A total of 35 specimens of benign ovarian tumors and 40 specimens of malignant tumors were collected from January 2017 to December 2017 at Renmin Hospital of Wuhan University (Wuhan, China). The age range of patients was 35–65 years of age and had no other tumors. All patients reviewed the content and purpose of the study and provided written informed consent. All patients knew and agreed to participate in the study prior to specimen collection. The project was approved by the Medical Ethics Committee of Renmin Hospital of Wuhan University. All ovarian tumor tissues were pathologically confirmed as epithelial ovarian cancer. Prior to the acquisition of the tissue, the patients did not undergo any tumor-related treatments, such as chemotherapy, radiation therapy or immunotherapy.

SKOV3, A2780 and OVCAR3 cells are human serous OC cell lines that were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) cell bank. IOSE80, a normal ovarian epithelial cell line, was also obtained from the ATCC cell bank. The cell culture medium was DMEM/F12 (cat. no. SH30023.01; HyClone; GE Healthcare Life Sciences) supplemented with 10% fetal bovine serum (FBS; cat. no. 141215; Hangzhou Tianhang Biological Technology Co., Ltd., Hangzhou, China) and 1% anti-cyanin. Cells were grown in a cell culture flask in a humidified incubator at 37°C in an atmosphere composed of 95% air and 5% carbon dioxide. The medium was changed every 2 days. Cells were passaged using 0.05% trypsin/ethylenediaminetetraacetic acid (cat. no. GNM25200; Gino Biomedical Technology Co., Ltd., Hangzhou, China). A Wnt inhibitor (XAV-939; cat. no. S1180; Selleck Chemicals, Houston, TX, USA) and a Wnt agonist (AZD2858; cat. no. HY-15761; Medical Chemical Corp., Torrance, CA, USA) were added at a concentration of 1 µM for 12 h.

The cells were seeded at a density of 4×10⁵ cells/well in 24-well culture plates containing the appropriate amount of complete medium to achieve a cell density of 30–50 % at the time of transfection. The specific miR-21 mimics/inhibitor and the negative control (NC) were designed and purchased from GenePharma Co., Ltd. (Shanghai, China). The sequences of the miRNA mimics and inhibitor are as follows: hsa-miR-21-5p mimics: UAGCUUAUCAGACUGAUGUUGA, AACAUCAGUCUGAUAAGCUAUU; hsa-miR-21-5p inhibitor UCAACAUCAGUCUGAUAAGCUA; miRNA control UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT. Cells were collected for further analysis after 48 h of transfection.

Total protein was extracted from adherent cells as follows: First, the adherent cells were washed 2–3 times with PBS buffer. Then, the appropriate volume of total cell protein extraction reagent (RIPA protein lysate; cat. no. AS1004; Aspen) (with protease inhibitors added within minutes of use) was added to the culture plates/vials for 3–5 min. Next, the cells were collected into 1.5-ml centrifuge tubes and incubated in an ice bath for 30 min with repeated pipetting to ensure the complete cell lysis. After centrifugation at 13,000 × g for 5 min at 4°C, the supernatant was collected, which contained the total protein solution. The protein concentration of each sample was determined using a BCA protein concentration assay kit (cat. no. AS1086; Aspen). A total of 30 µg of protein was loaded onto 10% SDS-polyacrylamide gels, separated and then transferred onto polyvinylidene difluoride membranes (PVDF; Bio-Rad Laboratories, Inc., Hercules, CA, USA). Then 5% milk blocking solution was incubated for 2 h at room temperature. The membranes were probed with primary antibodies against human CD44V6 (dilution 1:10,000; cat. no. ab78960; Abcam, Cambridge, UK), β-catenin (dilution 1:10,000; cat. no. ab32572; Abcam) and GAPDH (dilution 1:2,000; cat. no. ab37168; Abcam) at 4°C overnight. After several washes with TBST, the membranes were incubated with HRP-conjugated goat anti-mouse (dilution 1:10,000; cat. no. AS1106; Aspen) or HRP-conjugated goat anti-rabbit (1:10,000; cat. no. AS1107; Aspen) at room temperature for 2 h. The bound antibody was detected using the SuperSignal West Pico ECL Chemiluminescent Kit (Thermo Fisher Scientific, Inc., Rockford, IL, USA).

Total RNA from tissues and cells was isolated using TRIzol reagent (cat. no. 15596-026; Invitrogen™; Thermo Fisher Scientific, Inc., Watham, MA, USA) according to the manufacturer's instructions. Next, 250 µl of chloroform was added, mixed well, and incubated on ice for 5 min. Then, the samples were centrifuged at 10,000 × g for 10 min at 4°C. In an ultraclean workbench, 400 µl of the supernatant was carefully absorbed into a 1.5-ml EP tube, and an equal volume of 4°C precooled isopropanol was added. Then, the samples were mixed by inversion and incubated at −20°C for 15 min. Next, the samples were centrifuged at 10,000 × g for 10 min at 4°C, after which the liquid was carefully decanted. Then, 1 ml of precooled (4°C) 75% ethanol was added, and the tubes were inverted several times to wash the RNA precipitate. Subsequently, the tubes were centrifuged at 4°C at 10,000 × g for 5 min, after which the liquid was decanted. Finally, the samples were dried on a clean table for several minutes to fully evaporate the ethanol, and then 10 µl of RNase-Free Water was added to fully dissolve the RNA.

cDNA synthesis was performed using the M-MLV reverse transcriptase kit (Invitrogen™; Thermo Fisher Scientific, Inc.). Briefly, the following reagents were added into an EP tube: 1 µl of the internal reference gene-specific reverse transcription primer (10 µM), 1 µl of the target gene-specific reverse transcription primer (10 µM), 1 µl of the dNTP mix, and 10 µl of RNA. The samples were incubated at 65°C for 5 min and then on ice for 2 min. Next, 4 µl of the 5′ first strand synthesis buffer and 2 µl of 0.1 M DTT were added into the EP tube, which was incubated in the PCR instrument at 37°C for 2 min. Finally, 1 µl of M-MLV reverse transcriptase was added, and the tubes were placed in the PCR instrument and subjected to 37°C for 50 min, followed by 75°C for 15 min. Then, the samples were cooled to 4°C.

qRT-PCR analysis of the RNA was performed using the Qiagen OneStep RT-PCR kit (Qiagen, Inc., Valencia, CA, USA). Total RNA was polyadenylated and reverse-transcribed using the TaqMan MicroRNA Reverse Transcription kit and TaqMan miRNA assay (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The expression of U6 (a small nuclear RNA) was used as the internal control. The relative expression of the tested genes was calculated and normalized using the 2^−ΔΔCq method (25). RT-PCR was performed on a Life Technologies StepOne™ Real-Time PCR instrument using the SYBR^® Premix Ex Taq™ kit (Takara Bio Inc., Otsu, Japan). Each sample was tested in triplicate. The amount of each reagent was as follows: 5 µl of 2X qPCR Mix, 1 µl of primer working solution (2.5 µM), 1 µl of template, 2.8 µl of ddH₂O, and 0.2 µl of Rox dye. The following primers were used: U6 RT primer, 5′-AACGCTTCACGAATTTGCGT-3′, forward, 5′-CTCGCTTCGGCAGCACAT-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′; hsa-miR-21 RT primer, 5′CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACATC-3′, forward, 5′-TGGGCTTATCAGACTGATGTTGA-3 and reverse 5′-CTCAACTGGTGTCGTGGAGTC-3′; H-GAPDH forward, 5′-CATCATCCCTGCCTCTACTGG-3′ and reverse, 5′-GTGGGTGTCGCTGTTGAAGTC-3′; H-β-catenin forward, 5′-GCCAAGTGGGTGGTATAGAGG-3′ and reverse, 5′-GGGATGGTGGGTGTAAGAGC-3′; H-CD44V6 forward, 5′-GCCTTTGATGGACCAATTACC-3′ and reverse, 5′-TCATTCCTATTGGTAGCAGGGA-3′.

Cells in the logarithmic growth phase were digested with 0.25% trypsin. Then, the cells were suspended in DMEM medium containing 10% fetal bovine serum. The cell suspension was diluted and seeded at a density of 1,000 cells/well in a dish containing 10 ml of 37°C prewarmed culture medium. The dish was gently rotated to uniformly disperse the cells. The cells were incubated at 37°C with 5% CO₂ and saturated humidity for 2 to 3 weeks. When macroscopic clones appeared in the culture dish, the culture was terminated. The supernatant was discarded, and the cells were carefully washed twice with PBS. Then, 4% paraformaldehyde was used to fix the cells for 15 min. Subsequently, the appropriate amount of GIEMSA application staining solution was added to the fixative solution for 10 to 30 min. Subsequently, the staining solution was slowly washed away with running water, and the plate was allowed to air dry. The plate was inverted and overlaid with a grid of transparencies, and the clones were counted directly with the naked eye; alternatively, the number of clones >10 cells was counted under a light microscope (low magnification). Finally, the clone formation rate was calculated as follows: Clonal formation rate=(no. of clones/no. of cells inoculated) ×100%.

The dyeing solution was prepared as follows: 0.5% crystal violet solution diluted 1:5 with PBS solution was added into the 0.01% crystal violet dye solution. The cells were prepared into a suspension of 10⁵ cells/ml, and 1 ml of the cell suspension was centrifuged at 10,000 × g for 5 min, after which the supernatant was discarded. Then, 1 ml of serum-free medium was added and mixed evenly, after which 200 µl of the cell suspension was added into the Transwell chamber. Next, 500 µl of complete medium containing 10% FBS was added to the 24-well plate, and the chamber was placed in the plate. The plate was incubated for 48 h at 37°C in an incubator with 5% CO₂. The chamber was then removed, the medium was washed away with PBS, the glue and cells in the upper chamber were wiped clean with a cotton swab, and crystal violet stain was applied for 10 min. Then, the surface crystal violet was washed away, and the side opposite to the cell-inoculation side was photographed under an inverted microscope. The cell invasion assay was performed in an identical manner to the cell migration assay, except that a specific proportion of Matrigel (Serum-free medium: matrigel=7:1) was added to the Transwell chamber.

SKOV3 cells in the logarithmic growth phase were digested with trypsin to prepare a cell suspension at a concentration of 1×10⁵ cells/ml, which was seeded in a 96-well plate at 8,000 cells/well and 100 µl/well. The plate was incubated at 37°C with 5% CO₂ for 24 h for the cells to adhere. The medium was changed after 24 h. Five replicates were used for each sample concentration. Next, 10 µl of CCK-8 solution was added to all wells, and the plate was incubated for 2 h. Finally, the absorbance at 450 nm was measured using a microplate reader. Then, the cells that were treated with the solvent were used as a control group, and the medium without cells served as the blank group. The survival rate of the cells was calculated according to the following formula:

Cell viability %=(experimental group-blank group)/(control group-blank group) ×100%.

Following tissue embedding, sectioning, baking, dewaxing, rehydration and antigen retrieval, the blocking solution was added for 1 h. Then, the primary antibody, anti-CD44v6 (dilution 1:500; cat. no. ab78960; Abcam), was applied overnight at 4°C. Next, the sections were washed with PBS, and a secondary antibody goat anti-mouse (dilution 1:200; cat. no. AS1106; Aspen) was added at room temperature for 2 h. Then, the sections were washed 3 times with PBS, and the color developer (DAB) was added. Finally, the sections were rinsed, counterstained and sealed.

The cell suspension was added to a coverslip and incubated at 37°C in an incubator with 5% CO₂ until the cells were fixed (~2 h). The culture was continued for 2 h with the addition of 2 ml of the cell culture solution. Then, the medium was decanted, and the cells were washed 3 times with PBS. Next, 4% paraformaldehyde was added for 30 min to fix the cells, and subsequently the cells were washed three times with PBS. Next, the slides were slightly dried, and 50–100 µl of the DAPI staining solution (cat. no. AS1075; Aspen) was added and incubated for 10 min at room temperature, followed by 3 washes with PBS. Subsequently, a 3% hydrogen peroxide solution was added, and the slides were incubated at room temperature for 20 min in the dark, and then the slides were placed in PBS (pH 7.4) 3 times on a decolorizing shaker. After the slides were slightly dried, the cells were covered with an anti-β-catenin primary antibody (dilution 1:200; cat. no. ab16051; Abcam) diluted to a specific concentration with 5% BSA and incubated in a humidified box at 4°C overnight. Then, the slides were placed in PBS (pH 7.4) and washed 3 times on a bleaching shaker. After drying slightly, the cells were covered with a secondary antibody of the corresponding species (CY3-labeled goat anti-rabbit; dilution 1:50; cat. no. AS-1109; Aspen) and incubated for 50 min at room temperature. Then, the slides were washed 3 times with PBS, and 50–100 µl of DAPI staining solution was added dropwise to each well, followed by incubation for 5 min at room temperature. Subsequently, PBS was added to each well for 3 washes. An appropriate amount of anti-fluorescence quencher was added dropwise to the cells, the coverslips were mounted, and the slides were observed under a fluorescence microscope.

Data are expressed as the mean ± SEM. Data were analyzed using SPSS 21.0 (IBM Corp., Armonk, NY, USA) software. A t-test was used to compare two groups, and one-way analysis of variance (ANOVA) followed by Bonferroni post hoc test was used to compare multiple groups. The Chi-square test was used to classify the data. A P-value of P<0.05 was considered to indicate a statistically significant difference.

To investigate the expression level of miR-21 in benign and malignant ovarian tissues, the expression level of miR-21 was examined in 35 benign and 40 malignant ovarian tissue samples. The results are presented in Fig. 1A. As anticipated, the expression level of miR-21 in malignant OC tissues was significantly higher than that in benign ovarian tissues (Fig. 1A; P<0.01). This finding indicated that miR-21 may play a role in the development of malignant ovarian tumors.

To further investigate the expression of miR-21 in OC cell lines and normal ovarian epithelial cells, the expression levels of miR-21 were examined in the OC malignant cell lines SKOV3, OVCAR3, A2780 and the ovarian normal epithelial cell line IOSE80. The results revealed that the expression level of miR-21 in SKOV3 cells was significantly higher than that in the normal ovarian epithelial cell line (Fig. 1B; P<0.01). This trend was consistent with the results of the human tissue samples, indicating that miR-21 may in fact play an important role in malignant OC.

To determine whether the expression level of miR-21 affects the biological behavior of OC cells, loss- and gain-of-function experiments were performed in SKOV3 cells using the transient transfection with miR-21 mimics or an inhibitor. The transfection efficiency of RNA oligos was ascertained by qRT-PCR, as revealed in Fig. 1C and the proliferation rate of SKOV3 cells was determined by CCK-8 assay (Fig. 1D). Compared with the negative control group, the proliferation rate in the miR-21-inhibitor group was lower Then, the cell clonal formation, invasion and migration was examined in each group. As observed in Fig. 2A and B, the SKOV3 cell clonal formation rate was similar in the blank control group and the negative group. Although there were no significant differences between the negative control group and the miR-21-mimics group (Fig. 2B, C, and I; P>0.05), the colony formation rate of the SKOV3 cells in the miR-21-inhibitor group was obviously lower than the negative control group (Fig. 2B, D and I; P<0.01). Compared with the negative control group, SKOV3 cell migration (Fig. 3B, C and I, P<0.01) and invasion (Fig. 4B, C and I; P<0.01) abilities in the miR-21-mimics group were significantly increased and in the miR-21-inhibitor groups were significantly decreased. These findings indicated that miR-21 affected the biological behavior of OC.

To further explore the downstream signaling pathway of miR-21, it was ascertained from literature that the Wnt signaling pathway may be one of the primary downstream target genes of miR-21. Therefore, a Wnt inhibitor (XAV-939) and a Wnt agonist (AZD2858) were included in the experiment, and the results were asceertained by qRT-PCR and western blot analysis. As revealed in Fig. 1C, the results indicated that the activation of the Wnt pathway could partly promote the expression of miR-21. Concurrently, the results indicated that the expression of Wnt/β-catenin was positively associated with the expression of miR-21 (P<0.01). The corresponding cell clone formation as well as cell invasion and migration rates were revealed to be associated with the expression level of miR-21. High expression levels of miR-21 promoted the proliferation, migration and invasion of ovarian cancer cells. In the miR-21-mimics groups, the rate of cell clone formation was significantly higher than that of the miR-21-inhibitor group (Fig. 2C and D, P<0.01), and similar results were obtained in the invasion (Fig. 4C and D, P<0.01) and migration experiments (Fig. 3C and D, P<0.01). In addition, the cytological behavior was influenced by Wnt/β-catenin pathway. When a Wnt inhibitor was added to the miR-21-mimics group, proliferation, migration and invasion of SKOV3 cells were observed to be decreased compared to the miR-21-mimics group alone (Fig. 2C, G and I, P<0.01; Fig. 3C, G and I, P<0.01; Fig. 4C, G and I, P<0.01). When a Wnt agonist was added in the miR-21-inhibitor group, proliferation, migration and invasion of SKOV3 cells were observed to be increased (Fig. 2D, H and I, P<0.01; Fig. 3D, H and I, P<0.01; Fig. 4D, H and I, P<0.01). For the expression of β-catenin mRNA and protein, as observed in Fig. 5, there was no difference between the blank control group and the negative control group. The β-catenin mRNA and protein expression was significantly higher in the miR-21-mimics group compared with the negative control group (Fig. 5, P<0.01). After treatment with the Wnt inhibitor, the β-catenin mRNA and protein expression was decreased compared to the miR-21-mimics group alone (Fig. 5, P<0.01). Since β-catenin is transferred into the nucleus to promote tumor development, the enucleation of β-catenin in various groups of miR-21 expression levels was further examined using immunofluorescence. The results revealed that higher expression levels of miR-21 led to the increased enucleation of β-catenin (Fig. 6). These results indicated that the Wnt signaling pathway could in fact be regulated by miR-21, and moreover, high expression levels of miR-21 activated the Wnt signaling pathway.

Previous studies have confirmed that CD44v6 is highly expressed in OC tissues and cells and that CD44v6 is involved in the development of OC; therefore, this molecule is expected to be a molecular marker for the detection of OC (23). The immunohistochemical results of CD44v6 in our human ovarian benign and malignant tissues were also consistent with this conclusion (Fig. 7A). In addition, studies have reported that the Wnt pathway affects the expression of CD44v6 in tumors (26). Due to the tissue-specific expression of miR-21 and CD44, their molecular regulatory pathways in ovarian cancer are still unclear; thus, the mRNA and protein expression of CD44v6 in different treatment groups were analyzed. The mRNA and protein expression levels of CD44v6 in the miR-21-mimic groups were significantly higher than those in the negative control group (P<0.01), whereas the mRNA and protein levels of CD44v6 in the miR-21-inhibitor group were significantly lower than those in the negative control group (P<0.01) (Fig. 7B). These findings indicated that miR-21 affected the expression of CD44v6. To further confirm that miR-21 affects the expression of CD44v6 through the activation of the Wnt signaling pathway, the blank control group, the negative control group and the miR-21 mimics group were treated with a Wnt inhibitor, and a Wnt agonist was added to the miR-21-inhibitor group and the mRNA and protein expression levels of CD44v6 were reanalyzed. The expression of CD44v6 was revealed to be significantly lower following the addition of the Wnt inhibitor, whereas the expression of CD44v6 in the Wnt agonist group was significantly increased compared to the miR-21-mimics group alone (Fig. 7B and D). These findings indicated that the miR-21/Wnt/CD44v6 axis plays an important role in the development of OC.