Human gastric cancer MGC803 cell line was obtained from the Cancer Research Institute, Xiangya Medical College, Central South University in China. Cells were cultured in RPMI-1640 medium (Gibco; Life Technologies, Vienna, Austria) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc., Vienna, Austria) with the addition of 100 U/ml penicillin, 100 U/ml streptomycin and maintained at 37°C in a humidified atmosphere of containing 5% CO₂. To establish TGF-β1-overexpressing cell lines, the plasmid pCMV6 containing the full-length cDNA of human TGF-β1 (pCMV6-TGF-β1) was constructed by OriGene Technologies (Rockville, MD, USA). MGC803 cells were transfected with TGF-β1-expressing plasmid and the control vector (pCMV6-Neo) using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Carlsbad, CA, USA) according to the manufacturer's protocol. The stable transfectants were established after G418 (Invitrogen; Thermo Fisher Scientific, Inc.) selection. The expression levels of TGF-β1 in stable cell lines were evaluated by western blot analysis.

Diallyl disulfide (DADS), purchased from Fluka Co. (Milwaukee, WI, USA), was dissolved in Tween-80 and stored at −20°C after a 100-fold dilution with saline. Human recombinant TGF-β1 protein was purchased from R&D Systems (Minneapolis, MN, USA). The primary antibodies against TGF-β1 (cat. no. ab92486), Rac1 (cat. no. ab33186), β-catenin (cat. no. ab16051), Ki-67 (cat. no. ab66155), CD34 (cat. no. ab81289) and FITC-conjugated anti-mouse (cat. no. ab6785) or anti-rabbit (cat. no. ab6717) secondary antibodies were provided by Abcam (Cambridge, MA, UK). The primary antibodies against E-cadherin (cat. no. 24E10) and vimentin (cat. no. D21H3) were obtained from Cell Signaling Technology (Danvers, MA, USA). The mouse monoclonal against β-actin antibody (cat. no. sc-8432) and horseradish peroxidase (HRP)-conjugated secondary antibodies (cat. no. sc-2004 and cat. no. sc-2005) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). TGF-β1 receptor inhibitor SB431542 and Rac1 inhibitor NSC23766 were obtained from Cayman Chemical (Ann Arbor, MI, USA). A total of 5 ng/ml TGF-β1, 30 mg/l DADS, 10 µmol/l SB431542 and 50 µmol/l NSC23766 were used for experiments in vitro.

Total RNA was extracted from the cells using TRIzol reagent (Gibco-BRL; Thermo Fisher Scientific, Inc., Grand Island, USA). Reverse transcription was carried out using the RT-PCR system (Promega, Madison, WI, USA). PCR analysis was performed using the GeneAmp PCR kit (Promega). Primer sequences were as follows: TGF-β1 forward, TCTCCAGGCATTTCCACTATTC and reverse, CTCAGGCATTCGTCAACATCTA; Rac1 forward, TGCCTGCTGTTGTAAATGTCTC and reverse, AAAGTTCAGTGCTCGGTGTTCT; β-catenin forward, GGAAGGGACAGTATCGTTTGTT and reverse, GCCTCAGCATCTACCAGCATAG; E-cadherin forward, CTCCCAATACATCTCCCTTCAC and reverse, CGCCTCCTTCTTCATCATAGTAA; vimentin forward, GCGAGGAGAGCAGGATTTCT and reverse, TCTTGTAGGAGTGTCGGTTGTT; β-actin forward, CTGGGACGACATGGAGAAAA and reverse, AAGGAAGGATGGAAGAGTGC. The PCR products were analyzed on 2% agarose gel containing ethidium bromide. Densitometric quantitation of products was determined using the Labwork analysis software (Labworks LLC, Lehi, UT, USA). The relative abundance was expressed as the ratio of the object gene to β-actin.

For total protein extraction, cells were lysed directly on ice for 30 min in lysis buffer [10 mmol/l Tris-HCl (pH 7.6), 100 mmol/l NaCl, 1 mmol/l EDTA (pH 8.0), 100 µg/ml PMSF and 1 µg/ml aprotinin]. The cell lysates were centrifugated at 12,000 rpm for 10 min and the supernatants were collected. Then protein contents were determined using a BCA protein assay kit (Pierce, Rockford, IL, USA).

Protein extracts were loaded on a 10% SDS-polyacrylamide gel for electrophoresis and transferred onto polyvinylidene fluoride (PVDF) membrane. The blots were blocked in 5% skim milk in Tris-buffered saline (TBS) containing 0.1% Tween-20 for 2 h at room temperature, and then incubated with primary antibodies (1:200-500) at 4°C overnight. The membranes were washed in TBS-T and then incubated with HRP-conjugated secondary antibodies (1:1,000-1:2,000). After washed with TBS-T, the membranes were developed by an enhanced chemiluminescence plus (ECL Plus) kit (Amersham Biosciences, Buckinghamshire, UK) and bands were visualized on X-ray film (Kodak, Rochester, NY, USA). Membranes were re-incubated with anti-β-actin antibody to verify equal protein-sample loading. The target protein amounts were normalized towards β-actin quantity using densitometry, then relative fold changes in protein levels were calculated as ratios between treated vs. control group values.

Invasion assays were performed using Transwell^® plates (Corning, Inc., Corning, NY, USA) as previously described (12). Briefly, MGC803 cells were seeded onto Matrigel-coated filters (8-µm pore size), then were treated with TGF-β1 (5 ng/ml) or DADS (30 mg/l) alone, or incubated with TGF-β1 + SB431542 (10 µmol/l) or TGF-β1 + NSC23766 (50 µmol/l) for 24 h or left untreated. The cells that had invaded the lower surface of the filter were fixed and stained with hematoxylin. Invasiveness was determined by counting cells in four microscopic fields per well, and the extent of invasion was expressed as an average number of cells per microscopic field. Invasion rates were expressed as the ratio of the treated group value to the control group value. Transwell migration assays were conducted using the same procedure as for the invasion assay, except using the Matrigel-uncoated filters.

Transfected and untransfected MGC803 cells were injected into the subcutis of the right axillary of male athymic BALB/c nude mice (4 weeks old). The mice were purchased from the Experimental Center of the Chinese Academy of Science in Shanghai. The mice were housed in an environment controlled for temperature (22±2°C), light (12 h light/dark cycle) and humidity (60±10%). The animals were maintained under specific pathogen-free conditions in accordance with the NIH Guide for the Care and Use of Laboratory Animals. The animals were randomly divided into six groups, and each group consisted of five mice. The mice were treated with normal saline, DADS (100 mg/kg) (11), SB431542 (10 mg/kg) (14) and NSC23766 (5 mg/kg) (15) via intraperitoneal injection every 2 days until the termination of the experiment. Tumor volume (cm³) was examined every 6 days and calculated using a standard formula (width² × length × 0.5). Average tumor volumes are presented (n=5 for each group) starting from the twelfth day and continuing until mice were sacrificed at 48 days by cervical dislocation under anesthesia. The xenografts were removed and the tumor size and weight were assessed at 48 days. Tumor tissues were then fixed in formalin and embedded in paraffin. Tissue sections (5 µm-thick) were prepared for subsequent immunohistochemistry analysis. All experiments were performed according to the guidelines for animal use of the Ethics Committee of the University of South China.

Briefly, after slides were dewaxed in xylene and hydrated in graded alcohol solutions, antigen retrieval was performed by heat treatment in 10 mM sodium citrate buffer (pH 8.0). Slides were incubated in 3% H₂O₂ solution to quench endogenous peroxidase activity and then incubated with normal goat serum for 20 min. Slides were incubated with primary antibodies (dilution 1:100) at 4°C overnight. Positive signals were developed with peroxidase-conjugated secondary antibodies and 0.5% diaminobenzidine/H₂O₂ followed by counterstaining with Mayer's hematoxylin, dehydration, clearing and mounting. The slides that were treated with normal goat serum were evaluated as negative controls.

All results are presented as the mean ± SD for three independent experiments. Student's t-tests and one-way ANOVA were used to analyze the differences in expression among groups. P<0.05 were considered to indicate a statistically significant result. Statistical analyses were conducted using the SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA).

We first treated cells with 30 mg/l DADS for different time-points and we examined the effects of DADS on the expression of TGF-β1, Rac1 and β-catenin. The mRNA and protein levels of TGF-β1 were reduced after cells were treated with DADS for 12, 24 and 48 h in a time-dependent manner (Fig. 1A and B). In contrast, Rac1 and β-catenin were decreased in the mRNA and protein levels after incubation for 24 h (Fig. 1A and B). These data indicated that DADS can reduce the expression of TGF-β1, Rac1 and β-catenin. In addition, we observed that a decrease in TGF-β1 occurred after 12 h of incubation, which was earlier than the decreases in Rac1 and β-catenin (24 h). We proposed that downregulation of TGF-β1 by DADS may result in the expression changes of its downstream effectors, Rac1 and β-catenin. The expression of E-cadherin in the mRNA and protein level was increased by DADS after 12 h of treatment. In contrast, the mRNA and protein levels of vimentin were reduced (Fig. 1C and D).

Subsequently, we explored the effects of TGF-β1 on the expression of TGF-β1, Rac1 and β-catenin in MGC803 cells. The expression levels were determined after the cells were incubated with TGF-β1 (5 ng/ml) for 24 h. The mRNA and protein expression levels of TGF-β1, Rac1 and β-catenin were elevated in cells exposed to TGF-β1 (Fig. 2). The results indicated that TGF-β1 can induce upregulation of TGF-β1, Rac1 and β-catenin. Compared with the TGF-β1-treated group, TGF-β1, Rac1 and β-catenin protein levels were decreased in the TGF-β1 + SB431542 group (Fig. 2B). Similarly, these protein levels were decreased after cells were treated with TGF-β1 in the presence of a Rac1 inhibitor, NSC23766. DADS (30 mg/l) treatment produced similar effects to those of SB431542 and NSC23766 (Fig. 2).

We observed that TGF-β1 treatment induced a morphological change (spindle-like morphology) and a decrease in cell-cell junctions, compared with the control group (Fig. 3A). In line with these morphological changes, an increase of vimentin and a decrease of E-cadherin in the mRNA and protein levels were demonstrated in the TGF-β1-treated group (Fig. 3B and C). Conversely, SB431542 and NSC23766 reversed these changes of morphology and EMT markers, which occurred in TGF-β1-treated cells (Fig. 3B and C). DADS exerted similar effects as SB431542 and NSC23766, decreasing vimentin and increasing E-cadherin, concomitantly with significant inhibition of morphological changes similar to mesenchymal cells (Fig. 3).

Subsequently, we further demonstrated that TGF-β1 treatment increased the rates of cell migration and invasion, while DADS neutralized these effects of TGF-β1, as did SB431542 and NSC23766 (Fig. 4). These data indicated that Rac1 mediated EMT induced by TGF-β1, whereas downregulation of TGF-β1/Rac1 signaling by DADS resulted in inhibition of EMT, migration and invasion.

We have previously reported that DADS inhibits tumor growth by downregulating LIMK1, a downstream effector of Rac1 (11). We constructed a TGF-β1-overexpressing MGC803 cell line that exhibited increased TGF-β1 expression compared to the empty vector group and the control group (Fig. 5A). The transfected and untransfected cells were subcutaneously injected into nude mice. We examined the effect of TGF-β1 on tumor growth in nude mice, and determined whether the suppression of TGF-β1/Rac1 by DADS led to inhibition of gastric cancer MGC803 cell proliferation in vivo. The mice were subjected to different treatments and the tumor volume was examined every 6 days. Compared to the control group, the TGF-β1 group demonstrated an increase in tumor volume, whereas a decreased tumor volume was observed in the DADS group (Fig. 5B). The TGF-β1 + DADS, TGF-β1 + SB431542 and TGF-β1 + NSC23766 groups exhibited reduced tumor volumes, compared to the TGF-β1 group (Fig. 5B). After 48 days, the xenografts were removed from the mice. Similar changes were observed in tumor volume and weight (Fig. 5C and D). These data indicated that DADS antagonized TGF-β1-induced tumor growth via the downregulation of TGF-β1/Rac1 signaling.

We detected the protein expression levels of E-cadherin, vimentin, Ki-67 and CD34 in transplanted tumor tissues using immunohistochemistry. DADS reduced vimentin, Ki-67 and CD34 protein levels, and increased the expression of E-cadherin (Fig. 6). These results were consistent with our previous data (11). The opposite effects were observed in the TGF-β1 group. SB431542 and NSC23766 attenuated the inhibitory effect of TGF-β1 on E-cadherin expression and weakened the enhanced effects of TGF-β1 on vimentin, Ki-67 and CD34 expression. Furthermore, DADS exerted the same effects on the expression of these proteins as these inhibitors (Fig. 6).