A549 and 293AD cells were obtained from the American Type Culture Collection (CCL-185 and CRL-1573, respectively) and were cultured according to the recommended protocols.

Oligonucleotides encoding shRNA for NUPR1 (GGAGGACCCAGGACAGGATCC) or Firefly luciferase (CGTACGCGGAATACTTCGATT) as a control were ligated into pSUPER.retro.puro, and the fragment containing the H1 promoter and hairpin sequences was subcloned into the pAAV vector (Cell Biolabs) according to the manufacturer's protocol. The production and purification of AAV were carried out as previously described (28). The AAV titer was quantified by qPCR analysis.

A549 cells were cultured in complete medium and treated with AAV particles for 48 h. Fluorescence microscopy (magnification, ×10; Olympus Corp.) was used to analyze the infection efficiency of AAV particles. The infected cells were collected for the analysis of the protein levels.

Whole cell protein extracts in 1X Laemmli buffer (Bio-Rad, cat. no. 1610737) were resolved through 15% SDS-PAGE, transferred to a nitrocellulose membrane, and probed with antibodies against human NUPR1 (cat. no. 1:1,000; Abcam), SNAP25 (cat. no. ab109105; 1:1,000; Abcam), p62 (cat. no. 7695, 1:1,000; Cell Signaling Technology), p16 (cat. no. ab108349, 1:2,000; Abcam), p21 (cat. no. 9665; 1:2,000; Cell Signaling Technology), p27 (cat. no. 9932; 1:2,000; Cell Signaling Technology) and endogenous ACTB (cat. no. A-3853; 1:3,000; Sigma-Aldrich; Merck KGaA) as a control for normalization. Peroxidase-conjugated anti-mouse (cat. no. A-10654; 1:5,000; Thermo Fisher Scientific, Inc.) and anti-rabbit IgG (cat. no. 31423; 1:5,000; Thermo Fisher Scientific, Inc.) were used as secondary antibodies. The blots were visualized on a Kodak X-ray film using an enhanced chemiluminescence (ECL) detection substrate (cat. no. 32106, Thermo Fisher Scientific, Inc.). ImageJ software (version 1.0; National Institutes of Health) was used to quantify the intensities of band signals, which were normalized to the ACTB internal controls.

Animal care and surgical procedures were approved by Tianjin Medical University and carried out in accordance with the Institutional Animal Care and Use Committee guidelines (Tianjin Medical University, permission no. SYXK: 2016-0012). A total of 16 male Fox Chase severe combined immunodeficient (SCID) mice were housed at 18°C and supplied with water and laboratory chow. The SCID mice were subjected to subcutaneous injections of A549 cells (1.0×10⁶ cells) in Matrigel (50:50) into the lower flank. Ten days following tumor inoculation, the mice were randomly divided into four groups and received tail vein injections of AAV-iNUPR1, AAV-control (1×10¹¹ vg/mouse), TFP, or saline. To evaluate the effect of AAV and TFP treatment on tumor growth, tumor volume was measured at the indicated time points using a scaled ruler. After anesthetized by intraperitoneal injection with 10% chloral hydrate (300 mg/kg body weight), the mice were sacrificed by cervical dislocation. Death was confirmed when the mice did not move, and then tumor tissues were collected and weighed immediately, followed by fixation in buffered formalin for histological and immunohistochemical analyses.

Tumor tissue obtained from the animals was washed with PBS and fixed with PBS containing 3% glutaraldehyde and 2% paraformaldehyde (cat. nos. 340855 and P6148, respectively; Sigma-Aldrich; Merck KGaA) (pH 7.3) for 2 h at room temperature. Following fixation, the samples were washed with PBS and post-fixed with 1% buffered osmium tetroxide (cat. no. 75632, Sigma-Aldrich; Merck KGaA) for 30 min at room temperature and stained en bloc with 1% uranyl acetate (cat. no. 19481, Ted Pella, Inc.). The samples were dehydrated in increasing concentrations of ethanol, embedded in EMbed 812 medium (cat. no. 14120, Electron Microscopy Sciences) and polymerized at 70°C for 2 days. Ultrathin sections were cut using a Leica Ultracut microtome (Leica), stained with uranyl acetate and lead citrate in a Leica EM Stainer and examined using a JEM 1010 transmission electron microscope (JEOL) at an accelerating voltage of 80 kV. Digital TEM images were acquired using an AMT Imaging System (Advanced Microscopy Techniques).

Fresh tumor tissue was frozen in liquid nitrogen following resection and processed for embedding in O.C.T. compound. Tissue sections (5-µm-thick) were collected and processed for GLB1 staining. GLB1 staining was performed using a Senescence β-Galactosidase Staining kit (cat. no. 9860, Cell Signaling Technology) according to the manufacturer's protocol. Micrographs were acquired under a light microscope (Nikon Eclipse Ti-U, Nikon Instruments). Positive results for GLB1 staining were calculated using Photoshop CS6 software (Adobe Systems).

Tumor tissue obtained from the animals was fixed in formalin for 24 h at room temperature and incubated in 70% ethanol for 48 h before being embedded in paraffin. The embedded tumors were cut into 5-µm-thick sections, mounted on poly-L-lysine-coated slides and then stained with hematoxylin and eosin (H&E) to analyze the tumor histology. Immunohistochemical staining was carried out as previously described (9). Cell proliferation was analyzed using antibodies against Ki67 (Cell Signaling Technology, 1:400 dilution). Images were acquired with a CCD camera (Coolsnap ES, Roper Scientific) equipped with Metamorph software (Molecular Devices).

In this study, data were evaluated using SPSS version 22.0 statistical software (IBM Corp.) and analyzed using an unpaired two-tailed t-test or repeated measures analysis of variance. Differences were considered statistically significant at P<0.05.

To verify the effects of AAV-NUPR1 shRNA on the expression of NUPR1, AAV-control (cont), 4, 20, 40 and 200 vg/cell of the AAV-based vector containing NUPR1 shRNA were used to infect A549 cells. Western blot analysis demonstrated that AAV-NUPR1 shRNA decreased the NUPR1 protein expression levels in A549 cells (Fig. 1A and B) in a dose-dependent manner. These data indicated that AAV-delivered shRNA significantly decreased NUPR1 protein expression levels in vitro.

Since it has already been verified that the downregulation of NUPR1 impairs tumor cell autophagy (9), this study then examined the expression of synaptosome associated protein 25 (SNAP25), sequestosome 1 (SQSTM1/p62) and microtubule-associated protein 1 light chain 3B (MAP1LC3B/LC3B) in A549 cells by western blot analysis to confirm its biological effects. As expected, NUPR1 depletion by the AAV system decreased the SNAP25 protein expression level and increased LC3B-I to LC3B-II conversion; all these effects were enhanced by treatment with Torin 1 (an mTOR inhibitor and autophagy inducer) (Fig. 2A), consistent with previous findings. We then examined key cell cycle inhibitors (p16, p21 and p27) by western blot analysis. AAV-mediated NUPR1 shRNA treatment resulted in the upregulation of p21 and p27 expression, but not p16 expression (Fig. 2B), which is a deleted mutation in A549 cells. As expected, AAV-mediated NUPR1 depletion in A549 cells led to a significant increase in the number of GLB1-positive cells (Fig. 2C). These data indicated that AAV-mediated NUPR1 shRNA impaired tumor cell autophagy, leading to premature senescence in vitro.

TFP, an antipsychotic drug, has been shown to act as a potent NUPR1 inhibitor, exerting antitumor effects (29). Subsequently, in this study, the effect of AAV-mediated NUPR1 shRNA combined with TFP was assessed on tumorigenesis in vivo, hypothesizing that TFP enhances antitumor activity by NUPR1 depletion. A subcutaneous model was employed to analyze the application potential of TFP and AAV-NUPR1 shRNA. A549 cells were subcutaneously injected into athymic nude mice. At 10 days following tumor cell inoculation, all the cells formed visible xenograft tumors. The mice were then randomly divided into four groups and received tail vein injections of AAV-NUPR1 shRNA, AAV-control (1×10¹¹ vg/mouse), TFP, or saline as a control. The tumor volumes in the AAV-NUPR1 shRNA/TFP-single-treated or double-treated groups were significantly smaller than those in the control group, and the tumor volumes of the double-treated group were the smallest among all the groups (Fig. 3A). Consistent with the tumor volume, the tumor weight and size in the AAV-NUPR1 shRNA- and TFP-injected group were the most reduced compared with the other groups (Fig. 3B and C). There was no significant difference in tumor volume, weight and size between single therapy and combination therapy; however, combination therapy still exerted more beneficial tumor-suppressive effects, which was useful in reducing the dose of the NUPR1 shRNA virus. Both the tumor volume and weight were significantly decreased by combination treatment (Fig. 3A-C).

To investigate whether the AAV-mediated downregulation of NUPR1 has the same effect in vivo as in vitro, histological examinations confirmed the decrease in the tumor volume in the AAV-NUPR1 shRNA- and TFP-injected groups, with a high cell death rate and substantially decreased numbers of scattered tumor cells (Fig. 4A). Evidence to support this phenomenon was also provided by transmission electron micrographs exhibiting significantly increased autolysosomal vacuole formation upon AAV-NUPR1 shRNA and TFP treatment on day 27 (Fig. 4B). This phenomenon that has been previously described (9) is caused by impaired autolysosomal processing, which is not favorable in cancer cells. Immunohistochemical analyses confirmed that the NUPR1 expression level was decreased at 27 days following the injection of AAV-NUPR1 shRNA or TFP, which was not observed in the control tumors. Moreover, significant decreases in the NUPR1 expression level and in the number of cells positive for Ki67 were observed, which is a marker of cell proliferation, in the AAV-NUPR1 shRNA and TFP-treated groups compared with the control group (Fig. 4C); no significant difference was observed between single therapy and combination therapy. Subsequently, whether AAV-NUPR1 shRNA causes premature senescence in lung tumor xenografts was assessed. As shown in the data summary (Fig. 4D), the AAV-NUPR1 shRNA-treated group and the combined AAV-NUPR1 shRNA- and-TFP treated group exhibited significantly more GLB1-stained cells than the other two groups, suggesting that AAV-NUPR1 shRNA triggers premature senescence in xenograft lung tumors. It is noteworthy that the number of GLB-positive cells in the NUPR1 shRNA-treated group was increased compared to that in the combination therapy group. However, the tumor weight and size in the combination therapy group were more greatly reduced compared with those in the NUPR1 shRNA-treated group, suggesting that TFP may mediate non-senescence cell death to impair lung tumor growth. The exact function of TFP in tumors is not yet clear. The results of this study indicated that it can interfere with the premature senescence mediated by NUPR1 shRNA treatment; however, this warrants further investigation. Overall, the results of this study indicated that AAV-NUPR1 shRNA efficiently decreased A549 ×enograft tumor cell proliferation, impaired autophagy, caused premature senescence and further inhibited the growth of tumor xenografts in nude mice; TFP enhanced all these effects, apart from premature senescence. The combination of AAV-NUPR1 shRNA and TFP treatment is effective in inhibiting the growth of xenograft tumors.