Metastatic melanoma cell lines Mel MTP, Mel Z and Mel IL were derived from patients under treatment at N.N. Blokhin National Medical Scientific Center for Oncology (26,27). Cell lines were cultured in RPMI-1640 (Gibco, Paisley, UK) supplemented with 10% fetal bovine serum (FBS) (HyClone; GE Healthcare Life Sciences, Logan, UT, USA), 2 mM L-glutamine (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), 10 U/ml penicillin (Sigma-Aldrich; Merck KGaA), and 0.1 mg/ml streptomycin (Sigma-Aldrich; Merck KGaA) at 37°C under a 5% CO₂ humidified atmosphere.

Small interfering (si) RNAs targeting GRP78 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA) and a control siRNA (siCTRL, sequence, ATAGAGCGATCACATACAGCC) was constructed by Syntol (Moscow, Russia). Melanoma cells (2×10⁵ cells/well) were seeded onto 6-cm Petri dishes (Nunc, Roskilde, Denmark) and transfected with 10 nM GRP78 or siCTRL using the Lipofectamine RNAiMAX reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. Twenty-four hours after transfection, the cells were treated with 100 µM TMZ (Sigma-Aldrich; Merck KGaA) and 20 µM chloroquine (CQ) (Sigma-Aldrich; Merck KGaA) for 24 or 48 h, and cell viability and the percentages of autophagy and apoptosis were determined.

Melanoma cell lines Mel MTP, Mel Z and Mel IL were plated (8×10³ cells/well) into 96-well plates (Nunc). After 24 h, TMZ (100 µM) alone or combined with CQ (20 µM) was added, and the cells were incubated for 48 h. Control cells were treated with an equal amount of dimethyl sulfoxide (DMSO). Cytotoxicity was assessed by incubating cells with 20 µl of 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) reagent (Sigma-Aldrich; Merck KGaA) for 4 h, and measuring the absorbance at 540 nm with a microplate analyzer (Multiscan FC; Invitrogen; Thermo Fisher Scientific, Inc.) in triplicate.

Melanoma cells (2×10⁵) were seeded in 6-well plates. Medium containing 100 µM TMZ, and 20 µM CQ or an equal amount of DMSO as a vehicle control was added to the appropriate wells and cells were incubated for 24 h. After incubation, cells were reseeded on new 6-well plates (2×10³ cells/well) in triplicate and cultivated for 12 days, and the medium was changed every 3–4 days. At the end of the experiment, colonies were fixed in 1% formalin, stained with 0.5% crystal violet, and counted using ImageJ software [National Institutes of Health (NIH) Bethesda, MD, USA]. Three independent experiments were carried out.

Cells were lysed with lysis buffer containing 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM Na₂EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na₃VO₄, 1 µg/ml leupeptin, 1 mM phenylmethanesulfonyl fluoride (PMSF), 10 µl/ml inhibition cocktail, and 100 µM DTT for 40 min at 4°С. The cells were then centrifuged at 13,500 × g for 15 min at 4°С. The total protein content was analyzed using a Quant-IT protein assay kit according to manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc.) on a Quibit 2.0 fluorometer (Invitrogen; Thermo Fisher Scientific, Inc.). An equal amount of protein (40–60 µg) from each group was separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to nitrocellulose membranes. Membranes were incubated with 5% dry milk (Applichem, Darmstadt, Germany) for 90 min, and then incubated with Beclin 1 (1:1,000; cat. no. 3738; Cell Signaling Technology, Inc., Danvers, MA, USA), LC3B (1:500; cat. no. NB100-2220B; Novus Biologicals, Cambridge, UK), р62/SQSTM1 (1:1,000; cat. no. 5114; Cell Signaling Technology, Inc.), caspase-7 (1:100; cat. no. sc-56063; Santa Cruz Biotechnology, Inc.), cleaved PARP (1:1000, cat. no. 44698G; Invitrogen; Thermo Fisher Scientific, Inc.), GRP78 (1:1,000; cat. no. 3183; Cell Signaling Technology, Inc.) and β-actin (1:4,000; cat. no. A5441; Sigma-Aldrich; Merck KGaA) antibodies at 4°C overnight. The membranes were washed in Tris-buffered saline, containing Tween-20 and incubated with appropriate horseradish peroxidase-conjugated secondary anti-mouse antibodies (1:10,000; cat. no. NA991VS) and anti-rabbit (1:10,000; cat. no. NA934VS; both from GE Healthcare, Chicago, IL, USA) for 90 min at room temperature. Immunoreactive proteins were detected using enhanced chemiluminescence reagent Clarity ECL (Bio-Rad Laboratories GmbH, Munich, Germany). The density of bands was determined on a ChemiDoc Touch Imaging System (Bio-Rad Laboratories GmbH) and quantified using ImageJ software (NIH).

After 24 h of treatment with 100 µM TMZ and 20 µM CQ, the cells were washed with PBS; the cell pellets were resuspended in 500 µl of 50 µg/ml solution of propidium iodide (PI) in buffer (BD Biosciences, Franklin Lakes, NJ, USA) and incubated in the dark at room temperature for 15 min. The PI fluorescence was assessed on a NovoCyte 2000R flow cytometer (ACEA Biosciences, San Diego, CA, USA) and the cell cycle distribution was analyzed using ModFit 3.2 software (Verity Software House, Topsham, ME, USA).

Apoptosis was determined by caspase-7 activity within the cells 24 h after drug treatment. Cells were treated with 100 µM TMZ alone or in combination with 20 µM CQ. Control cells were treated with DMSO. After treatment, cells were trypsinized, centrifuged, permeabilized in 200 µl 0.1% Triton X-100-citrate buffer, and incubated for 30 min at 4°C with mouse anti-caspase-7 antibodies (1:100; Santa Cruz Biotechnology, Inc.). After incubation, the cells were washed and incubated with anti-mouse antibody AlexaFluor^® 488 (1:2,000; cat. no. A11001; Life Technologies; Thermo Fisher Scientific, Inc.), washed and fixed in 1% formalin, and followed by analysis on a NovoCyte 2000R flow cytometer (ACEA Biosciences) using NovoExpress v.1.2.4 software. Results are presented as the percent increases relative to the control.

Melanoma cells were seeded (3×10⁵ cells/well) in 24-well plates (BD Falcon). Twenty-four hours later, the cells were transfected with 30 viral particles/cell using Premo^® Autophagy Tandem Sensor RFP-GFP-LC3B and Premo Autophagy Sensor RFP-p62, as described in the manufacturer's manual (Life Technologies; Thermo Fisher Scientific, Inc.) and incubated overnight. The next day, the cells were treated with TMZ and CQ or equal amounts of DMSO as a vehicle control and further incubated for 24 h. Imaging was performed using IN Cell Analyzer 6000 and In Cell Investigator software (GE Healthcare Life Sciences).

Total RNA was extracted from cells using TRIzol reagent (Sigma-Aldrich; Merck KGaA), as previously described (28). For cDNA synthesis, RNA (250 ng) was reverse-transcribed in a final volume of 20 µl using iScript™ Select cDNA Synthesis kit according to manufacturer's instructions (Bio-Rad Laboratories, Inc., Hercules, CA, USA). No-reverse transcriptase controls were performed by omitting the addition of the reverse transcriptase enzyme, and no-template controls were performed by the addition of nuclease-free water. A relative quantitation of Beclin 1 mRNA expression normalized to two endogenous reference genes (β-actin and GAPDH) was performed using a Bio-Rad CFX96 Real-Time System (Bio-Rad, Laboratories, Inc.) and iTaq^® Universal SYBR^®-Green SuperMix (Bio-Ra, Laboratories, Inc.). Primers are listed in Table I. The PCR reaction mixture (final volume, 10 µl) contained 5 µl of 2X SuperMix, 5 pmol of GADPH, β-actin and Beclin 1 and 2 µl (50 ng) of cDNA. The thermocycling conditions were: 5 min at 95°C, followed by 39 cycles of 5 sec at 95°C, 30 sec at 60°C and 30 sec at 72°C. At the end of the 39 PCR cycles, melting curve analysis was performed by continuously recording the fluorescence during progressive heating up to 95°C with a ramp rate of 0.5°C/sec. All samples were analyzed in duplicate wells of a 96-well plate. The results of real-time RT-PCR were represented by the parameter ∆∆Cq (29).

Each treatment condition was set up in triplicate, and each experiment was repeated three times independently. Data are expressed as the mean ± standard deviation (SD), and the concentration-response curves were produced using the GraphPad Prism v.5.0 software (GraphPad, Software, Inc., La Jolla, CA, USA). Statistical analysis was carried out using the Student's t-test. A P-value of <0.05 was considered to indicate a statistically significant difference.

All experiments were carried out on three melanoma cell lines with different basal autophagy levels [Mel Z (low basal autophagy), Mel IL (medium basal autophagy), and Mel MTP (high basal autophagy], which were investigated by Beclin 1 mRNA expression (qRT-PCR) (Fig. 1A) and Beclin 1 protein expression (western blotting) (Fig. 1B and C).

Previously, we demonstrated that the autophagy inhibitor chloroquine (CQ) enhances the cytotoxic effect of TMZ on both BRAF-mutated and wild-type melanoma cell lines (30).

First, we determined the cytotoxic effect of TMZ on the melanoma cell lines with knockdown of GRP78 by MTT assay. We initially transfected Mel IL, Mel Z, and Mel MTP cells with small interfering (si)RNA to a scrambled sequence (siCTRL) and GRP78. According to the data received, treatment of siCTRL-transfected melanoma cells with 100 µM TMZ had little to no effect compared to untransfected cells. Knockdown of GRP78 enhanced the cytotoxic effects of TMZ alone on Mel MTP cells with a high basal level of autophagy but there was no inhibition effect on Mel IL compared to untransfected cells and, notably, silencing of GRP78 mitigated TMZ toxicity on the Mel Z cell line (Fig. 2A and B). Moreover, downregulation of GRP78-dependent autophagy mitigated the cytotoxic effect of CQ on Mel Z and Mel IL cell lines, but induced an antiproliferative effect on Mel MTP (Fig. 2C).

To better understand the mechanism underlying the synergistic cytotoxic effects of TMZ and CQ in our cells, we transfected Mel Z, Mel IL, and Mel MTP cells with siCTRL or siRNA to GRP78. After transfection, cells were cultivated in the presence or absence of TMZ or TMZ in combination with CQ for 24 h in a series of colony-forming assays (CFAs). To confirm the knockdown of the GRP78 protein, we analyzed the protein level of GRP78 by western blot analysis using β-actin as a loading control (Fig. 3B).

TMZ alone did not affect the viability of Mel IL cells; there was a slight increase in the number of colonies relative to the control. Compared to the DMSO-treated control, the combination of TMZ and CQ reduced the number of colonies by 25% (P=0.05). The number of colonies in the Mel Z cell line decreased by 30% with TMZ, the combination of TMZ with CQ reduced the number of colonies by ~60% compared to the control (P<0.05) (Fig. 3A). Notably, under TMZ treatment alone or combined with CQ, Mel MTP cells did not form viable colonies (data not shown).

In Mel IL and Mel Z cells, knockdown of GRP78 with siGRP78 enhanced the cytotoxic effects of TMZ by further reducing the percentage of colonies formed by an additional ~20%. Treatment of siGRP78-transfected melanoma cells with 100 µM TMZ and 20 µM CQ reduced the percentage of colonies formed by ~70% in Mel Z cells but did not affect Mel IL. Mel MTP does not form colonies under siGRP78 transfection (Fig. 3C).

It has been reported that GRP78 maintained ER integrity and was involved in autophagosome formation independently of Beclin 1-mediated autophagy (22). Thus, inhibition of GRP78 enhanced the cytotoxic effects of TMZ, however the combined effect of TMZ and CQ were detected only in the Mel Z cell line.

Previously, we demonstrated that TMZ (100 µM) treatment increased the cell population in the G0/G1 phase in melanoma cell lines and TMZ and CQ combination further increased the G0/G1 fraction in BRAF-mutated Mel IL and Mel Z cell lines, but not in BRAF wild-type Mel MTP (29). Thus, we evaluated the cell cycle distribution in the siGRP78 transfected cells.

Transfection with siGRP78 resulted in increased accumulation of cells in the G0/G1 phase compared to the siCTRL cells under TMZ treatment (49 vs. 73% for Mel IL, and 67 vs. 87% for Mel Z). However, CQ did not affect the cycle cell distribution when GRP78 was downregulated as it did in the siCTRL cells (Fig. 4). Notably, the Mel MTP line, characterized by a high level of autophagy, was not sensitive to siGRP78, but the combination with CQ increased in cells in the G0/G1 phase, which was not observed in the siCTRL cells.

Next, we investigated the activation of caspase-7 by flow cytometry in melanoma cell lines. We found that, in the Mel Z cell line, apoptosis was not activated via the caspase pathway. However, activation of caspase-7 occurred under treatment in cells transfected with siGRP78. In cell lines with a medium (Mel IL) and high (Mel MTP) basal level of autophagy, we observed activation of caspase-7 under TMZ treatment, and its combinations with CQ further enhanced activation of apoptosis markers. Silencing of GRP78 led to a more evident activation of caspase-7 in Mel IL and Mel MTP cells compared to the control. However, downregulation of GRP78 enhanced apoptosis only in the Mel MTP cell line (up to 96%). Thus, cells with initially high autophagy were more sensitive to its inhibition (Fig. 5).

To investigate the mechanistic details of GRP78-dependent autophagy, we investigated markers of autophagy and apoptosis. TMZ treatment resulted in a significant increase in the LC3II/LC3I ratio in the siCTRL cells. In contrast, there was no TMZ-associated increase in the LC3B-I/LC3B-II ratio in cells transfected with siGRP78 in either cell line. We found that GRP78 knockdown diminished the ability of TMZ and the TMZ plus CQ combination to convert LC3B-I to LC3B-II, especially in the Mel MTP cells. Moreover, in the GRP78-transfected cells, another autophagy marker, p62, which is involved in trafficking cargo to lysosomes, was not degraded in autolysosomes compared to the siCTRL cells. Notably, in the Mel IL cell line, Beclin 1 expression was mitigated in GRP78-transfected cells but was upregulated in Mel MTP cells. Thus, GRP78 plays a significant role in TMZ-dependent autophagy (Fig. 6).

Next, we analyzed the expression of apoptosis markers caspase-7 and cleaved PARP in melanoma cell lines by western blotting. In the single treatment, TMZ increased the levels of apoptosis markers caspase-7 and cleaved PARP in both cell lines. However, there was a slight increase in caspase-7 and cleaved PARP activation under combined TMZ and CQ treatment compared to TMZ alone. Silencing of GRP78 also led to induction of caspase-7 and caused enhanced cleavage of PARP under the TMZ and CQ combined treatment in Mel MTP cells compared to control cells, but there were no differences between Mel IL and Mel Z cells (Fig. 6). Thus, we suggest that the combined effect of TMZ and CQ was mediated by increased apoptosis.

To ensure that TMZ induced autophagy and did not block clearance of autolysosomes, cells were transfected with tandem Premo^® RFP-GFP-LC3 and Premo RFP-p62 sensors (Thermo Fisher Scientific, Inc.), as described in the Materials and methods section. Cells were treated with 100 µM TMZ, and 20 µM CQ for 24 h and the control cells were treated with equal amounts of DMSO. In the absence of any treatment, the distribution of green fluorescence was diffuse. Treatment with TMZ increased the number of autophagosomes and increased autophagic flux, driven by functional fusion with the lysosome due to the recruitment of GFP-LC3 in autophagy. TMZ combined with CQ enhanced the number of autophagic vacuoles over individual treatment and produced yellow puncta, reflecting lysosomal impairment, as well as distal autophagy blockade producing persistence of green and red fluorescence (31). Under TMZ treatment, p62 puncta were decreased, and blockade of autophagy led to an accumulation of p62-positive vesicles. When Mel Z cells were transfected with GRP78-siRNA for 24 h prior to drug treatment, we detected impaired autophagic flux, and a smaller amount of p62-positive cells and combined therapy had no effect (Fig. 7). The same effect was observed in GRP78-transfected Mel IL and Mel MTP cell lines after 24 h of treatment with TMZ or TMZ plus CQ (data not shown).