Long-term and high-dose glucocorticoid treatment is recognized as an important influencing factor for osteoporosis and osteonecrosis. Nicotinamide mononucleotide (NMN) is an intermediate of NAD+ biosynthesis, and is widely used to replenish the levels of NAD+. However, the potential role of NMN in glucocorticoid-induced osteogenic inhibition remains to be demonstrated. In the present study, the protective effects of NMN on dexamethasone (Dex)-induced osteogenic inhibition, and its underlying mechanisms, were investigated. Bone mesenchymal stem cells were treated with Dex, which decreased the levels of the osteogenic markers alkaline phosphatase, Runt-related transcription factor 2 and osteocalcin. NMN treatment attenuated Dex-induced osteogenic inhibition and promoted the expression of sirtuin 1 (SIRT1) and peroxisome proliferator-activated receptor gamma coactivator (PGC)-1α. SIRT1 knockdown reversed the protective effects of NMN and reduced the expression levels of PGC-1α. Collectively, the results of the present study reveal that NMN may be a potential therapeutic target for glucocorticoid-induced osteoporosis.
Osteoporosis is a chronic disease with a heavy global socioeconomic burden. It is defined as a skeletal disorder, characterized by decreased bone strength, which in turn predisposes affected individuals to fractures (
Nicotinamide mononucleotide (NMN) is an important NAD+ intermediate whose levels decrease with age. As such, NMN administration is an effective treatment for age-related diseases and bone metabolism (
SIRT1, also known as silent mating type information regulation 2 homolog, was discovered in humans in 1999 (
In the present study, the effects of NMN on glucocorticoid-induced loss of bone cell viability, and its underlying mechanisms, underwent preliminary investigation. It was hypothesized that NMN plays a protective role in glucocorticoid-induced osteoporosis, and the present study provides a potential therapeutic method for glucocorticoid-induced osteoporosis.
Bone mesenchymal stem cells (BMSCs) at passage 6 were obtained from Cyagen Biosciences, Inc. The cells were cultured in C57BL/6 Mouse Mesenchymal Stem Cell growth medium (Cyagen Biosciences, Inc.) containing 10% FBS, 1% glutamine and 1% penicillin-streptomycin, and incubated at 37°C in a humidified atmosphere (5% CO2). For osteogenic induction, BMSCs were seeded into 6-well plates at a density of 2×105 cells per well. The culture medium was substituted for C57BL/6 Mouse Mesenchymal Stem Cell osteogenic differentiation medium (Cyagen Biosciences, Inc.; 10% FBS, 1% penicillin-streptomycin, 0.2% ascorbate, 1% glutamine, 10−10 M Dex and 10 mM ß-glycerophosphate), and the cells were incubated until reaching 80% confluence. The negative control group was incubated in osteogenic differentiation medium supplemented with 10−10 M Dex. For subsequent experiments, BMSCs were used between passages 7 and 10. The osteogenic induction medium was replaced every 3 days. After incubation for 7 days, subsequent experiments were performed.
BMSCs were treated with 1, 5 or 10 mM NMN (cat. No. 1094-61-7) for 7 days. The vehicle group was cultured with osteogenic differentiation medium for 7 days. The Dex groups were cultured with osteogenic differentiation medium containing 10−6 M Dex for 7 days. The NMN groups were cultured with osteogenic differentiation medium containing 10−6 M Dex and 1, 5 or 10 mM NMN for 7 days.
SIRT1-small interfering (si)RNA and their negative control (NC) siRNA were purchased from Shanghai GenePharma Co., Ltd. BMSCs were transfected with 5 µl SIRT1 siRNA (si-SIRT1: 5′-CCACCUGAGUUGGAUGAUA-3′; 20 µM) or NC siRNA (5′-ACGUGACACGUUCGGAGAATT-3′; 20 µM) were transfected into BMSCs using Lipofectamine® RNAi Max reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. After 48 h, the effect of knockdown was confirmed by reverse transcription-quantitative PCR (RT-qPCR) and western blotting.
Total RNA was isolated from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and quantified using an absorbance measurement at a wavelength of 260 nm. The RNA was reverse-transcribed into cDNA using a SYBR® PrimeScript™ RT-PCR kit (Takara Bio, Inc.) The specific primers for mouse ALP, Runt-related transcription factor 2 (Runx2), osteocalcin (OCN), SIRT1 and peroxisome proliferator-activated receptor gamma coactivator (PGC)-1α are listed in
For nuclear and cytoplasmic proteins, the Nuclear and Cytoplasmic Protein Extraction kit (Beyotime Institute of Biotechnology) with 1% Triton X-100 (Beyotime Institute of Biotechnology) was added to cells in order to solubilize plasma membrane and keep the nuclear membrane intact. The supernatant was incubated at 4°C for 20 min, and then 500 µl nuclear isolation buffer was added. Next, homogenates were centrifuged at 600 × g (10 min, 4°C) for separation into the supernatant cytosolic fraction and pellet nuclear fraction. Proteins were then lysed using RIPA lysis buffer (Beyotime Institute of Biotechnology) (
Following osteogenic induction, BMSCs were washed three times with PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. Alizarin working solution (1%; 1 g Alizarin diluted in aqueous solution; Cyagen Biosciences, Inc.) was used to perform Alizarin staining for 3–5 min, and a 5-bromo, 4-chloro, 3-indolylphosphate/Nitro-Blue Tetrazolium ALP Color Development kit (Beijing Leagene Biotechnology, Co., Ltd.) was used to perform ALP staining as previously described (
Cell viability was assessed using a Cell Counting Kit-8 (CCK-8) assay (Beyotime Institute of Biotechnology), according to the manufacturer's protocol. BMSCs were cultured and induced in 96-well plates at density of 5×103 cells/well for 7 days. Subsequently, 10 µl CCK-8 solution was added to each well and cultured for 1 h. The optical density of each well at a wavelength of 450 nm was measured using a microplate reader and analyzed using GraphPad Prism software (version 8.0; GraphPad Software, Inc.).
After osteogenic induction, BMSCs were harvested and lysed with RIPA lysis buffer (Beyotime Institute of Biotechnology). Following centrifugation at 18407 × g at 4°C for 10 min, the lysate supernatants were collected and added to 96-well plates. ALP activity was detected with the ALP Assay kit (Beyotime Institute of Biotechnology) using the p-nitrophenylphosphate method, according to the manufacturer's instructions. The cells were incubated at 37°C for 30 min, and absorbance was measured with a microplate reader (Omega Bio-Tek, Inc.) at 405 nm. The ALP level was normalized to the total protein content, and ALP activity was demonstrated as a fold change over the corresponding control group.
After osteogenic induction and treatment, BMSCs were washed with PBS and then fixed in 4% paraformaldehyde for 15 min at room temperature. The cells were permeabilized with 0.1% Triton-X 100 in PBS for 10 min. After blocking with 5% BSA (Sigma-Aldrich; Merck KGaA) for 1 h at room temperature, the cells were incubated with primary antibodies against SIRT1 (Abcam; cat. no. ab110304, 1:2,000) and PCNA (Abcam; cat. no. ab92552, 1:500) at 4°C overnight. The cells were then incubated with DAPI, Alexa Fluor® 488-AffiniPure goat anti-mouse IgG [H+L (Jackson ImmunoResearch Europe, Ltd.; cat. no. 115-545-003, 1:200] and Cy3- AffiniPure goat anti-rabbit IgG [H+L (Jackson ImmunoResearch Europe, Ltd.; cat. no. 111-165-003, 1:200)] at room temperature for 1 h. Images of cells were captured using a fluorescence microscope (Olympus Corporation; magnification, ×1,000).
All independent experiments were performed ≥3 times and the data are presented as the mean ± SEM. Statistical differences were analyzed using a student's t-test or one-way ANOVA followed by Tukey's multiple comparison post hoc test. Statistical analysis was carried out using Prism 8 (GraphPad Software, Inc.), and P<0.05 was considered to indicate a statistically significant difference.
A number of studies have reported that glucocorticoid treatment can suppress the osteogenic function of osteoblasts, and lead to osteoporosis and osteonecrosis (
A recent study demonstrated that NMN could improve osteogenesis and reduce the adipogenesis of BMSCs in aging bone marrow (
SIRT1 is considered to be an important regulator of cellular metabolism. Numerous studies have suggested that NMN protects cells from stress stimuli, such as oxidative stress, aging and toxicity stress, by regulating SIRT1 (
To further investigate whether NMN enhanced the osteogenic ability of Dex-treated BMSCs, siRNA was used to inhibit SIRT1 expression. Firstly, the silencing effects of si-SIRT1 were determined by RT-qPCR. SIRT1 mRNA expression was decreased in BMSCs transfected with si-SIRT1, compared with si-NC (
BMSCs possess the potential to differentiate into osteoblasts, a process that can be suppressed by glucocorticoid use (
The present study suggested NMN as a potential therapeutic target for Dex-induced inhibition of osteogenesis, and that SIRT1 was an important downstream target of NMN. The expression of BMSC osteogenic markers was decreased following exposure to Dex (range, 10−9−10−6 M); these included ALP, Runx2 and OCN. ALP staining and alizarin red staining also confirmed above results. These results suggest that Dex, as a glucocorticoid, can inhibit the differentiation and osteogenesis of BMSCs.
Various studies have demonstrated that the administration of NMN significantly increases the intracellular levels of NAD+. Much evidence has also confirmed that intracellular NAD+ is closely associated with bone diseases. Li
A previous study found that in aged bone marrow, NMN improved osteogenesis and reduced adipogenesis by regulating MSCs via the SIRT1 pathway (
To further confirm the role of SIRT1 in this process, si-SIRT1 was used to knock down SIRT1, which inhibited the protective effect of NMN in glucocorticoid-induced osteogenic inhibition. Knockdown of SIRT1 was found to reduce the expression of the osteogenic markers that were increased with NMN treatment. Alizarin red and ALP staining also confirmed the importance of SIRT1 in the protective effect of NMN in Dex-treated BMSCs. Importantly, SIRT1 knockdown was able to reduce the protein expression of PGC-1α improved by NMN treatment in BMSCs exposed to Dex. Together, these results suggest that NMN attenuates Dex-induced osteogenic inhibition by regulating the SIRT1/PGC-1α signaling pathway, and that SIRT1 regulates this process through improving the protein expression of PGC-1α rather than PGC-1α mRNA (
Song
In conclusion, the results of the present study show that Dex is capable of inhibiting the differentiation and mineralization of BMSCs. Moreover, NMN can alleviate Dex-induced osteogenic inhibition by regulating SIRT1/PGC-1α expression. These findings provide a novel mechanism to improve the understanding of glucocorticoid-induced osteogenic inhibition, and indicate that NMN may be a potential therapeutic target.
The authors would like to thank Professor Yan Jiang (The Second Affiliated Hospital of Nanchang University) for provided suggestions regarding experimental design and article writing.
No funding was received.
All data generated or analyzed during the present study are included in this published article.
RH performed the experiments and collected the data. JT designed the study, analyzed the data and drafted the manuscript. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Dex-induced osteogenic inhibition in BMSCs. BMSCs were exposed to Dex (range, 10−9−10−6 M) for 7 days. (A) Reverse transcription-quantitative PCR was used to detect Runx2, ALP and OCN mRNA expression in BMSCs. (B) Western blotting was used to determine the Runx2 and ALP protein expression levels in BMSCs. (C) Relative ALP activity. (D) Cell Counting Kit-8 was used to assess the viability of BMSCs. (E) Alizarin red and ALP staining assays were used to measure the osteogenic function of BMSCs treated with 10−6 M Dex for 7 days. Scale bar, 20 µm. (F) Relative ALP activity of BMSCs treated with 10−6 M Dex for 7 days. All experiments were performed ≥3 times. ***P<0.001, **P<0.01, *P<0.05 and nsP≥0.05 vs. Veh. Dex, dexamethasone; BMSCs, bone mesenchymal stem cells; ALP, alkaline phosphatase; Runx2, Runt-related transcription factor 2; OCN, osteocalcin; Veh, vehicle.
Role of NMN in Dex-induced osteogenic inhibition of BMSCs. BMSCs were exposed to 10−5 M Dex and NMN (1, 5 and 10 mM). (A) Reverse transcription-quantitative PCR was used to detect Runx2, ALP and OCN mRNA expression in BMSCs. (B) Western blotting was used to determine the Runx2 and ALP protein expression levels in BMSCs. (C) Alizarin red and ALP staining assays were used to assess the osteogenic function of BMSCs treated with 10−5 M Dex for 7 days. Scale bar=20 µm. All experiments were performed ≥3 times. P<0.05 was considered to indicate a statistically significant difference. ***P<0.001 and **P<0.01, as indicated. NMN, nicotinamide mononucleotide; Dex, dexamethasone; BMSC, bone mesenchymal stem cells; ALP, alkaline phosphatase; Runx2, Runt-related transcription factor 2; OCN, osteocalcin.
SIRT1/PGC-1α signaling is involved in the protective effects of NMN on Dex-induced osteogenic inhibition. BMSCs were treated with control, Dex and Dex + NMN for 7 days. (A) Reverse transcription-quantitative PCR was used to detect the SIRT1, PGC-1α, Runx2 and ALP mRNA expression levels in BMSCs. (B) Western blotting was used to determine the SIRT1, PGC-1α, Runx2 and ALP protein expression levels in BMSCs. (C) Relative ALP activity. (D) Immunofluorescence was used to detect SIRT1 protein expression in BMSCs following 2 days of treatment. Scale bar, 5 µm. All experiments were performed ≥3 times. ***P<0.001 and **P<0.01, as indicated. SIRT1, sirtuin 1; PGC, peroxisome proliferator-activated receptor gamma coactivator; NMN, nicotinamide mononucleotide; Dex, dexamethasone; BMSC, bone mesenchymal stem cells; ALP, alkaline phosphatase; Runx2, Runt-related transcription factor 2.
SIRT1 knockdown reduces the protective effects of NMN on Dex-induced osteogenic inhibition. Si-NC or si-SIRT1 were transfected into BMSCs before Dex and NMN treatment. SIRT1-knockdown was confirmed by (A) RT-qPCR and (B) western blotting. (C) RT-qPCR was used to detect the SIRT1, PGC-1α and Runx2 mRNA expression levels in BMSCs. (D) Western blotting assays were used to determine the SIRT1, PGC-1α, ALP and Runx2 protein expression levels in BMSCs. (E) Alizarin red and ALP staining assays were used to assess the osteogenic ability of BMSCs. Scale bar, 20 µm. All experiments were performed ≥3 times. ***P<0.001, **P<0.01 *P<0.05 and nsP≥0.05, as indicated. Si, small interfering; NC, negative control; NMN, nicotinamide mononucleotide; Dex, dexamethasone; BMSC, bone mesenchymal stem cells; SIRT1, sirtuin 1; PGC, peroxisome proliferator-activated receptor gamma coactivator; ALP, alkaline phosphatase; Runx2, runt-related transcription factor 2; RT-qPCR, reverse transcription-quantitative PCR.
NMN alleviates Dex-induced osteogenesis by regulating the SIRT1/PGC-1α signaling pathway. NMN, nicotinamide mononucleotide; Dex, dexamethasone; SIRT1, sirtuin 1; PGC, peroxisome proliferator-activated receptor gamma coactivator.
Study characteristics.
Study | Type | Primary findings | (Refs.) |
---|---|---|---|
Song |
Research | NMN promotes osteogenesis via SIRT1 | ( |
Zainabadi, 2019 | Review | NMN improve osteogenesis | ( |
Liang |
Research | NMN alleviates aluminum-induced bone loss by inhibiting the thioredoxin-interacting protein-NLRP3 inflammasome | ( |
Hassan |
Research | Nicotinamide phosphoribosyltransferase expression in osteoblasts controls osteoclast recruitment in alveolar bone remodeling | ( |
Mills |
Research | Long-term NMN administration significantly improves bone density | ( |
Baek |
Research | Nicotinamide phosphoribosyltransferase inhibits receptor activator of nuclear factor-κB ligand-induced osteoclast differentiation |
( |
Abed |
Research | Low SIRT1 levels in human osteoarthritis subchondral osteoblasts lead to abnormal sclerostin expression which decreases Wnt/β-catenin activity | ( |
NMN, nicotinamide mononucleotide; SIRT1, sirtuin 1; NLRP3, nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3.
Primers used for qPCR.
Primer sequence (5′→3′) | ||
---|---|---|
Gene | Forward | Reverse |
Runx2 | GACGAGGCAAGAGTTTCACC | GGACCGTCCACTGTCACTTT |
ALP | TCGGGACTGGTACTCGGATAAC | GTTCAGTGCGGTTCCAGACATAG |
OCN | CAAGCAGGGAGGCAATAAGG | CGTCACAAGCAGGGTTAAGCQ |
SIRT1 | CACATGCCAGAGTCCAAGTT | AAATCCAGA TCCTCCAGCAC |
PGC-1α | AACCACACCCACAGGATCAGA | TCTTCGCTTTATTGCTCCATGA |
GAPDH | AGGAGCGAGACCCCACTAACA | AGGGGGGCTAAGCAGTTGGT |
Runx2, Runt-related transcription factor 2; ALP, alkaline phosphatase; OCN, osteocalcin; SIRT1, sirtuin 1; PGC-1α, peroxisome proliferator-activated receptor gamma coactivator-1α.