OR Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 10.3892/or.2019.7016 or-41-04-2453 Articles Deoxypodophyllotoxin inhibits cell viability and invasion by blocking the PI3K/Akt signaling pathway in human glioblastoma cells WangWei GaoWei ZhangLuyang ZhangDongyong ZhaoZilong BaoYijun Department of Neurosurgery, The First Affiliated Hospital of China Medical University, Shenyang, Liaoning 110001, P.R. China Correspondence to: Dr Yijun Bao, Department of Neurosurgery, The First Affiliated Hospital of China Medical University, 155 Nanjing North Street, Shenyang, Liaoning 110001, P.R. China, E-mail: baoyijun@mail.cmu.edu.cn 042019 14022019 41 4 2453 2463 31072018 18012019 Copyright © 2019, Spandidos Publications 2019

Deoxypodophyllotoxin (DPT) is a natural chemical that has been demonstrated to inhibit cellular viability and motility in various cancer cell types. Although previous studies have indicated that programmed cell death and cell cycle arrest are involved in the suppression of glioma development by DPT, the underlying mechanism has not been fully explored. Different methods were used to the elucidate the mechanisms of DPT that inhibit the malignant behavior of glioma cells. Cellular viability was assessed by MTT assay. Relative protein and mRNA expression levels were detected by western blot analysis and reverse transcription-quantitative polymerase chain reaction analyses, respectively. Cell cycle distribution and the apoptosis rate were detected by flow cytometry. Hochest 33258 staining was also performed to detect apoptosis. Transwell assays without and with Matrigel were used to assess migration and invasion abilities, respectively. It was determined that DPT suppressed cellular viability by inducing cell cycle arrest at the G1/S phase by targeting the phosphatidylinositol 4,5-bisphosphate 3-kinase (PI3K)/RAC-α serine/threonine-protein kinase (Akt)-cyclin-dependent kinase inhibitor 1-cyclin-dependent kinase 2/cyclin E signaling cascades. Additionally, DPT significantly enhanced apoptosis by attenuating the PI3K/Akt-mediated suppression of Bcl-2-associated agonist of cell death expression, which was accompanied by an increased apoptosis regulator BAX/apoptosis regulator Bcl-2 ratio. Furthermore, DPT downregulated the invasiveness of glioma cells by hindering PI3K/Akt-matrix metalloproteinase (MMP)9/MMP2 signaling pathways. In conclusion, DPT effectively inhibited the expression of PI3K and downregulated PI3K/Akt-mediated signaling pathways to prevent glioblastoma progression.

 deoxypodophyllotoxin glioblastoma U87 U251 phosphatidylinositol 4,5-bisphosphate 3-kinase RAC-α serine/threonine-protein kinase Introduction

Gliomas, the most common type of primary malignant brain tumor, are divided into four histopathological grades designated I–IV (1), by the World Health Organization (WHO) grading system. The most malignant type of glioma, WHO grade IV, also known as glioblastoma or glioblastoma multiforme (GBM), has a high rate of recurrence and poor prognosis due to the invasiveness of the tumors (2). Although great advances in surgery, and radio- and chemotherapies have been made over the last decade, GBM remains incurable and invariably recurs (3). The activation of phosphatidylinositol 4,5-bisphosphate 3-kinase (PI3K)/RAC-α serine/threonine-protein kinase (Akt) and other intracellular signaling pathways has been demonstrated to ultimately result in cellular proliferation, migration and a decrease in GBM cell apoptosis (4). Therefore, it is important to explore the mechanisms of novel chemicals to increase the understanding of tumorigenesis and offer novel therapeutics that may hinder GBM progression.

The PI3K/Akt signaling pathway, activated by growth factors and other extracellular stimuli, regulates many biological processes, including cell growth, survival, metabolism and invasion (5,6). The epidermal growth factor receptor (EGFR)-activated PI3K/Akt signaling pathway has been associated with poor prognosis and the frequent recurrence of GBM (4,7,8). Although numerous small molecular inhibitors targeting PI3K/Akt have been developed, the preclinical and clinical efficacy of these inhibitors in GBM is limited (9,10). Possible reasons for the limited treatment effect include poor infiltration of molecules through the blood brain barrier and genetic heterogenicity. Hence, the need for novel inhibitors targeting the PI3K/Akt axis which is emerging. Deoxypodophyllotoxin (DPT), considered as Anthriscus sylvestris L. Hoffm's main lignan constituent (Fig. 1A), is a natural chemical that has multiple antitumor effects, including the prevention of microtubule assembly by binding to tubulin directly (11–13), the promotion of cell cycle arrest via the accumulation of phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN (PTEN) (14), the induction of apoptosis-activating caspases (15–18) and the stimulation of cytoskeleton remodeling with the activation of 5′-AMP-activated protein kinase-associated signaling pathways (19). Notably, DPT promoted caspase-dependent apoptosis via the suppression of the insulin-like growth factor 1 receptor/PI3K/Akt signaling pathway in non-small cell lung cancer cells (20). DPT induced cytoprotective autophagy to counteract apoptosis by inhibiting the PI3K/Akt/serine/threonine-protein kinase mTOR (mTOR) axis in osteosarcoma cells (21). Additionally, DPT inhibited cellular growth by hindering the PI3K/mTOR signaling pathway in breast cancer cells (22). However, the molecular mechanisms involved in these DPT effects have not been fully characterized in GBM. Therefore, our research group investigated the mechanism involved in DPT-antagonized malignant gliomas.

Recently, Guerram et al reported that DPT promoted G2/M arrest and induced apoptosis via caspase-dependent pathways (23). Ma et al demonstrated that DPT triggered parthanatos in GBM cells via induction of excessive ROS (24). The different mechanisms underlying suppression of GBM progression by DPT inssssdicated that the details of DPT inhibition require further investigation in GBM. In addition, Park et al revealed that DPT (also known as anthricin) treatment reduced the phosphorylation of pY1131-IGF1R, pTyr458-PI3K (p85) and pSer473-Akt, and led to caspase-dependent apoptosis in A549 human non-small lung cancer cells (20), indicating that DPT targeted to the upstream regulators of Akt including IGF1R and inactivated the PI3K/AKT pathways. However, the possibility of DPT targeting PI3K directly cannot be rule out. Furthermore, Kim et al demonstrated DPT induced both apoptosis and autophagy via inhibition of PI3K/AKT/mTOR signaling cascades in osteosarcoma U2OS cells (21), providing rational evidence that DPT suppressed the PI3K/AKT signaling pathways in GBM. Considering that the molecular mechanisms involved in DPT suppression are complex, the Akt pathway was investigated to explore details of DPT in glioma.

In the present study, the authors hypothesized that DPT may suppress cell growth and invasiveness while inducing apoptosis with the inhibition of the PI3K/Akt signaling pathways in GBM cells.

 Materials and methods <sec> <title>Cell culture

Normal human astrocytes (HAs; cat. no. CC-2565) were obtained from Lonza Group, Ltd. (Basel, Switzerland). U87 MG, glioblastoma of unknown origin, was purchased from the American Type Culture Collection (ATCC; cat. no. HTB-14; Manassas, VA, USA). Human glioblastoma cell lines, U251 (cat. no. KCB200965YJ), was purchased from Kunming Institute of Zoology, Chinese Academy of Sciences (Kunming, China). Normal HAs were cultured in Astrocytes Growth Medium (AGM; Lonza Group) supplemented with 0.03% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc., Waltham, MA, USA). U87 and U251 cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. The cells were maintained at 37°C in an incubator with a humidified atmosphere of 5% CO2 and 95% air.

 Chemicals

DPT (cat. no. CFN99888) was purchased from Wuhan ChemFaces Biochemical Co., Ltd. (Wuhan, China). LY294002 (cat. no. L9908_SIGMA) and dimethyl sulfoxide (DMSO) (cat. no. D2650) were purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany).

 MTT assays

Normal HAs, U87 and U251 cells (1×104/well) were seeded in 100 µl AGM containing 0.03% FBS or DMEM containing 10% FBS in 96-well plates; 24 h later, the medium was replaced with 100 µl medium containing the indicated concentrations of DPT, and then the cells were incubated for 12, 24, 36 or 48 h. The cellular viability was assessed by the modified tetrazolium salt MTT assay. MTT solution [10 µl; 5 mg/ml in phosphate-buffered saline (PBS)] was added to each well. After 4 h of incubation at 37°C, the medium was replaced with 0.15 ml DMSO. Finally, the optical densities at 490 nm were assessed using a microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA) after incubating the cells for a further 5 min at 37°C.

 Cell cycle analysis by flow cytometry

U87 cells were incubated with the indicated concentration of DPT for 24 h. The cells were then collected, washed with PBS and suspended in a staining buffer [10 µg/ml propidium iodide (PI), 0.5% Tween-20 and 0.1% RNase in PBS]. The cells were analyzed using a FACSVantage flow cytometer with the CellQuest acquisition and analysis software program (both BD Biosciences, San Jose, CA, USA). Gating was set to exclude cell debris, doublets and clumps.

 Cell apoptosis analysis

Cells were washed twice with cold PBS, then re-suspended in binding buffer at a concentration of 1×106 cells/ml. Annexin V-fluorescein isothiocyanate (FITC; 5 µl) and 10 µl PI (both BD Biosciences, San Jose, CA, USA) were then added and the cells were incubated in the dark at room temperature for 15 min. Finally, 400 µl binding buffer was added to each tube and the apoptosis rate was assessed by flow cytometry within 1 h.

 Hochest 33258 staining

U87 cells were incubated with the indicated concentrations of DPT for 24 h. Following incubation, the cells were fixed with 4% polyoxymethylene, washed twice with PBS, incubated with 10 µg/ml Hochest 33258 (cat. no. B2883; Merck KGaA, Darmstadt, Germany) for 5 min at room temperature and washed with PBS three times. Cells were observed with a fluorescence microscope.

 Cell migration and invasion assay

Migration and invasion assays were performed using modified Boyden chambers with polycarbonate nucleopore membranes (Cell Biolabs, Inc., San Diego, CA, USA). Precoated filters (6.5 mm in diameter, 8-µm pore size) were used for migration and invasion assays. Matrigel (100 µg/cm2) was rehydrated with 100 µl medium for invasion assays. Cells (1×105) in 100 µl DMEM supplemented with 0.1% bovine serum albumin (BSA) were seeded into the upper part of each chamber, whereas the lower chambers were filled with 600 µl DMEM containing 10% FBS. After incubating the cells for 24 h at 37°C, non-invasive cells were removed from the upper surface of the filter with a cotton swab, and the invasive cells on the lower surface of filter were fixed, stained, photographed and counted under high-power magnification.

 cDNA synthesis and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated using TRIzol reagent (Thermo Fisher Scientific, Inc.). Total RNA (2 µg) was used for the synthesis of First-Strand cDNA using M-MLV reverse transcriptase (Thermo Fisher Scientific, Inc.). qPCR was performed using the SYBR-Green Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). The reactions were performed with a 7500 Fast Real-Time PCR System (Applied Biosystems China, Inc., Beijing, China). Relative gene expression was normalized to β-actin and reported as 2−ΔΔCq (25). The sequences of the RT-PCR primers are listed in Table I.

 Western blot analysis

To determine the expression of protein, whole-cell extracts (lysates) were prepared from 1×106 cells using a lysis buffer [20 mM Tris (pH 7.4), 250 mM sodium chloride, 0.1% Triton X-100, 2 mM EDTA, 10 µM ED leupeptin, 10 µM ED aprotinin, 0.5 mM phenylmethylsulfonyl fluoride, 4 mM sodium orthovanadate and 1 mM dithiothreitol]. Proteins (80 µg/lane) were resolved using SDS-PAGE on 10% gels. Then proteins were electrotransferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories, Inc.), which were blocked with 5% skim milk in TBS-T [20 mM Tris (pH 7.6), 137 mM NaCl and 0.05% Tween-20] for 1 h at room temperature. The proteins were incubated with specific antibodies: p110 PI3K (cat. no. sc-293172), p85 PI3K (cat. no. sc-374534), Akt (cat. no. sc-377457), phosphor Ser 473-Akt (cat. no. sc-52940), phosphor Thr 308-Akt (cat. no. sc-135650), p21 (cat. no. sc-817), cyclin-dependent kinase 2 (CDK2; cat. no. sc-70829), cyclin E (cat. no. sc-248), Bcl2-associated agonist of cell death (Bad; cat. no. sc-8044), apoptosis regulator BAX (Bax; cat. no. sc-7480), apoptosis regulator Bcl2 (Bcl2; cat. no. sc-509), matrix metalloproteinase (MMP)2 (cat. no. sc-13594), MMP9 (cat. no. sc-21736) and GAPDH (cat. no. sc-47724) all from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA) at 4°C. The dilution of these antibodies was 1:1,000. Total PI3K expression was determined with PI3KCA polyclonal antibody (cat. no. bs-2067R) from Bioss Inc. (Boston, MA, USA). GAPDH served as the loading control. All proteins on polyvinylidene difluoride membranes were detected by enhanced chemiluminescence (Pierce; Thermo Fisher Scientific, Inc.).

 Statistical analysis

Data from at least three independent experiments are presented as the mean ± standard deviation (SD). Statistical comparisons were performed using one-way analysis of variance (ANOVA). Dunnett's multiple comparisons test was performed to compare the mean of each group with the mean of the control group. P<0.05 indicated that the difference between groups was statistically significant.

 Results <sec> <title>DPT suppresses cellular viability by inhibiting PI3K/Akt in GBM cells

GBM cells U87 and U251 cells, and normal HAs were treated with different concentrations of DPT at different time-points. MTT assays were used to assess cell viability. As revealed in Fig. 1B, DPT markedly inhibited the growth of U87 and U251 at 30 µm/l, whereas DPT did not suppress the growth of normal HAs. The phosphorylation of Akt at Thr308 and Ser473, and total Akt expression in GBM cells were also examined. As revealed in Fig. 1C, DPT inhibited the phosphorylation of Akt at Thr308 and Ser473 in a dose-dependent manner, whereas no difference was observed in total Akt expression. To confirm the result, the PI3K/Akt inhibitor, LY294002, was used to treat GBM cells alone or combined with DPT. The phosphorylation of Akt at Thr308 and Ser473 markedly dropped in cells treated with DPT alone, LY294002 alone and DPT combined with LY294002 compared with the control group, which was treated only with DMSO (Fig. 1D). Notably, phosphorylation of Akt decreased the most in cells post-treated with DPT combined with LY294002. The data, at least in part, indicated that DPT impaired GBM cell viability through the inhibition of the PI3K/Akt signaling pathway.

 DPT induces G1/S phase arrest in GBM cells due to regulation of the p21-CDK2/cyclin E signaling pathway

To further investigate the mechanisms by which DPT inhibited the growth of GBM cells, U87 cells were exposed to various concentrations of DPT for 24 h, and then cell cycle analysis was performed. The percentage of cells in the G1 phase increased and that of cells in the S phase decreased in a dose-dependent manner in cells treated with DPT compared to the cells treated with DMSO (Fig. 2A and B), indicating that DPT arrested cells at the G1 phase of the cell cycle. The key regulators of the G1/S checkpoint, CDK2 and cyclin E, were also examined in DPT-treated GBM cells. Western blot analysis revealed that the protein expression of CDK2 and cyclin E in U87 cells and U251 cells notably decreased as DPT exposure increased (Fig. 2C). The protein expression of p21, the dominant regulator of the CDK2/cyclin E signaling pathway, markedly increased, which was accompanied by a decrease in CDK2 and cyclin E protein expression. Furthermore, relative mRNA levels of p21, CDK2 and cyclin E were assessed using RT-qPCR. As revealed in Fig. 2D, the relative mRNA level of p21 increased while that of CDK2 and cyclin E decreased in cells treated with DPT in a dose-dependent manner. The results indicated that DPT arrested GBM cells at the G1 phase, leading to the suppression of cellular viability via the p21/CDK2/cyclin E signaling pathway.

 DPT promotes the apoptosis of GBM cells suppressing Bcl-2

To identify whether DPT induced GBM cell apoptosis, the apoptotic ratio was examined by Hochest 33258 staining and flow cytometry. Condensed chromatin was clearly observed in U87 cells and U251 cells as DPT concentration increased (Fig. 3A). Compared with U87 cells treated with DMSO, apoptosis in cells treated with DPT markedly increased (Fig. 3B). Since Akt is a key mediator of cell survival through the suppression of pro-apoptotic proteins, including Bad and Bax (26), a western blot analysis was performed to further explore alteration of apoptosis regulators Bad, Bax and Bcl-2. As revealed in Fig. 3C, the protein expression of Bad and Bax increased while the protein expression of Bcl-2 was markedly reduced along with increase in the dose of DPT. Additionally, RT-qPCR was performed to detect the mRNA levels of Bad, Bax and Bcl-2. In line with the alterations observed in the protein levels, DPT promoted relative mRNA expression levels of Bad and Bax, while inhibiting that of Bcl-2 (Fig. 3D). These data indicated that DPT increased cell death by blocking Bcl-2-mediated survival pathways.

 DPT impedes the migration and invasion of GBM cells by suppressing MMP2 and MMP9 expression

Previous studies have revealed that DPT inhibited motility in various cancer cells (27) and aortic smooth muscle cells (28), therefore, the authors of the present study investigated whether the DPT-induced suppression of invasive GBM cells was mediated by MMPs. The suppression of invasive and migratory GBM cells was analyzed by Transwell assays with or without Matrigel. As revealed in Fig. 4A and B, DPT markedly reduced the migration and invasion of U87 cells in a dose-dependent manner. Similar results were observed in U251 cells (Fig. 4C and D). Given the frequency of upregulation of MMP2 and MMP9 expression by aberrant activity of the PI3K/Akt signaling pathway in cancer (29), the authors explored the underlying mechanism of decreased motility and invasiveness. Consistent with the results of the Transwell assays, Fig. 4E and F revealed that the expression of MMP2 and MMP9 decreased in cells treated with DPT in a dose-dependent manner. Similar results were observed when relative mRNA levels of MMP2 and MMP9 were examined in cells treated with DPT compared with the control cells (Fig. 4G). According to these results, DPT decreased the migratory and invasive abilities of GBM cells by suppressing MMP2 and MMP9 expression.

 DPT attenuates GBM progression via the PI3K/Akt-mediated signaling pathways

Since hyper-activation of PI3K/Akt signaling pathways have been demonstrated to instigate the rapid growth, survival and invasion of GBM cells, inhibition of PI3K expression may lead to GBM cell death and hinder GBM progression. To determine whether deactivation of the PI3K/Akt signaling pathway by DPT retarded glioma tumorigenesis, U87 cells were treated with 10 µM DPT, 20 µM LY294002 or a combination of the two. Then the lysate was assessed with western blotting. Fig. 5A revealed that DPT and pan-PI3K inhibitor LY294002 dephosphorylated Akt on Thr308 and Ser473, whereas no change was observed in the expression of Akt, PI3K p85 subunit, PI3K p110 subunit and total PI3K. Moreover, the effect of Akt Thr308 and Ser473 dephosphorylation was amplified in cells treated with LY294002 and DPT, compared with that in cells treated with DPT or LY294002 alone (Fig. 5B). As anticipated, the protein expression levels of total Akt, the catalytic subunit of PI3K-p110α, the regulatory subunit of PI3K-p85, and total PI3K were not altered following DPT alone, LY294002 alone or combination treatment. Compared with the control cells, the CDK-interacting protein p21, demonstrated the greatest increase while CDK2 and cyclin E expression levels decreased the most in cells following the combination treatment. The most evident increase in the expression of proapoptotic proteins, Bad and Bax, and the most evident decrease in the expression of the antiapoptotic protein, Bcl-2, were identified in cells treated with DPT and LY294002 together. Similarly, the protein expression of MMP2 and MMP9 decreased the most in cells treated with a combination of the agents compared with the control cells.

In brief, these results indicated that DPT inhibited GBM progression via the PI3K/Akt signaling pathways. The potential mechanisms are summarized in Fig. 5C.

 Discussion

The present study was designed to determine whether deoxypodophyllotoxin (DPT) can act as an antitumor agent by preventing glioblastoma multiforme (GBM) progression and to elucidate the molecular mechanisms of this effect. The principal research findings of the current study are as follows: i) DPT impaired the viability and invasion of, and induced the apoptosis of GBM cells; and ii) the molecular mechanisms involved include PI3K/Akt signaling pathway suppression.

GBM, WHO grade IV, is an aggressive brain tumor, which cannot be cured due to the invasive nature of the tumor. Current standard therapies for GBM include surgical resections, chemotherapies and radiotherapies. The median overall survival remains nearly 15 months after receiving standardized treatment from time of diagnosis (30). The occurrence and development of GBM is frequently associated with molecular changes in receptor-tyrosine kinase (RTK) signaling pathways, PI3K/Akt signaling pathways, cellular tumor antigen p53 signaling pathways, retinoblastoma-associated protein-dependent signaling through the cell cycle (31). The PI3K family are lipid kinases consisting of a catalytic subunit, p110 and a regulatory subunit, p85, situated downstream of RTKs. Following the activation of RTKs, Akt has been demonstrated to regulate multiple cellular processes, including proliferation, invasion, metabolism and survival (32). The Akt protein contains two phosphorylation sites, Thr308 and Ser473, which need to be phosphorylated by phosphoinositide-dependent kinase 1 and rapamycin-insensitive complex, respectively, to complete Akt activation (4). Akt phosphorylation is widely considered to be a marker reflecting PI3K activity. The phosphatase, PTEN, has been revealed to serve as a negative regulator of the PI3K/Akt signaling pathway. Abnormally activating mutants in the PI3K/Akt signaling pathway have been identified in ~10% of GBM (33) and it is hypothesized that accurately targeted strategies could be effective in patients with GBM.

An increasing number of studies have demonstrated that DPT causes cell cycle arrest, growth inhibition and cytoskeletal remodeling in various cancer cell lines, while the study of DPT in GBM cells has been limited, Guerram et al (23) reported that DPT promoted G2/M arrest and promoted apoptosis via caspase-dependent signaling pathways. Ma et al (24) demonstrated that DPT triggered parthanatos in GBM cells via the induction of excessive reactive oxygen species production. In accordance with a previous study, which revealed that a novel derivative of DPT enhanced cell cycle arrest in the G1/S phase (34), the results of the present study demonstrated that DPT interferes with cell proliferation by arresting the cell cycle in the G1/S phase. The cell cycle was arrested in different phases than in a previous study (23), suggesting that different mechanisms underlying DPT-induced cellular growth inhibition could be activated concurrently in GBM cells. One hallmark of cancer cells is the failure of cell cycle checkpoints. It is widely accepted that the CDK2/cyclin E complex serves a critical role in the G1 phase and in the G1-S phase transition by allowing the expression of genes that drive G1 progression. Constitutive activation of PI3K/Akt signaling cascades and reduced p21 protein expression were revealed to be common in GBM cells, contributing to improper progression of the cell cycle (35).

In the present study, the data revealed that DPT significantly increased the levels of p21, but decreased levels of CDK2 and cyclin E and Akt dephosphorylation in GBM cells. Therefore, PI3K/Akt/p21/CDK2/cyclin E signaling pathways were involved in DPT-induced G1/S phase arrest of the cell cycle in GBM cells.

The pro-apoptotic protein, Bad, was identified as a positive regulator of programmed cell death. The promotion of Bad expression and an increased Bax/Bcl-2 ratio were involved in apoptosis in multiple human cancers, such as GBM (36). Therefore, the connection between apoptotic regulator proteins and the phosphorylation of Akt was also investigated in this study. Phospho-Akt markedly decreased as Bad expression was increased and the ratio of Bax/Bcl-2 increased in cells following DPT treatment, indicating that DPT promoted cell death through the inhibition of Akt phosphorylation. These results were consistent with those of a previous study, which revealed that extracts of Artocarpus communis induced mitochondria-associated apoptosis in GBM cells (37). The finding that DPT triggered mitochondria-mediated apoptosis via the dephosphorylation of Akt broadened our knowledge of DPT in GBM progression.

GBM cells infiltrate into normal brain tissues and the vascular systems, preventing complete resection of all malignant cells. Hyperactivation of PI3K, together with deletions or mutations of PTEN have resulted in glycogen synthase kinase-3 β phosphorylation and the nuclear translocation of β-catenin (38). Additionally, the activated PI3K/Akt signaling pathway increased the expression and activity of MMP9 and MMP2, giving cells the proteolytic capability to invade normal brain tissues (39). The authors of the present study investigated the mechanisms underlying DPT-induced suppression of the migration and invasion of GBM cells. DPT robustly inhibited the invasiveness of GBM cells, and the expression of MMP2 and MMP9 significantly decreased, as expected. In agreement with these results, previous studies reported that the suppression of Akt hindered the migration and invasion of GBM cells by reducing MMP2 and MMP9 expression (40,41).

PI3K is generally classified into three classes according to their substrate specificity and subsequence homology, among which, class I is the most vital to

tumorigenesis and tumor progression. Class I consists of a catalytic subunit p110 and a regulator subunit p85. Lacking kinase activity, p85 functions as an adaptor, connecting with p110 to activate protein tyrosine kinase. Different p110 forms and two forms of p85 (p85α and p85β) have been identified. p110α and p110β interact with p85α, and p110α has also been revealed to interact with p85β in vitro. Notably, p110γ does not interact with the p85 subunit and has been revealed to be activated by α and βγ heterotrimeric G proteins (42,43). The subsequent conformation change releases the catalytic subunit p110, phosphorylating PIP2 into PIP3. Subsequently, PIP3 recruits Akt to inner membranes and phosphorylates Akt on Thr308 and Ser473. Thr308 located in the activation of the catalytic protein kinase core, and Ser473 within a C-terminal hydrophobic motif is required for the maximal activation of Akt (44). While the PI3K p110α isoform is expressed universally, the PI3K p110γ isoform is mainly expressed in leukocytes (45,46). As a result of the differential distribution of PI3K isoforms, p110α-specific antibody was appropriate for investigating the effects of DPT on the PI3K expression in glioma cell lines. A previous study revealed that PI3K inhibitors, including pan-PI3K inhibitors, isoform-selective PI3K inhibitors and dual PI3K/mTOR inhibitors, inhibited PI3K expression (46). The present results revealed that DPT impaired the activity of PI3K without reducing the catalytic subunit of PI3K, p110α, the regulatory subunit of PI3K, p85 and total PI3K expression in agreement with previous research. It is expected that phosphorylation of Thr308 has similar changes with that of Ser473 in cells undergoing the same treatment. DPT attenuated the phosphorylation of Akt at Thr308 and at Ser473 without hindering the expression of the p85 or p110 subunits of PI3K, indicating that DPT suppressed the activation of PI3K instead of the expression of PI3K. There are several possible explanations for the attenuation. First, DPT can disrupt the binding of activated RTKs to regulatory subunit p85 directly, leading to maintenance of inhibitory interactions between p85 and the p110 subunit (47). Second, DPT may obstruct the stimulation of catalytic subunit p110 by activated RAS independently of p85 (48). In addition, G-protein-coupled receptors activating RAS induce PI3K by binding to the p110 subunit (49). Interruption of the association of G-protein-coupled receptors and RAS by DPT cannot be excluded. Mechanisms underlying DPT dephosphorylation of Akt require further investigation.

It was also determined that the combination of DPT and the pan-PI3K inhibitor, LY294002, enhanced the suppression of Akt activation. However, interactions between DPT and PI3K inhibitors, including pan-PI3K inhibitors, isoform-selective PI3K inhibitors and dual PI3K/mTOR inhibitors, require further elucidation. In addition, experiments with human GBM xenografts are critical for exploring the safety and efficacy of DPT.

In conclusion, the present study demonstrated that DPT exhibited an inhibitory effect on cellular growth and invasion and promoted apoptosis in GBM cells by suppressing the PI3K/Akt signaling pathway. However, it is necessary to confirm the antitumor effect of DPT using a xenograft tumor model. The authors hypothesize that DPT can be used as a starting compound to develop novel therapeutic agents.

 Acknowledgements

The authors of the present study would like to acknowledge the helpful comments on this study received from our reviewers and editors.

 Funding

The present study was funded by the Ministry of Education Personnel Returning from Overseas Project sponsored by the Scientific Research Foundation [left outside of the Teaching Department no. (2013)1792]; the Liaoning Province Natural Science Foundation of China (grant no. 2015020460); the 59th Batch of Chinese Postdoctoral Science Foundation funded project (grant no. 2016M590240); the Shenyang City Science and Technology Project (grant no. 17-230-9-13); and the Scientific Research Foundation of the First Affiliated Hospital of China Medical University (grant no. FSFH201722).

 Availability of data and materials

All data generated or analyzed during this study are included in this published article.

 Authors' contributions

WW conceived and designed the study, participated in every experiment, and drafted and critically revised the manuscript. WG cultured the cell lines and performed the MTT assays and western blotting. LZ supplied the design of study and participated in the cell cycle distribution and apoptosis analyses. DZ participated in the Hoechst 33258 staining, analyzed the data and revised the manuscript critically. ZZ performed the migration assays, the invasion assays, reverse transcription-quantitative polymerase chain reaction assays and analysis of the data. YB critically revised the manuscript and was involved in the conception of the study. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

 Ethics approval and consent to participate

Not applicable.

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 Abbreviations DPT

deoxypodophyllotoxin

 DMSO

dimethyl sulfoxide

 HAs

human astrocytes

 GBM

glioblastoma multiforme

 PI3K

phosphatidylinositol 4,5-bisphosphate 3-kinase

 MMP2

matrix metalloproteinase 2

 MMP9

matrix metalloproteinase 9

 References KohlerBAWardEMcCarthyBJSchymuraMJRiesLAEhemanCJemalAAndersonRNAjaniUAEdwardsBKAnnual report to the nation on the status of cancer, 1975–2007, featuring tumors of the brain and other nervous systemJ Natl Cancer Inst103714736201110.1093/jnci/djr077214549083086878 CloughesyTFCaveneeWKMischelPSGlioblastoma: From molecular pathology to targeted treatmentAnn Rev Pathol9125201410.1146/annurev-pathol-011110-130324 OlarAAldapeKDUsing the molecular classification of glioblastoma to inform personalized treatmentJ Pathol232165177201410.1002/path.4282241147564138801 LiXWuCChenNGuHYenACaoLWangEWangLPI3K/Akt/mTOR signaling pathway and targeted therapy for glioblastomaOncotarget733440334502016269670525078108 OkkenhaugKGrauperaMVanhaesebroeckBTargeting PI3K in cancer: Impact on tumor cells, their protective stroma, angiogenesis, and immunotherapyCancer Discov610901105201610.1158/2159-8290.CD-16-0716276554355293166 FrumanDAChiuHHopkinsBDBagrodiaSCantleyLCAbrahamRTThe PI3K pathway in human diseaseCell170605635201710.1016/j.cell.2017.07.029288020375726441 PawICarpenterRCWatabeKDebinskiWLoHWMechanisms regulating glioma invasionCancer Lett36217201510.1016/j.canlet.2015.03.015257964404435977 FanQWNicolaidesTPWeissWAInhibiting 4EBP1 in glioblastomaClin Cancer Res241421201810.1158/1078-0432.CCR-17-004228696243 OhTIvanMESunMZSafaeeMFakurnejadSClarkAJSayeghETBlochOParsaATPI3K pathway inhibitors: Potential prospects as adjuncts to vaccine immunotherapy for glioblastomaImmunotherapy6737753201410.2217/imt.14.35251866044580256 LaiKKillingsworthMCLeeCSGene of the month: PIK3CAJ Clin Pathol68253257201510.1136/jclinpath-2015-20288525688137 LoikeJDBrewerCFSternlichtHGenslerWJHorwitzSBStructure-activity study of the inhibition of microtubule assembly in vitro by podophyllotoxin and its congenersCancer Res38268826931978679171 AbadALopez-PerezJLdel OlmoEGarcía-FernándezLFFranceschATrigiliCBarasoainIAndreuJMDíazJFSan FelicianoASynthesis and antimitotic and tubulin interaction profiles of novel pinacol derivatives of podophyllotoxinsJ Med Chem5567246737201210.1021/jm201757322607205 ZillaMKNayakDAminHNalliYRahBChakrabortySKitchluSGoswamiAAliA4′-Demethyl-deoxypodophyllotoxin glucoside isolated from Podophyllum hexandrum exhibits potential anticancer activities by altering Chk-2 signaling pathway in MCF-7 breast cancer cellsChem-Biol Interact224100107201410.1016/j.cbi.2014.09.02225446499 ShinSYYongYKimCGLeeYHLimYDeoxypodophyllotoxin induces G2/M cell cycle arrest and apoptosis in HeLa cellsCancer Lett287231239201010.1016/j.canlet.2009.06.01919616373 JohnstoneRWRuefliAALoweSWApoptosis: A link between cancer genetics and chemotherapyCell108153164200210.1016/S0092-8674(02)00625-611832206 BenzinaSHarquailJJeanSBeauregardAPColquhounCDCarrollMBosAGrayCARobichaudGADeoxypodophyllotoxin isolated from Juniperus communis induces apoptosis in breast cancer cellsAnticancer Agents Med Chem157988201510.2174/187152061466614060815044824913660 HuSZhouQWuWRDuanYXGaoZYLiYWLuQAnticancer effect of deoxypodophyllotoxin induces apoptosis of human prostate cancer cellsOncol Lett1229182923201610.3892/ol.2016.4943276988805038213 WangYRXuYJiangZZGuerramMWangBZhuXZhangLYDeoxypodophyllotoxin induces G2/M cell cycle arrest and apoptosis in SGC-7901 cells and inhibits tumor growth in vivoMolecules2016611675201510.3390/molecules20011661256088546272175 WangYWangBGuerramMSunLShiWTianCZhuXJiangZZhangLDeoxypodophyllotoxin suppresses tumor vasculature in HUVECs by promoting cytoskeleton remodeling through LKB1-AMPK dependent Rho A activationOncotarget629497295122015264705954745742 ParkBRLeeSAMoonSMKimCSAnthricininduced caspasedependent apoptosis through IGF1R/PI3K/AKT pathway inhibition in A549 human nonsmall lung cancer cellsOncol Rep3927692776201829620219 KimSHSonKMKimKYYuSNParkSGKimYWNamHWSuhJTJiJHAhnSCDeoxypodophyllotoxin induces cytoprotective autophagy against apoptosis via inhibition of PI3K/AKT/mTOR pathway in osteosarcoma U2OS cellsPharmacol Rep69878884201710.1016/j.pharep.2017.04.00728623712 JungCHKimHAhnJJungSKUmMYSonKHKimTWHaTYAnthricin isolated from Anthriscus sylvestris (L.) hoffm. inhibits the growth of breast cancer cells by inhibiting Akt/mTOR signaling, and Its apoptotic effects are enhanced by autophagy inhibitionEvid Based Complement Alternat Med2013385219201310.1155/2013/385219238189253681310 GuerramMJiangZZSunLZhuXZhangLYAntineoplastic effects of deoxypodophyllotoxin, a potent cytotoxic agent of plant origin, on glioblastoma U-87 MG and SF126 cellsPharmacol Rep67245252201510.1016/j.pharep.2014.10.00325712646 MaDLuBFengCWangCWangYLuoTFengJJiaHChiGLuoYDeoxypodophyllotoxin triggers parthanatos in glioma cells via induction of excessive ROSCancer Lett371194204201610.1016/j.canlet.2015.11.04426683770 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT methodMethods25402408200110.1006/meth.2001.126211846609 ZinkelSGrossAYangEBCL2 family in DNA damage and cell cycle controlCell Death Differ1313511359200610.1038/sj.cdd.440198716763616 GuanXWXuXHFengSLTangZBChenSWHuiLSynthesis of hybrid 4-deoxypodophyllotoxin-5-fluorouracil compounds that inhibit cellular migration and induce cell cycle arrestBioorg Med Chem Lett2615611566201610.1016/j.bmcl.2016.02.01326873416 SuhSJKimJRJinUHChoiHSChangYCLeeYCKimSHLeeISMoonTCChangHWDeoxypodophyllotoxin, flavolignan, from Anthriscus sylvestris Hoffm. inhibits migration and MMP-9 via MAPK pathways in TNF-alpha-induced HASMCVascul Pharmacol511320200910.1016/j.vph.2008.10.00419013539 TangYLvPSunZHanLZhouW14-3-3β Promotes migration and invasion of human hepatocellular carcinoma cells by modulating expression of MMP2 and MMP9 through PI3K/Akt/NF-κB pathwayPLoS One11e0146070201610.1371/journal.pone.0146070267307364711775 Balca-SilvaJMatiasDCarmoADSarmento-RibeiroABLopesMCMoura-NetoVCellular and molecular mechanisms of glioblastoma malignancy: Implications in resistance and therapeutic strategiesSemin Cancer Biol201830266571 MillerJJWenPYEmerging targeted therapies for gliomaExpert Opin Emerg Drugs21441452201610.1080/14728214.2016.125760927809598 EngelmanJALuoJCantleyLCThe evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolismNat Rev Genet7606619200610.1038/nrg187916847462 ParsonsDWJonesSZhangXLinJCLearyRJAngenendtPMankooPCarterHSiuIMGalliaGLAn integrated genomic analysis of human glioblastoma multiformeScience32118071812200810.1126/science.1164382187723962820389 JinYLiuJHuangWTChenSWHuiLSynthesis and biological evaluation of derivatives of 4-deoxypodophyllotoxin as antitumor agentsEur J Med Chem4640564061201110.1016/j.ejmech.2011.06.00421733601 YangRYiLDongZOuyangQZhouJPangYWuYXuLCuiHTigecycline inhibits glioma growth by regulating miRNA-199b-5p-HES1-AKT pathwayMol Cancer Ther15421429201610.1158/1535-7163.MCT-15-070926823491 ChaoYWangYLiuXMaPShiYGaoJShiQHuJYuRZhouXMst1 regulates glioma cell proliferation via the AKT/mTOR signaling pathwayJ Neurooncol121279288201510.1007/s11060-014-1654-425373346 LeeCWHsuLFLeeMHLeeITLiuJFChiangYCTsaiMHExtracts of artocarpus communis induce mitochondria-associated apoptosis via pro-oxidative activity in human glioblastoma cellsFront Pharmacol9411201810.3389/fphar.2018.00411297701145941989 LeeWSWooEYKwonJParkMJLeeJSHanYHBaeIHBcl-w enhances mesenchymal changes and invasiveness of glioblastoma cells by inducing nuclear accumulation of beta-cateninPLoS One8e68030201310.1371/journal.pone.0068030238263593694904 KubiatowskiTJangTLachyankarMBSalmonsenRNabiRRQuesenberryPJLitofskyNSRossAHRechtLDAssociation of increased phosphatidylinositol 3-kinase signaling with increased invasiveness and gelatinase activity in malignant gliomasJ Neurosurg95480488200110.3171/jns.2001.95.3.048011565871 LiuYZhengJZhangYWangZYangYBaiMDaiYFucoxanthin activates apoptosis via inhibition of PI3K/Akt/mTOR pathway and suppresses invasion and migration by restriction of p38-MMP-2/9 pathway in human glioblastoma cellsNeurochem Res4127282751201610.1007/s11064-016-1989-727394418 ZhangFYHuYQueZYWangPLiuYHWangZHXueYXShikonin inhibits the migration and invasion of human glioblastoma cells by targeting phosphorylated beta-catenin and phosphorylated PI3K/Akt: A potential mechanism for the anti-glioma efficacy of a traditional chinese herbal medicineInt J Mol Sci162382323848201510.3390/ijms161023823264738294632727 BurkeJEWilliamsRLSynergy in activating class I PI3KsTrends Biochem Sci4088100201510.1016/j.tibs.2014.12.00325573003 LuSJangHGuSZhangJNussinovRDrugging ras GTPase: A comprehensive mechanistic and signaling structural viewChem Soc Rev4549294952201610.1039/C5CS00911A273962715021603 ManningBDTokerAAKT/PKB signaling: Navigating the networkCell169381405201710.1016/j.cell.2017.04.001284312415546324 PridhamKJVargheseRTShengZThe role of class IA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunits in glioblastomaFront Oncol7312201710.3389/fonc.2017.00312293268825736525 ZhaoHFWangJShaoWWuCPChenZPToSTLiWPRecent advances in the use of PI3K inhibitors for glioblastoma multiforme: Current preclinical and clinical developmentMol Cancer16100201710.1186/s12943-017-0670-3285922605463420 DomchekSMAugerKRChatterjeeSBurkeTRJrShoelsonSEInhibition of SH2 domain/phosphoprotein association by a nonhydrolyzable phosphonopeptideBiochemistry3198659870199210.1021/bi00156a0021382595 Rodriguez-VicianaPWarnePHDhandRVanhaesebroeckBGoutIFryMJWaterfieldMDDownwardJPhosphatidylinositol-3-OH kinase as a direct target of RasNature370527532199410.1038/370527a08052307 GuptaSRamjaunARHaikoPWangYWarnePHNickeBNyeEStampGAlitaloKDownwardJBinding of ras to phosphoinositide 3-kinase p110alpha is required for ras-driven tumorigenesis in miceCell129957968200710.1016/j.cell.2007.03.05117540175

DPT inhibits the growth of GBM cells by downregulating the PI3K/Akt signaling pathway. (A) The structure of DPT. (B) HAs, U87 and U251 cells were cultured with indicated concentrations of DPT for indicated time-points in 96-well plates. MTT assays were performed and the results were presented as the mean ± standard deviation of three experiments performed in triplicate. **P<0.01. (C) U87 and U251 cells were treated with DMSO or the indicated concentration of DPT for 24 h. The expression of p85-PI3K, p110-PI3K, p-AktThr308, p-AktSer473 and total Akt were detected by western blot analysis. (D) U87 and U251 cells were treated with 20 µM LY294002 (inh), DPT or LY294002 combined with DPT. Cell lysates were detected with antibodies by western blotting. Con, control; DM, DMSO; DPT, deoxypodophyllotoxin; GBM, glioblastoma; HAs, human astrocytes; p-, phosphorylated.

DPT induces cell cycle arrest in the G1 phase. (A) U87 cells (B) and U251 cells were incubated with DMSO or DPT for 24 h. Cells were analyzed using flow cytometry. Experiments were performed in triplicate. (C) U87 and U251 cells were treated with indicated concentrations of DPT for 24 h and the expression of indicated proteins were detected by western blotting. (D) The relative mRNA levels of p21, CDK2 and cyclin E were analyzed using reverse transcription-quantitative polymerase chain reaction analysis. Results were presented as the mean ± standard deviation of three experiments preformed in triplicate. **P<0.01. DPT, deoxypodophyllotoxin; p21, cyclin-dependent kinase inhibitor 1; CDK2, cyclin-dependent kinase 2; DMSO, dimethyl sulfoxide.

DPT promotes apoptosis in GBM cells. (A) U87 cells and U251 cells were pre-incubated with DPT for 24 h. Then cells were stained with Hoechst 33258 and observed with a fluorescence microscope (magnification, ×200). (B) The apoptosis of U87 cells using flow cytometry. (C) U87 and U251 cells were treated with indicated concentrations of DPT for 24 h. The expression of indicated proteins were detected by western blot analysis. (D) U87 and U251 cells were treated with indicated concentrations of DPT for 24 h. Relative mRNA levels of Bad, Bax and Bcl-2 were detected using reverse transcription-quantitative polymerase chain reaction analysis, and results were presented as the mean ± standard deviation of three experiments preformed in triplicate. **P<0.01. DPT, deoxypodophyllotoxin; Bad, Bcl-2-associated agonist of cell death; Bax, apoptosis regulator BAX; Bcl-2, apoptosis regulator Bcl-2; GBM, glioblastoma.

DPT suppresses the invasiveness capacity of GBM cells. U87 and U251 cells were pre-incubated with DPT for 24 h. In U87 cells, (A) migration was assessed by Transwell assay without Matrigel and (B) invasion was assessed by Transwell assay with Matrigel. In U251 cells, (C) migration was assessed by Transwell assay without Matrigel and (D) invasion was assessed by Transwell assay with Matrigel. (E) U87 and (F) U251 cells were treated with indicated concentrations of DPT for 24 h, and the expression of indicated proteins in (E) U87 and (F) U251 cells were detected using western blotting. (G) Relative mRNA levels of MMP2 and MMP9 were detected using reverse transcription-quantitative polymerase chain reaction analysis. Results were presented as the mean ± standard deviation of three experiments preformed in triplicate. **P<0.01. MMP, matrix metalloproteinase; DPT, deoxypodophyllotoxin; GBM, glioblastoma; DMSO, dimethyl sulfoxide.

DPT attenuates GBM progression via PI3K/Akt-mediated signaling pathways. (A) U87 cells were treated with DPT alone or LY294002 alone. Proteins in the cell lysate were detected with indicated antibodies by western blotting. (B) U87 cells were treated with DPT alone, 20 µM LY294002 alone or LY294002 combined with DPT. Proteins in the cell lysate were detected with indicated antibodies by western blotting. (C) The proposed mechanisms of DPT, which allow it to suppress GBM cells via the PI3K/Akt signaling pathways. Con, Control; DM, DMSO; DPT, deoxypodophyllotoxin; GBM, glioblastoma; inhibitor (inh), LY294002

Primer sequences for the reverse transcription-quantitative polymerase chain reaction analysis.

Primers
Gene Forward (5′-3′) Reverse (5′-3′)
p21 AGTCAGTTCCTTGTGGAGCC AGGAGAACACGGGATGAGGA
Cyclin E CCATCATGCCGAGGGAGC AAGGCCGAAGCAGCAAGTAT
CDK2 GCCATTCTCATCGGGTCCTC ATTTGCAGCCCAGGAGGATT
MMP2 CGCATCTGGGGCTTTAAACAT TCAGCACAAACAGGTTGCAG
MMP9 CGACGTCTTCCAGTACCGAG TTGTATCCGGCAAACTGGCT
BAD CCAACCTCTGGGCAGCACAGC TTTGCCGCATCTGCGTTGCTGT
BCL-2 GGTGAACTGGGGGAGGATTG GGCAGGCATGTTGACTTCAC
BAX AGCTGAGCGAGTGTCTCAAG GTCCAATGTCCAGCCCATGA
β-actin TCGTGCGTGACATTAAGGAG ATGCCAGGGTACATGGTGGT