HCT116 cells were obtained from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI-1640 medium (HyClone; GE Healthcare, Chicago, IL, USA) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The HCT116 cells were cultured at 37°C in a humidified incubator with 5% CO₂.

The MEIS2 shRNA sequences were obtained from Shanghai GeneChem Co., Ltd. (Shanghai, China). Recombinant lentiviral vectors carrying MEIS2 shRNA were constructed according to the manufacturer's protocol. The MEIS2 shRNA sequences were designed using an online system (http://rnaidesigner.thermofisher.com/rnaiexpress/) and purchased from Shanghai GeneChem Co., Ltd. The sequence of MEIS2 shRNA-1 was 5′-CCGGCCCATGATTGACCAGTCAAATTTCAAGAGAATTTGACTGGTCAATCATGGGTTTTTG-3′ and the sequence of MEIS2 shRNA-2 was CCGGCCCATGATTGACCAGTCAAATTTCAAGAGAATTTGACTGGTCAATCATGGGTTTTTG. Recombinantlentiviral vectors carrying MEIS2 shRNAs were constructed with standard molecular techniques. 293T cells were transfected with the recombinant vectors to generate lentiviruses. Concentrated lentiviruses were transfected in HCT116 cells at a multiplicity of infection (MOI) of 40 in RPMI-1640 medium (HyClone; GE Healthcare) without FBS. The expression of MEIS2 in HCT116 knockdown cells was validated by quantitative real-time polymerase chain reaction (qRT-PCR).

Total RNA was extracted from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Subsequently, cDNA was synthesized using the RevertAid First Strand cDNA Synthesis kit (Promega Corp., Madison, WI, USA), according to the manufacturer's protocol. qPCR was performed using the iQ™ SYBR-Green SuperMix (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The following primers were used for qPCR: CEBPA forward, 5′-CCAGAAAGCTAGGTCGTGGGT-3′ and reverse, 5′-TGGACTGATCGTGCTTCGTGT-3′; JUN forward, 5′-ATGGTCAGGTTATACTCCTCCTC-3′ and reverse, 5′-CACATGCCACTTGATACAATCC-3′; TGFBR2 forward, 5′-TGGCTGTATGGAGAAAGA-3′ and reverse, 5′-GTCAGGATTGCTGGTGTT-3′; GAPDH forward, 5′-TGACTTCAACAGCGACACCCA-3′ and reverse, 5′-CACCCTGTTGCTGTAGCCAAA-3′; MDM2 forward, 5′-GAATCATCGGACTCAGGTACATC-3′ and reverse, 5′-TCTGTCTCACTAATTGCTCTCCT-3′; CDKN1A forward, 5′-CTGTCTTGTACCCTTGTGCCT-3′ and reverse, 5′-GGTAGAAATCTGTCATGCTGGT-3′; and TGFBR2 forward, 5′-CGATAACTTCTGCCACCGAT-3′ and reverse, 5′-AGGGTTATGGTCAGCGAGAT-3′. The 2^−ΔΔCq method was used to calculate the relative expression levels of the target genes (13).

HCT116 cells were seeded into a 6-well plate. Once the confluency of the cells reached ~80%, a scratch was created in a monolayer of the cells using a sterile micropipette tip. The detached cells were then washed with phosphate-buffered saline (PBS). The extent of wound healing was observed at 0, 24 and 48 h. Images were captured from 5 random fields using an inverted microscope. Triplicate wells for each condition were examined.

Transwell assays were performed using 8-µm pore size Transwell^® plates (Corning Inc., Corning, NY, USA). The invasion assay was performed using Matrigel^® (BD Biosciences, San, Jose, CA, USA), which was used to pre-coat Transwell^® plates. A total of 50,000 HCT116 cells, cultured in RPMI-1640 with 2% FBS, were seeded into the upper well. In addition, RPMI-1640 with 10% FBS was added to the bottom well. Following incubation for 72 h the number of invading cells was counted.

A total of 4×10⁶ MEIS2-knockdown or negative control HCT116 cells were transplanted into ten 5-week-old female nude mice (from the Shanghai Slake Laboratory Animal Co., Ltd., Shanghai, China) weighing 15–20 g through the lateral tail vein. The mice were housed at a temperature of 20–26 °C, a relative humidity of 40–70 % and light/dark cycle of 12/12 h. Luciferase-expressing HCT116 cells were constructed. MEIS2-knockdown and control luciferase-expressing HCT116 cells were then injected into the mice and monitored using an IVIS system (IVIS; PerkinElmer, Inc., Waltham, MA, USA). The animal was sacrificed when the tumor reached 1 cm in diameter. The mice were sacrificed 7 weeks after injection with CO₂ (with the flow rate of CO₂ euthanasia displacing ≤30% of the chamber volume/min). To detect the effect of MEIS2 on tumor metastasis, the lungs were collected and hematoxylin and eosin (H&E) staining was performed. All in vivo study protocols were approved by the Shanghai Medical Experimental Animal Care Commission (Approval ID: ShCI-14-008).

The CRC cells were rinsed with PBS, and lysates were prepared using RIPA buffer (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Total protein concentrations were determined using a BCA protein concentration assay kit (Beyotime Institute of Biotechnology, Haimen, China). A quantity of 50 µg protein sample was loaded to each lane before electrophoresis began. Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes using a Bio-Rad System (Bio-Rad Laboratories, Inc.). Blotted membranes were firstly moved to blocking buffer containing 5% non-fat dry milk (diluted in TBST) at room temperature for 1 h. Western blot analysis was performed with E-cadherin (diluted 1:1,000; cat. no. 14472; Cell Signaling Technologie), Snail (diluted 1:1,000; cat. no. 3895; Cell Signaling Technologies), MEIS2 (diluted 1:1,000; cat. no. ab73164; Abcam, Cambridge, MA, USA), Twist (diluted 1:1,000; cat. no. ab50581; Abcam), JUN (diluted 1:1,000; cat. no. ab32137; Abcam), CEBPA (diluted 1:1,000; cat. no. 8178; Cell Signaling Technologies), MDM2 (diluted 1:1,000; cat. no. ab38618; Abcam), TGFBR2 (diluted 1:1,000; cat. no. ab61213; Abcam) and CDKN1A (diluted 1:1,000; cat. no. 2947; Cell Signaling Technologies), and mouse anti-GAPDH (diluted 1:1,000; cat. no. c-25778; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) at 4°C overnight and then incubated with 2 mg/ml HRP-conjugated anti-rabbit IgG (diluted 1:5,000; cat. no. A9169; Sigma-Aldrich; Merck KGaA) for 1 h at room temperature. After washing, ECL Western Blotting reagent (Millipore; Merck KGaA) was applied for the detection. The Quantity One software package (Bio-Rad Laboratories, Inc.) was used for quantitation of the signal intensities.

Total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and was quantified by the NanoDrop ND-2000 (Thermo Fisher Scientific, Inc.). Global expression of mRNAs in 3 MCM10 shCtrl samples and 3 shMCM10 were examined using the GeneChip PrimeView Human Gene Expression Array (Thermo Fisher Scientific, Inc.). The raw data of the mRNA expression profiles were downloaded and analyzed by R language software. Background correction, quartile data normalization, and probe summarization were applied for the original data. The limma method in Bioconductor (http://www.bioconductor.org/) was used to identify genes which were differentially expressed between two groups; the significance of DEGs was calculated by t-test and was represented by a P-value. The threshold set for upregulated and downregulated genes was a fold-change ≥1.5.

The gene expression profiles of MEIS2 in CRC by analyzing a series of public datasets, including The Cancer Genome Atlas (TCGA), GSE17536 (14), GSE17537 (14) and GSE41258 (15) datasets. TCGA dataset included 10 normal colon samples and 367 CRC samples. GSE17536 dataset included 177 patients with CRC from the Moffitt Cancer Center (Tampa, FL, USA) were used as the independent dataset. GSE17537 dataset included 55 CRC patients from Vanderbilt Medical Center (Nashville, TN, USA). GSE41258 dataset included 54 normal colon samples, 13 normal liver samples, 7 normal lung samples and 186 primary CRC samples. Moreover, we analyzed the protein levels of MEIS2 in CRC by analyzing Human Protein Atlas database (https://www.proteinatlas.org/).

The Database for Annotation, Visualization, and Integrated Discovery (DAVID) online tool (version 6.8; david.ncifcrf.gov) was applied to perform Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. Adjusted P<0.05 was considered to indicate statistical significance.

SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA) was used to perform statistical analysis. Each experiment was performed 3 times. Student's t-test was used to calculate the statistical significance between 2 groups. For >2 groups, one-way analysis of variance followed by Newman-Keuls post hoc test was used. P<0.05 was considered to indicate a statistically significant difference.

The present study performed loss-of-function assays by silencing MEIS2 expression to investigate its role in CRC. As presented in Fig. 1A-C, shRNA-mediated silencing of MEIS2 led to a significant decrease in both mRNA and protein expression levels of MEIS2 in HCT116 cells. Subsequently, the effects of MEIS2 on cell migration were examined by wound healing assay. Compared with the negative control group, MEIS2-knockdown significantly suppressed the number of HCT116 cells migrating toward the wound area (Fig. 1D-E and S1).

Furthermore, a Transwell assay was performed to investigate the role of MEIS2 in the regulation of migration. It was revealed that the number of migrating HCT116 cells decreased by ~70 and 60% in the shRNA-1 (Fig. 2A and B) and shRNA-2 (Fig. 2A and C) knockdown groups, respectively, compared with the negative control group.

The invasive ability of cells transfected with MEIS2 shRNAs was assessed by Matrigel cell invasion assay. The results indicated that knockdown of MEIS2 significantly suppressed the invasion of CRC cells (P<0.05). The number of invading HCT116 cells decreased by ~80 and 45% in the shRNA-1 (Fig. 3A and B) and shRNA-2 (Fig. 3A and C) knockdown groups, respectively, compared with the negative control group.

To investigate whether MEIS2 promotes metastasis by regulating EMT, the protein levels of E-cadherin, Twist and Snail were detected following MEIS2 knockdown in CRC cells. Western blot analysis revealed that the expression level of E-cadherin increased, while Twist and Snail levels decreased in MEIS2-knockdown HCT116 cells compared with the control groups (Fig. 4A and B).

Since it was demonstrated that MEIS2 knockdown inhibited cell motility in vitro, the effect of MEIS2 on CRC metastasis was further validated in vivo. The results demonstrated that MEIS2-knockdown significantly inhibited CRC metastasis in vivo. The luciferase signaling in the MEIS2-knockdown group was significantly decreased compared with the control groups (Fig. 5A and C).

Furthermore, histological analysis was performed to confirm that MEIS2-knockdown inhibits the formation of lung metastasis. It was revealed that the number of lung metastasis nodules was markedly lower in the MEIS2-knockdown group compared with the control group (Fig. 5B).

Previous studies have indicated that MEIS2 is involved in the regulation of gene transcription by interacting with HOX and PBX proteins to form protein-DNA complex. However, the targets of MEIS2 in certain human cancer types, including CRC, remain unknown. The present study performed microarray analysis, which identified 338 upregulated and 317 downregulated genes following MEIS2-knockdown (Fig. 6A). The top 10 upregulated genes are presented in Table I and the top 10 downregulated genes are revealed in Table II. Bioinformatics analyses, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes pathway analysis, were subsequently performed.

As anticipated, it was revealed that the downregulated genes following MEIS2-knockdown were associated with negative regulation of apoptotic process, chondroitin sulfate biosynthetic process, regulated exocytosis, ER-associated misfolded protein catabolic process, protein kinase B signaling, Golgi organization, Rap1 signaling pathway and glycosaminoglycan biosynthesis. Furthermore, upregulated genes following MEIS2-knockdown were identified to be involved in regulating cilium assembly, response to stress, protein transport, cellular response to starvation, negative regulation of TOR signaling, mitotic spindle organization, p53 signaling pathway, FoxO signaling pathway, carbohydrate digestion and absorption, endocytosis, and PI3K-Akt signaling pathway (Fig. 6B-E).

To further validate the microarray analysis results, the expression levels of several key pathway regulators were detected using RT-qPCR following MEIS2-knockdown in CRC cells. As presented in Fig. 7A, it was revealed that CEBPA was downregulated, and JUN, TGFBR2, MDM2 and CDKN1A were upregulated following MEIS2-knockdown in HCT116 cells. Western blot analysis also revealed similar results (Fig. 7B and C).

Next, the protein levels of MEIS2 in CRC tissue and normal colorectal tissue were analyzed using the Human Protein Atlas database. As revealed in Fig. S2, it was demonstrated that the MEIS2 protein levels in CRC samples were high. In addition, the MEIS2 protein levels in normal colon and rectum samples were also high. Furthermore, the present study analyzed whether the dysregulation of MEIS2 was correlated with overall survival time in CRC by analyzing a series of public datasets, including The Cancer Genome Atlas (TCGA), GSE17536 (14), GSE17537 (14) and GSE41258 (15) datasets. Analysis of TCGA data revealed that a high expression level of MEIS2 was correlated with a shorter overall survival time for patients with CRC (Fig. 8A). Subsequently, the Gene Expression Omnibus datasets, including GSE17536, GSE17537 and GSE41258, were further analyzed to validate the aforementioned analysis. A similar result was observed, where the overall survival time was shorter in the MEIS2-high group compared with the MEIS2-low group (Fig. 8B-D). These results indicated that the dysregulation of MEIS2 could serve as a novel biomarker for CRC.