A total of 20 paired CRC and adjacent normal tissue specimens were obtained from the Department of General Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology. The tissue samples were frozen in liquid nitrogen immediately following surgical removal and stored at −80°C until used. The study protocol was approved by the Ethics Committee of Tongji Medical College, Huazhong University of Science and Technology (IORG no. IORG0003571) and written informed consent was obtained from each participant. The human CRC HT-29, HCT-116, SW480 and SW620 cell lines, and the normal colonic FHC cell line, were obtained from American Type Culture Collection. The HT-29 cell line used in our study has been authenticated using the method of STR profiling. All cell lines were maintained under the recommended culture conditions and incubated in a humidified environment with 5% CO₂ at 37°C. The gain-of-function study of miR-663b was conducted with miR-663b mimics (100 nM) and corresponding negative control (100 nM) on the SW480 cell line. The loss-of-function assay was conducted with miR-663b inhibitor (100 nM) and corresponding negative control (100 nM) on the HCT-116 cell line. miR-663b mimics, miR-663b inhibitors and the corresponding negative control were purchased from Shanghai GenePharma Co., Ltd. The sequences of the miR-663b mimic and the inhibitor were as follows: GGUGGCCCGGCCGUGCCUGAGG and CCUCAGGCACGGCCGGGCCACC, respectively. All assays were performed using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Subsequent experimentations were performed 48 h-post transfection.

All the oligoribonucleotides used in the present study were purchased from Shanghai GenePharma Co., Ltd. (Table I). The small interfering (si)RNA targeting human adenomatous polyposis coli 2 (APC2) transcript was designated as siAPC2.

Total RNA was isolated from the cells using TRIzol^® reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. RT-qPCR was performed to evaluate the expression of miR-663b and APC2 mRNA in SW480 and HCT-116 cells. RNA was reverse transcribed using One Step PrimeScript miRNA cDNA Synthesis kit (Takara Bio, Inc.). cDNA was subsequently quantified via qPCR using SYBR Premix Ex Taq (Takara Bio, Inc.). All PCR reactions were performed using the ABI7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: Initial denaturation at 95°C for 5 min; 40 cycles of 95°C for 15 sec; annealing/elongation at 60°C for 30 sec and a final extension at 72°C for 30 sec. The relative expression levels of miR-663b and APC2 mRNA were quantified using the 2^−ΔΔCq method (16) and normalized to small nuclear RNA U6 and GAPDH, respectively.

Protein was prepared from transfected SW480 and HCT-116 cells using modified RIPA lysis buffer supplemented with proteinase inhibitor cocktail (Sangon Biotech Co, Ltd.). Protein concentrations were measured according to the BCA protein assay kit (Beyotime Institute of Biotechnology). Equal protein amounts (30-50 µg) were separated in 10% SDS-PAGE gels and transferred onto polyvinylidene fluoride membranes. The membranes were blocked with 5% non-fat milk for 1 h at room temperature, prior to incubation overnight at 4°C with the following primary antibodies: Anti-APC2 (cat. no. 12301), anti-c-Myc (cat. no. 9402), anti-phospho-β-catenin (Ser552; cat. no. 9566), anti-phospho-β-catenin (Ser675; cat. no. 9567), anti-β-catenin (cat. no. 9562), anti-cyclin D1 (cat. no. 2922), anti-axin1 (cat. no. 2087) and anti-β-actin (cat. no. 4970) (all 1:1,000 and all from Cell Signaling Technology, Inc.). The membranes were subsequently washed 3 times in 10 ml TBS + 0.2% Tween-20 and incubated with the corresponding horseradish peroxidase-conjugated secondary antibody (1:5,000; cat. no. D110291; Sangon Biotech Co., Ltd.) for 1 h at room temperature. Secondary antibody binding to the primary antibody was detected using an enhanced chemiluminescence system (Pierce; Thermo Fisher Scientific, Inc.). All experiments were performed in triplicate.

SW480 and HCT-116 cells seeded at a density of 4,000 cells/well in 96-well plates were transfected with miR-663b mimic/miR-663b inhibitor or corresponding NC. Following incubation of the cells for the specified time (1, 2, 3 or 4 days), a Cell Counting Kit-8 assay was performed according to the manufacturer's protocol (Dojindo Molecular Technologies, Inc.). The absorbance of the solution was measured spectrophotometrically at 450 nm with MRX II absorbance reader (Dynex Technologies). All experiments were performed in triplicate.

The migration of SW480 or HCT-116 cells was assessed via the wound healing assay. A total of 5×10⁵ cells were seeded into 6-well plates and cultured in DMEM medium (Sangon Biotech Co, Ltd.) at 37°C in 5% CO₂ until they reached ~100% confluence. Subsequently, artificial wounds were created by scratching the cell monolayer with a sterile pipette tip. Following wounding, cells were washed three times with PBS to remove floating cells and debris, and subsequently incubated in serum-free medium at 37°C in 5% CO₂. Representative images with cells migrating into the wounds were randomly captured using an inverted light microscope (magnification, ×40). The experiments were performed in triplicate.

Transwell membranes (Corning, Inc.) coated with Matrigel (BD Biosciences, USA) were used to assay cell invasion in vitro. A total of 1.0×10⁵ transfected cells suspended in serum-free medium were added to the upper chamber, and medium supplemented with 10% FBS (Sangon Biotech Co., Ltd.) was added to the lower chamber as a chemoattractant. After 24 h of incubation at 37°C, the invading cells were fixed with 4% paraformaldehyde for 30 min, followed by staining with 0.1% crystal violet solution for 20 min, both at room temperature. Subsequently, each well was captured using an inverted light microscope (magnification, ×100). Data were obtained from three independent experiments.

An Annexin V-fluorescein isothiocyanate (FITC) Apoptosis Detection Kit (Beyotime Institute of Biotechnology) was used to analyze the cell apoptosis rate according to the manufacturer's instructions. Following transfection for 72 h, the cells were harvested and stained in binding buffer with 5 µl of Annexin V-FITC for 10 min at room temperature. Following incubation with 5 µl of propidium iodide for 20 min at 4°C, the cell apoptosis rate was analyzed via flow cytometry (FACScan; BD Biosciences). BD FACSDiva™ software (version 6.1.3) was used to analyze the flow cytometry data. The experiments were performed in triplicate.

APC2 was predicted to be the target candidate gene of miR-663b according to TargetScan databases (version 7.2) (17–21). The 3′UTR fragment of APC2 containing the putative wild-type (wt) sequence was amplified by PCR. The amplified product was inserted into the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega Corporation). The QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene; Agilent Technologies, Inc.) was used to construct the miR-663b binding site mutants according to the manufacturer's protocol. These constructs were named pmirGLO-APC2-wt and pmirGLO-APC2-mutant (mut), respectively. SW480 cells were plated into 24-well plates at a density of ~2×10⁵ cells/well, cultured until they reached ~70% confluence and co-transfected with either miR-663b mimic or NC and pmirGLO-APC2-wt or pmirGLO-APC2-mut using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Transfected cells were collected after 48 h of incubation, and the luciferase activity was measured by a Dual-Luciferase Reporter Assay System (Promega Corporation) in accordance with the manufacturer's protocol. The relative luciferase activity, normalized using Renilla luciferase, was measured 48 h after transfection. All experiments were performed in triplicate.

Experimental data are presented as mean ± standard deviation. All data were analyzed using one-way ANOVA or Student's t-test. Multiple comparisons between the groups were performed using Tukey's post hoc test. SPSS software v.18.0 (SPSS, Inc.) was used for all data analyses. P<0.05 was considered to indicate a statistically significant difference.

To validate the expression of miR-663b in CRC tissues, the expression level of miR-663b was detected in 20 paired CRC tissue specimens and adjacent normal tissues. The results revealed that miR-663b expression was significantly increased in CRC tissues compared with that in adjacent normal tissues (Fig. 1A). To further investigate the expression pattern of miR-663b in CRC cells, RT-qPCR was performed to measure the expression of miR-663b in 4 CRC cell lines and the normal colonic cell line FHC. It was observed that miR-663b was markedly upregulated in all 4 CRC cell lines compared with FHC cells (Fig. 1A). These data suggest that the abnormal expression of miR-663b may be involved in tumorigenesis of human CRC. As the expression level of miR-663B was the lowest in SW480 and highest in HCT-116 among 4 CRC cell lines, the SW480 and HCT-116 cells were selected for the subsequent gain/loss-of-function studies and investigation of the underlying mechanism.

The overexpression miR-663b in CRC tissues and cells suggested that miR-663b may serve as an oncogene in CRC. To investigate the biological function of miR-663b, its effect on the proliferation of CRC cells was examined using a CCK-8 assay. miR-663b expression was measured using RT-qPCR to confirm the transfection efficiency of ectopic miR-663b mimic or inhibitor (Fig. 1B). It was demonstrated that ectopic miR-663b expression markedly increased the proliferation of SW480 cells (Fig. 2A), while miR-663b knockdown decreased the proliferation of HCT-116 cells at 3 and 4 days after transfection (Fig. 2B).

Following transfection of miR-663b mimic or inhibitor for 72 h, CRC cell apoptosis was analyzed using flow cytometry. The apoptotic rate was significantly decreased in the miR-663b mimic-transfected group compared with the miR-NC group (Fig. 2C). Additionally, the apoptotic rate in the miR-663b inhibitor group was increased compared with that in the corresponding NC group (Fig. 2D). These results confirmed the anti-apoptotic effect of miR-663b on CRC cells.

To evaluate the role of miR-663b in cancer cell migration and invasion, wound healing and Transwell assays were performed. It was observed that the ectopic expression of miR-663b promoted SW480 cell migration (Fig. 3A), whereas miR-663b inhibitor decreased HCT-116 cell migration (Fig. 3B). In addition, the invasion assay suggested that ectopic miR-663b expression markedly promoted the invasion capacity of SW480 cells (Fig. 4A), while miR-663b knockdown inhibited invasion of HCT-116 cells (Fig. 4B). These results indicated that miR-663b may be involved in CRC progression by promoting cell migration and invasion.

To elucidate the molecular mechanism by which miR-663b promotes cancer cell proliferation and invasion, its target gene was further investigated. APC2, a negative invasion-associated regulator in the Wnt/β-catenin signaling pathway, was selected as the candidate target. A seed sequence of miR-663b was bound to the putative 3′UTR of APC2 (Fig. 5A). First, a dual-luciferase reporter system was employed to confirm whether APC2 is a target of miR-663b. PmirGLO-APC2-wt or pmirGLO-APC2-mut was co-transfected with either miR-NC or miR-663b mimic in SW480 cells. It was observed that ectopic miR-663b significantly inhibited the firefly luciferase activity of PmirGLO-APC2-wt but not pmirGLO-APC2-mut (Fig. 5B), suggesting that APC2 is a direct target of miR-663b.

In addition, to further validate that APC2 is the target of miR-663b, western blot analysis and RT-qPCR analysis were performed to evaluate the effect of miR-663b on endogenous APC2 expression at the protein and mRNA level. The results demonstrated that the miR-663b inhibited the expression of the APC2 protein in SW480 cells and that the miR-663b inhibitor upregulated the APC2 level in HCT-116 cells (Fig. 5C). However, miR-663b overexpression did not decrease the APC2 mRNA level (P>0.05; Fig. 5D), indicating that miR-663b downregulates APC2 expression at the post-transcriptional level. Taken together, these data suggest that miR-663b may downregulate the expression of APC2 by directly targeting its 3′UTR.

Further experiments were conducted to explore the molecular mechanisms by which miR-663b promotes cell invasion by regulating APC2. The effect of APC2 knockdown on invasion was investigated. The expression of the APC2 protein was identified to be markedly downregulated in siAPC2-transfected SW480 cells (Fig. 3D). The data suggested that the knockdown of APC2 promoted CRC cell migration and invasion (Figs. 3C and 4C), eliciting the same effect as miR-663b overexpression.

Previous evidence has demonstrated that the Wnt/β-catenin signaling pathway is associated with tumor growth and invasion (22). Therefore, the effect of miR-663b on the key molecules of the Wnt/β-catenin pathway was investigated. It was observed that ectopic miR-663b expression promoted the expression of MYC proto-oncogene protein (c-Myc) and cyclin D1 protein in SW480 cells (Fig. 6A). In addition, the ectopic expression of miR-663b lowered the protein level of phosphorylated β-catenin. However, there was little effect on the endogenous expression of axin 1 or total β-catenin protein observed (Fig. 6A).

Collectively, these results suggest that miR-663b may promote cell migration and invasion in CRC through activating the Wnt/β-catenin pathway (Fig. 6B).