Lung epithelial cells BEAS-2B and human lung cancer cells 95D, H1975, H1299 and A549 were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA) and cultured in RPMI-1640 medium (HyClone; GE Healthcare Life Sciences, Logan, UT, USA). The culture medium was supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin solution (both from Corning Inc., Corning, NY, USA). All the cells were maintained at 37°C with 5% CO₂.

The HLug-Ade030PG-01 microarrays of lung adenocarcinoma and adjacent normal samples were obtained from Shanghai Outdo Biotech Co., Ltd. (Shanghai, China). This array contained a total of 15 samples with 11 stage II, 4 stage III lung adenocarcinoma samples and 15 adjacent normal samples. A core represented a separate case and each sample was fixed in formalin. Thick 5-µm slices coated with paraffin were subjected to immunohistochemical staining of BAIAP2L2.

Microarray of human lung adenocarcinoma and adjacent normal sample were subjected to immunohistochemistry staining of BAIAP2L2. Briefly, 5 µm sections of tissues were deparaffinized in xylene and rehydrated in descending alcohol series. Antigen-retrieval was performed by incubating 0.01 M boiled citrate buffer in a microwave for 20 min. After cooling to room temperature, slides were rehydrated in double distilled H₂O for 10 min. The slides were then blocked with 10% goat serum (cat. no. C0265; Beyotime Institute of Biotechnology, Beijing, China) at room temperature for 30 min, followed by incubating with primary anti-BAIAP2L2 antibody (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany; cat. no. HPA003043, dilution 1:50) at 4°C overnight. Then, the slides were washed with TBS and incubating with the secondary antibodies (dilution 1:100; cat. no. SPN-9001; OriGene Technologies, Inc., Rockville, MD, USA) at room temperature for 2 h. After washing with TBS, the sections were stained by Vulcan Fast Red Chromogen kit 2 for 15 min at room temperature (Biocare, Shanghai, China). The extent and intensity of BAIAP2L2 immunostaining were taken into consideration. The intensity of extent of BAIAP2L2 expression was graded as follows: Negative, 0; weak, 1; moderate, 2; and strong, 3. The extent of staining was grouped according to the percentage of high-staining cells in the cancer nest: Negative, 0; 1–25, 1; 26–50, 2; 51–75, 3; and 76–100%, 4. The final quantitation of each staining was obtained by multiplying the two scores. Immunoreactivity was assessed independently by two expert pathologists blinded to all clinical data.

A lentiviral system containing pGCSIL-GFP (stably expressed shRNA fused with a GFP marker), pHelper1.0 (gag/pol element) and Helper2.0 (VSVG element) were used to silence BAIAP2L2 in A549 and H1299 cells. The vectors were transfected into 293T cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The lentiviral supernatants were collected 48 h after transfection, filtered through 0.45-µm filters, and then subjected to infection of A549 and H1299 cells. Knockdown efficiency was determined by qRT-PCR and western blot analysis of BAIAP2L2.

The coding sequence of BAIAP2L2 was inserted into pBABE-puro vector. Targeted vectors or control vectors accompanied with PIK packaging vectors were co-transfected into 293T cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Forty-eight hours later, viral supernatants were collected and filtered through 0.45-µm filters. Then, they were subjected to infection of 95D cells. Puromycin was used to select stable cell lines.

Total proteins were isolated from indicated cells using lysis buffer [2 g SDS, 1.55 g DTT, 6 ml Tris (1 M, pH 6.8), 10 ml glycerol and ddH₂O up to 100 ml]. Cell lysates were boiled at 98°C for 10 min, and then centrifuged at 16,000 × g for 5 min. Briefly, the lysates were separated on 10 or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride membranes (PVDF; EMD Millipore, Billerica, MA, USA). The PVDF membranes were then blocked in 5% skim milk at room temperature for 60 min and incubated with primary antibodies at 4°C overnight. Antibodies against BAIAP2L2 for western blotting were purchased from Abcam (Cambridge, UK) (dilution 1:1,000; cat. no. ab135897). Antibodies against CCNA2 (dilution 1:1,000; cat. no. 4656), CDK6 (dilution 1:1,000; cat. no. 3136) and CDKN1B (dilution 1:1,000; cat. no. 3698) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against CCND1 (dilution 1:200; cat. no. ab16663) were purchased from Abcam. Antibodies against GAPDH (dilution 1:2,000; cat. no. sc-32233) and all the secondary antibodies (goat anti-mouse IgG, dilution 1:5,000; cat. no. sc-2005; goat anti-rabbit IgG, dilution 1:5,000; cat. no. sc-2004) were obtained from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Following incubation with the secondary antibodies for 2 h at room temperature, the membranes were visualized using the ECL Plus kit (GE Healthcare, Chicago, IL, USA).

shCtrl and shBAIAP2L2 A549 and H1299 cells were lysed in TRIzol reagent and subjected to total RNA isolation using Ultrapure RNA Kit (CWBIO, Beijing, China). Total RNA (0.8 µg) was subjected to reverse transcription using ReverTra Ace^® qPCR RT Master Mix with gDNA Remover (Toyobo Life Science, Osaka, Japan). Quantitative real-time PCR was analyzed using TransStart Top Green qPCR SuperMix (TransGene Biotech Co., Ltd., Beijing, China) on an iQ5 Real-Time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). GAPDH served as an internal control. The primer sequences were as follows: BAIAP2L2 forward, GTCCCACCATCACCAATGACC and reverse, TCTGCTGCTGTTGCTGCTGTC; GAPDH forward, 5′-TGACTTCAACAGCGACACCCA-3′ and reverse, 5′-CACCCTGTTGCTGTAGCCAAA-3′.

A total of 2,000 Ctrl or BAIAP2L2 overexpressed 95D cells were seeded in 10-cm plates, and shCtrl or shBAIAP2L2 A549 and H1299 cells (800 cells/well) were seeded in 6-well plates. After being cultured at 37°C for 12–16 days, the cell colonies were fixed with methanol for 20 min and stained with 0.5% crystal violet solution for 15 min. The colony numbers (>50 cells/colony) were quantified using a fluorescence microscope (Olympus Corp., Tokyo, Japan).

Multiparametric high-content screening (HCS) assay was used to determine cell viability. In brief, indicated cells were cultured in 96-well plates for 5 days. The cell density was assessed using a fluorescence-imaging microscope each day from day 1 to day 5. The density and distribution of the fluorescence determined the cell viability of shCtrl and shBAIAP2L2 A549 and H1299 cells. Quantitative results were analyzed using the ArrayScan™ HCS software (Cellomics, Inc., Pittsburgh, PA, USA).

shCtrl and shBAIAP2L2 A549 and H1299 cells were seeded at a density of 3,000 cells/well in 96-well plates. After 1, 2, 3, 4 or 5 days, the cells were washed with phosphate-buffered saline (PBS) and incubated with 3-(4,5-dimethyl-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution (5 mg/ml) for 3 h at 37°C. Then, cell viability was detected at 490 nm of spectrophotometric absorbance.

Caspase-Glo^® reagent (Promega Corporation, Madison, WI, USA) was prepared according to the manufacturer's instructions. After seeding a total of 10,000 cells/well into 96-well plates, 100 µl Caspase-Glo^® reagent was added into the plates. Then, the plates were rotated at 9.99–25 × g for 0.5 h and maintained at room temperature for 1.5 h. The activity was detected by a microplate reader.

Apoptosis of shCtrl and shBAIAP2L2 A549 and H1299 cells was examined using Annexin V-APC apoptosis detection kit (eBioscience; Thermo Fisher Scientific, Inc.), following the manufacturer's instructions. Briefly, after washing with PBS, the cells were resuspended with 100 µl staining buffer and incubated with 5 µl Annexin V-APC at room temperature for 15 min, and subsequently subjected to flow cytometric detection of apoptosis.

Total RNA from A549 cells was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). NanoDrop 2000 (Thermo Fisher Scientific, Inc., Wilmington, DE, USA) and Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA) were used to detect the RNA quantity and quality. Affymetrix Human GeneChip PrimeView (Affymetrix; Thermo Fisher Scientific, Inc.) was used for microarray processing to determine gene expression profiles according to the manufacturer's instructions. Significantly different genes between A549 cells treated with shCtrl and shBAIAP2L2 were identified depending on the follow criteria: P<0.05 and the absolute fold change >1.5. Pathway enrichment analysis was performed for all significantly different genes based on Ingenuity Pathway Analysis v9.0 (IPA; www.ingenuity.com; Ingenuity Systems, Redwood City, CA, USA).

The statistical analysis was performed using GraphPad Prism 6.0 (GraphPad Software, Inc., La Jolla, CA, USA). The data were presented as the mean ± SEM of at least 3 independent repeats. Paired Student's t-tests were used to analyze the differences of the IHC scores between the adenocarcinoma and adjacent tissues. Unpaired Student's t-tests were used to analyze the difference between two other groups. Differences among groups were determined by one-way analysis of variance (ANOVA) with repeated measures, followed by the Bonferroni post hoc test. P<0.05 was considered to indicate a statistically significant difference.

To explore the clinical relevance of BAIAP2L2 in lung cancer, we collected 15 pairs of lung adenocarcinoma specimens and detected the expression of BAIAP2L2 using immunohistochemical assay. We revealed that BAIAP2L2 was overexpressed in the tumor areas compared to adjacent normal tissues (Fig. 1A and B). In addition, we analyzed the expression of BAIAP2L2 in normal lung epithelial cells and lung cancer cells. The qRT-PCR results revealed that the mRNA level of BAIAP2L2 was higher in lung cancer cells compared to BEAS-2B cells (Fig. 1C). These results indicated that BAIAP2L2 was a potential biomarker for lung cancer and that it may be essential for lung cancer progression.

We next determined the role of BAIAP2L2 in lung cancer. BAIAP2L2 was silenced in A549 cells using lentivirus-mediated knockdown strategy (Fig. 2). Then, we analyzed the proliferation of shCtrl and shBAIAP2L2 in A549 cells from day 1 to day 5 through HCS. We found that A549 cells expressing shCtrl lentivirus proliferated robustly from day 1 to day 5 (Fig. 3A). However, BAIAP2L2 knockdown completely suppressed the proliferation of A549 cells (Fig. 3A). Cell count analysis was consistent with the results (Fig. 3B). Likewise, MTT detection also demonstrated that blockage of BAIAP2L2 largely inhibited the proliferation of A549 cells (Fig. 3C). In addition, we silenced BAIAP2L2 in another lung cancer cell line, H1299. qRT-PCR and western blot results revealed that BAIAP2L2 was knocked down in H1299 cells (Fig. 2). Consistently, blockage of BAIAP2L2 significantly decreased the viability of H1299 cells as indicated by the suppressed cell proliferation rate (Fig. 3D). Moreover, we detected a reduced number of colonies in shBAIAP2L2 A549 or H1299 cells compared with shCtrl A549 or H1299 cells (Fig. 4).

To ascertain our results, we overexpressed BAIAP2L2 in 95D cells. It was revealed that BAIAP2L2 ectopic expression accelerated the proliferation and growth of 95D cells (Fig. 5). Thus, we concluded that BAIAP2L2 is critical for lung cancer cell viability.

Suppressed cell proliferation and growth may be a consequence of increased cell death. Apoptosis is a common cell death type and plays an important role in cancer development. Therefore, we investigated whether apoptosis participated in BAIAP2L2-mediated lung cancer cell proliferation and growth. To address this question, Annexin V-APC was used to detect the apoptosis of A549 and H1299 cells expressing shCtrl or shBAIAP2L2 lentivirus. Our results revealed that BAIAP2L2 silencing increased the apoptosis of A549 and H1299 cells (Fig. 6A and C). Quantitative results revealed that >2-fold enhanced apoptosis was found in A549 and H1299 cells after BAIAP2L2 knockdown (Fig. 6B and D). Furthermore, we also detected increased caspase-3/7 activity in shBAIAP2L2 A549 cells compared with shCtrl A549 cells (Fig. 6E). Likewise, shBAIAP2L2 H1299 cells exhibited increased apoptosis and caspase-3/7 activity (Fig. 6F). These results indicated that BAIAP2L2 knockdown triggered lung cancer cell apoptosis, mainly by enhancing caspase-3/7 activity. Collectively, our results revealed that BAIAP2L2 silencing may suppress cell proliferation and growth at least partly by increasing apoptosis.

By revealing that BAIAP2L2 is critical for apoptosis, proliferation and growth of lung cancer cells, we further explored the potential molecular mechanism. Firstly, GeneChip was performed to determine dysregulated genes in A549 cells after BAIAP2L2 knockdown. We found that 1,240 genes were upregulated and 1,157 genes were downregulated in BAIAP2L2 silenced A549 cells (Fig. 7A). By pathway enrichment analysis, we revealed that the Estrogen-mediated S-phase Entry pathway was significantly inhibited after BAIAP2L2 knockdown (Fig. 7B). Cyclins and cell cycle regulation signaling was suppressed (Fig. 7B). However, the predictive analysis revealed that the G1/S checkpoint regulation pathway involved in the cell cycle was upregulated (Fig. 7B). Additionally, BAIAP2L2 knockdown upregulated the G2/M DNA damage checkpoint regulation pathway to a lesser extent (Fig. 7B). Next, we confirmed our predictive analysis using qRT-PCR and western blot assays. The results revealed that CCNA2, CCND1, CDK6 were downregulated and CDKN1B was upregulated in shBAIAP2L2 A549 cells (Fig. 7C).