the human FRA1 gene was amplified from cDNA derived from SW480 cells by PCR using a gene-specific primer set: Sense, ggggacaagtttgtacaaaaaagcaggcttcaccatgttccgagacttcggggaacccggcccg, and antisense, ggggaccactttgtacaagaaagctgggtctcacaaagcgaggagggttggagagccaag. The PCR fragment was introduced into a pDONR221 vector for cloning of the gene, in accordance with the instructions for Gateway Cloning Technology (Invitrogen), and confirmed by sequencing. Then, this gene was transferred by LR recombination from its entry clone into a pLenti7.3V5-DEST vector containing Emerald Green Fluorescent Protein (EmGFP). pLenti7.3/V5-GW/lacZ was the construct for the negative control. Lentiviral stocks were produced in 293FT cells in accordance with a modification of the manufacturer's protocol (Invitrogen). Briefly, 18 µl of FuGENE 6 was diluted in 0.6 ml of Opti-MEM I medium, and then 1.5 µg of plasmid DNA and 4.5 µg of packaging mix (Applied Biological Materials Inc., Richmond, BC, Canada) were added to this medium. These transfection complexes were incubated at room temperature and added to 5 ml of Opti-MEM I containing 6×10⁶ cells. After incubation at 37°C for 8 h, the culture medium was replaced with 5 ml of DMEM supplemented with 10% heat-inactivated FBS. Virus-containing supernatants were harvested 48 h after transfection and then centrifuged at 3,000 rpm at 4°C for 15 min and passed through a 0.45-µm Millex-HV filter to remove debris. The virus was precipitated at 4°C overnight by adding 3.3 ml of cold 40% PEG6000, to concentrate the virus, and then suspended in 100 µl of phosphate-buffered saline (PBS). Then, 1×10⁵ cells were transduced by 10 µl of the virus preparation in the presence of 6 µg/ml hexadimethrine bromide (Polybrene) for 48 h. Fra-1 protein expression was evaluated by western blotting, and upregulation of Fra-1 was confirmed at 48 h after lentivirus transfection by comparison with the Fra-1 expression level of the cells transfected with the negative control.

Cell survival curves were determined by a colony formation assay as previously described, with some modifications (38). Briefly, cell cultures at 70% confluence were rinsed with PBS and detached with 0.1% trypsin/PBS. Cell numbers were determined with a hemocytometer. Cells were plated in triplicate onto 60-mm diameter plastic dishes and incubated for 12 days, whereupon the colonies were fixed and stained with 1% methylene blue in 30% methanol. Colonies consisting of more than 50 cells were scored as surviving colonies.

For the radiosensitivity analysis, non-irradiated cells or cells irradiated with X-rays at 1, 2, 4, 6, or 8 Gy or C-ions at 0.5, 1, 2, 3, or 4 Gy were used. The cells were trypsinized and counted immediately after irradiation. Eighty cells for non-irradiated cells or 150, 300, 1,500, or 3,000 cells for X-ray irradiation at 1, 2, 4, 6, or 8 Gy or C-ion irradiation at 0.5, 1, 2, 3, or 4 Gy were plated onto 60-mm diameter dishes, respectively. The surviving fraction was normalized to that of the non-irradiated control.

To assess the clonogenicity of the Fra-1 siRNA-transfected or lentivirus-transfected cells, cells were treated with siRNA or lentivirus vector for 48 h before irradiation. Immediately after irradiation, the cells were trypsinized, and the same numbers of cells as that used in the radiosensitivity analysis were plated onto dishes containing fresh media; colony-forming assays were then performed.

Non-irradiated or irradiated cells were trypsinized and counted immediately after irradiation, and the same number of non-irradiated and irradiated cells was plated onto dishes containing fresh media. Two days after irradiation, cells were lysed with RIPA lysis buffer containing PMSF and sodium orthovanadate (Santa Cruz Biotechnology, Dalla, TX, USA) and then used for the western blotting.

For the proteasome inhibitor treatment, two patterns of schedule were used: 1) 10 nM of epoxomicin (proteasome inhibitor; Peptide Institute Inc., Osaka, Japan) was added to the culture media immediately before cell irradiation, and the cells were cultured for 48 h in a 5% CO₂ incubator at 37°C and then lysed, or 2) 10 nM of epoxomicin was added to the culture media 48 h after irradiation, and the cells were cultured in a 5% CO₂ incubator at 37°C for 24 h. The cells were then lysed with RIPA lysis buffer and used for the western blotting.

Immunoblotting was performed as previously described (37). Primary antibodies for human Fra-1 (Santa Cruz Biotechnology) and GAPDH (Trevigen, Bristol, UK) with horseradish peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG (Amersham Biosciences, Buckinghamshire, UK) were used for this study. Protein bands were detected by enhanced chemiluminescence and imaged using a Lumino image analyzer (LAS4000; Fujifilm, Tokyo, Japan).

Quantitative real-time PCR (qRT-PCR) was performed on a LightCycler 480 with Probes Master (Roche Diagnostics, Basel, Switzerland) as previously described (38). The Universal Probe Library (UPL; Roche Diagnostics) probes and primer sequences for the Fra-1 (FOSL1) and GAPDH genes were as follows: FOSL1 (UPL probe: 26) sense, aggaactgaccgacttcctg, and antisense, cagctctaggcgctccttc; GAPDH (UPL probe: 60) sense, agccacatcgctcagaca, and antisense, gcccaatacgaccaaatcc.

Statistical analyses were performed using unpaired Student's t-tests or Mann-Whitney U-tests. P-values of <0.05 was considered to indicate a statistically significant difference.

Surviving fractions of SW620 and SW480 cells were determined after X-ray or C-ion irradiation. Sensitivity to X-ray or C-ion irradiation differed between the cell lines; SW620 showed lower surviving fractions than SW480 at doses greater than 6 Gy for X-ray or 3 Gy for C-ion radiation (Fig. 2). Of note, SW620 cells showed a greater decrease in Fra-1 after 6 Gy for X-ray or 3 Gy for C-ion irradiation than SW480 cells (Fig. 3A and B for X-ray and Fig. 3C and D for C-ion irradiation, respectively).

To investigate a possible association between Fra-1 downregulation and cellular radiosensitivity, we first treated SW480 cells with Fra-1 siRNA. The effectiveness of Fra-1 reduction with siRNA transfection is shown in Fig. 4A. Downregulation of Fra-1 in siRNA-treated SW480 cells showed increased radiosensitivity to 8-Gy X-ray radiation (Fig. 4C) and to 2-, 3-, or 4-Gy C-ion radiation (Fig. 4E), compared with that of the scrambled negative control-treated SW480 cells.

To further clarify the significance of Fra-1 in radioresistance, we next overexpressed Fra-1 in SW620 cells via transfection with a lentivirus vector. Fra-1 induction with lentivirus transfection is shown in Fig. 4B. Further, overexpression of Fra-1 in lentivirus-transfected SW620 cells tended to increase the resistance to X-ray radiation (Fig. 4D) and significantly enhanced the resistance to C-ion radiation at doses greater than 2 Gy (Fig. 4F). Overall, the results indicate that Fra-1 has some role in radioresistance to X-ray or C-ion radiation for SW480 and SW620 cells.

To identify the molecular mechanisms modulating Fra-1 levels after irradiation, we first compared the changes of Fra-1 protein and the corresponding FOSL1 transcript levels in SW620 and SW480 cells after X-ray or C-ion irradiation. Although Fra-1 protein levels significantly decreased after irradiation with 6-Gy X-ray or 3-Gy C-ion radiation (Fig. 5A-D), no alteration in the Fra-1 transcript, FOSL1, levels was found for either the SW620 (Fig. 5A and B) or the SW480 cell lines (Fig. 5C and D), which indicates discrepancies between the reduction of Fra-1 protein and transcript levels in the irradiated cells.

The expression of Fra-1 protein is known to be highly regulated by proteasomal degradation (39). To clarify whether proteasomal degradation was involved in the reduction of the Fra-1 protein levels observed in the irradiated cells, C-ion-irradiated SW620 cells were further studied, because a clear discrepancy between the Fra-1 protein and transcript levels was observed in these cells (Figs. 3C and 5B). Pre-treatment of SW620 cells with the proteasome inhibitor epoxomicin and continued treatment for another 48 h after irradiation (Fig. 6A) blocked the Fra-1 degradation of these irradiated cells compared with that of the non-epoxomicin-treated SW620 cells (Fig. 6B-D). Of note, epoxomicin treatment from 48 h after C-ion irradiation (Fig. 7A) failed to block the reduction of Fra-1 (Fig. 7B-D), which indicates that the degradation of Fra-1 via the proteasome occurred at some time during the first 48 h after irradiation.