The human normal prostate epithelial cell line RWPE-1 and the androgen-independent prostate cancer cell lines PC3 and DU145 were used in the present study. The metastatic potential of DU145 is higher than that of the PC3 cell line. 293 cells were obtained from the Type Culture Collection of the Chinese Academy of Sciences. DU145 cells were maintained in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with a combination of 1% penicillin and streptomycin in the presence of 10% fetal bovine serum (Gibco). Ham's F-12K (Kaighn's) Medium (Gibco; Thermo Fisher Scientific, Inc.) was used to culture PC3 cells with 1% penicillin and streptomycin and 10% fetal bovine serum in the culture medium. 293 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Gibco; Thermo Fisher Scientific, Inc.) with a combination of 1% penicillin and streptomycin and 10% fetal bovine serum. All the cells were incubated in standard cell culture conditions with 5% CO₂ and 95% humidity at 37°C.

A siRNA oligonucleotide targeting α5-nAChR mRNA was synthesized by Shanghai Genepharma Co. Ltd. The sequence was as follows: 5′-CCCGCAAACUACAAAAGUUTT-3′. A pair of scrambled control siRNAs with sequences different from those of the siRNA-α5-nAChR was designed. The pair of sequences was not homologous to any sequences found in GeneBank. When the cells reached 70–80% confluence, the transfection was conducted according to the transfection instructions. The cells were subsequently cultured under normal conditions for 36 h at 37°C.

IHC was performed in 8 normal prostate tissues (all male, aged 66.37±4.53) and the results were compared with the analysis performed in 36 prostate cancer samples (Table I). The clinicopathological variables of these patients were collected. Written informed consent forms were obtained from the subjects. The study protocol was approved by the Research Ethics Committee of the Second Hospital of Hebei Medical University. IHC was performed to determine α5-nAChR expression. Paraffin-embedded tissue sections (5-µm thick) were deparaffinized with xylene, followed by rehydration using a graded series of 100, 90, 80 and 70% ethanol. Then, intrinsic peroxidase was deactivated with 0.3% H₂O₂ and intrinsic biotin was deactivated with skim milk. The sections were reacted with the primary (cat. no. ab166718; Abcam) and secondary (cat. no. ab97048; Abcam) antibodies. Finally, H₂O₂ was added to DAB to undergo reaction. Sections were then stained with methyl green, and the target proteins were observed under a light microscope (magnification, ×100 and ×400).

TRIzol reagent (CWBIO) was used to isolate total RNA as determined by the manufacturer's instructions. A total of 500 ng of RNA was extracted from each sample and reverse-transcribed using the Reverse Transcription Reaction Kit (CWBIO). The relative mRNA levels of α5-nAChR, and β-actin (internal control) were determined by RT-qPCR using an FTC-3000 Real-Time PCR System. All real-time PCR assays used the SYBR Green Supermix. The cycles used for RNA amplification included a pre-denaturing step at 95°C for a duration of 10 sec, followed by 40 PCR cycles consisting of 5 sec at 95°C, 30 sec at 60°C, and 10 min at 72°C. All samples were repeatedly assayed in triplicate in each experiment. The relative amount of mRNA was determined by the comparative ΔΔCq method (18) and then normalized to the β-actin mRNA levels. The sequences of α5-nAChR primers were as follows: Forward, GACTCCACCGGCAAACTACA and reverse, TTTGCTCCCTGTTGCACTCA.

The cells were treated with PBS and subsequently lysed in RIPA buffer (Beyotime Institute of Biotechnology). Then the protein concentration was determined by the Pierce BCA Protein Assay (Thermo Fisher Scientific, Inc.). In each sample, 44 µg protein was resolved by gel electrophoresis using 15% sodium dodecyl sulfate (SDS)-polyacrylamide gels. The proteins were transferred to a PVDF membrane, and finally analyzed by western blotting. The primary antibodies against α-tubulin (cat. no. ab18251) and anti-α5-nAChR (cat. no. ab166718) (rabbit polyclonal antibody) and the secondary alkaline phosphatase-coupled anti-rabbit IgG antibody (cat. no. ab97048) were obtained from Abcam. The membranes were blocked in 5% fat-free milk in TBS containing 0.1% Tween-20 at room temperature for 1 h and subsequently incubated with primary antibodies against tubulin (1:10,000 dilution) and α5-nAChR (1:1,000 dilution) for 2 h. The membranes were further incubated with secondary antibodies (1:5,000) for 1 h. The western blot assay was repeated 3 times in order to evaluate the repeatability of the procedure. Finally, the labeled proteins were detected by chemiluminescence (ECLPlus; Amersham Pharmacia Biotech; GE Healthcare) and analyzed using ImageJ software (v1.43; National Institutes of Health).

PC3 and DU145 cells were cultured in a 96-well plate at a density of 1,000 cells/well. The cells were divided into the control (si-RNA-NC, scramble sequence) and the test groups (si-α5-nAChR). The cell proliferation assay was performed as follows: A total of 10 µl CCK-8 solution (Beijing Solarbio Science & Technology Co., Ltd.) was added to each well and the plate was incubated at 37°C for 2 h. A microplate reader was used to measure the absorbance at 450 nm.

The cell migration assay was conducted using Transwell chambers. The Transwell inserts were placed in 24 well plates (Corning, Inc.). Following treatment with either full-length α5-nAChR plasmid or α5-nAChR-specific siRNA, 5×10⁴ cells/well were placed in the upper chamber with 200 µl culture medium (RPMI-1640 medium for DU145 and Ham's F-12K for PC3). The lower chamber was filled with 600 µl of 10% FBS culture medium (RPMI-1640 medium for DU145 and Ham's F-12K for PC3). The cells were then cultured for 24 h. The outer surface was subsequently washed three times with PBS, fixed with methanol for 20 min and stained with 0.2% crystal violet for 15 min at room temperature. The images were obtained immediately after drying. The number of migrated cells were counted in five randomly microscopic fields of view (Olympus Corp.) at ×400 magnification. The experiments were repeated three times and the data were summarized.

One-Step TUNEL kit (Beyotime Institute of Biotechnology) was used following the manufacturer's recommendations. Briefly, PC3 and DU145 cells were exposed to si-RNA-NC (scramble sequence) or si-α5-nAChR for 24 h and then fixed in 4% paraformaldehyde for 10 min at room temperature. Subsequently, the cells were washed with PBS three times and permeabilized for 2 min on ice and then the cells were resuspended in TUNEL working solution. Following incubation for 1 h in a humidified atmosphere at 37°C in the dark, the cells were counterstained with DAPI staining solution for 5 min at room temperature, DAPI was used for the nuclear staining and afterwards washed with PBS. The staining solution consisted of a mixture of methanol and DAPI as follows: 1 ml methanol and 2 µl DAPI (from a stock solution of 1 mg/ml). The mounting medium was S2100 (Solarbio Science and Technology Co., Ltd.). The number of TUNEL-positive cells were counted in five randomly fluorescence microscopic fields of view. The experiments were repeated three times and the data were summarized.

The cells were transfected by siRNA targeting α5-nAChR mRNA using NanoFectin Transfection Reagent. Following 24 h of incubation, a scratch was made to the bottom of the culture dish by the tip of a glass micropipette in order to establish a clean wound area. The cultured cells were maintained in their original culture medium. The culture dish with the scratched wound was photographed at the following time-points: 0, 12 and 24 h after the wound was made.

The data were expressed as the mean ± SD and were analyzed using SPSS v17 (SPSS, Inc.). Pearson's chi-squared test was performed to examine the correlation of α5-nAChR expression with the various clinical factors. One-way ANOVA was performed to determine the differences between the experimental groups, and the least significant difference (LSD) post hoc test was used. A P-value <0.05 (P<0.05) was considered to indicate a statistically significant difference.

To investigate the expression levels of α5-nAChR in prostate cancer tissues, RT-PCR was initially used and the α5-nAChR mRNA levels were analyzed in 2 human prostate cancer cell lines. The results were compared with the human prostate epithelial cell line RWPE-1. The mRNA levels of α5-nAChR in the prostate cancer cell lines (PC3 and DU145) were higher than those noted in the normal prostate epithelial cell line (RWPE-1) (Fig. 1A). α5-nAChR protein expression was further assessed in the PC3 and DU145 cancer cell lines and in the normal prostate epithelial cell line RWPE-1 by western blotting. A similar expression pattern was noted to that observed for the mRNA expression (Fig. 1B and C).

Subsequently, IHC analysis was performed to examine the α5-nAChR expression levels in a tissue array consisting of 8 normal prostate tissues compared with those noted in 36 prostate cancer samples (Fig. 1D). The expression levels of α5-nAChR in prostate cancer tissues were increased (P=0.0384). Subsequently, the correlation between the levels of α5-nAChR expression and the clinicopathological variables of prostate cancer patients was evaluated. The expression levels of α5-nAChR were not associated with the parameters age, lymph-node metastasis and tumor diameter (Table I).

The initial experiments demonstrated that the α5-nAChR expression levels were different between prostate cancer and normal tissues. Additional experiments focused on identifying whether α5-nAChR could promote the proliferation and migration of prostate cancer cells and therefore contribute to the progression of prostate cancer. To determine the role of α5-nAChR in the biological behavior of prostate cancer cells, siRNA sequences of α5-nAChR were transfected into 3 cell lines (PC3, DU145 and RWPE-1). RT-qPCR was used to detect the transfection efficiency. si-α5-nAChR caused a significant inhibition in the expression levels of α5-nAChR in PC3, DU145 and RWPE-1 cells (Fig. 2A).

The effect of α5-nAChR on the growth of prostate cancer cells was determined using a CCK-8 assay. The proliferation of DU145 cells transfected with α5-nAChR-specific siRNA was signficantly reduced (Fig. 2B). The effects of α5-nAChR-siRNA on DU145 cell proliferation indicated successful transfection of α5-nAChR siRNA in prostate cancer cells in vitro. Clone formation assays of PC3 and DU145 cells indicated that the clone number of the si-α5-nAChR-treated cells decreased significantly compared with that of the NC cells (Fig. 2C and D).

Subsequently, the wound healing assay indicated that overexpression of α5-nAChR markedly promoted cell migration into the wound areas compared with that of the negative control (NC) cells. Downregulation of α5-nAChR by si-RNA significantly inhibited the migratory activities of DU145 cells that expressed high levels of α5-nAChR (Fig. 3A and B).

The migratory activity of the cells transfected with either full-length α5-nAChR plasmid or α5-nAChR-specific siRNA was evaluated. When the cells were transfected with the α5-nAChR vector, their migratory activity into the lower chamber was increased (Fig. 3C and D). The cells transfected with α5-nAChR-specific siRNA demonstrated reduced migratory activity into the lower chamber. This finding suggested that α5-nAChR could promote the migratory activity of the DU145 prostate cancer cells.

The induction of apoptosis was detected by the TUNEL assay. The experimental results indicated that downregulation of α5-nAChR with siRNA-α5-nAChR increased the number of apoptotic cells compared with that of the control group (P<0.05, Fig. 4A and B).

Since cleaved caspase-3 expression is positively associated with cell apoptosis, the role of α5-nAChR in cell apoptosis was detected by western blot analysis of caspase-3 and cleaved caspase-3. The expression levels of total caspase-3 and cleaved caspase-3 were determined in DU145 and PC3 cells treated with control si-RNA-NC and siRNA-α5-nAChR. Silencing of α5-nAChR expression by siRNA-α5-nAChR decreased the expression levels of total caspase-3 and increased the expression levels of cleaved caspase-3 (P<0.05) (Fig. 4C and D).

It has been revealed that upon binding to nicotine, nAChRs activate the ERK and PI3K/AKT signaling pathways in several human cancer cells. The levels of total ERK1/2 and phosphorylated ERK1/2 and levels of total AKT and phosphorylated were analyzed following transfection of DU145 and PC3 cancer cells with siRNA-α5-nAChR (Fig. 5A and B). The phosphorylation levels of p-ERK1/2 and p-AKT were significantly decreased by downregulation of α5-nAChR (Fig. 5C and D). The results indicated that phosphorylation of ERK and AKT proteins was involved in the Α5-nAChR-mediated abnormal growth of prostate cancer cells.