A total of 30 pregnant C57BL/6J (wild-type) mice (age, 14-16 weeks; weight, 30–40 g) were purchased from Nanjing Qinglongshan Experimental Animal Center. The day of birth was considered day 0. After birth, the pups were housed with their dam under a 12:12-h light-dark cycle at a temperature of 23±3°C and relative humidity of 50±5%, with food and water available ad libitum throughout the study. The male 7-day-old postnatal (P7) pups (weight, 10-15 g) were anesthetized with isoflurane (3% in a mixture of medical air and oxygen 70:30 ratio). A 5.0 silk surgical suture was used to ligate the right common carotid artery. The artery was cut between two ligation sites. After the surgery, the pups were recovered for 1 h and then placed in the hypoxic incubator containing 8% oxygen and 92% nitrogen at 37°C for 2 days, 5 days, 7 days or 8 weeks. Sham animals were selected as the control group, and underwent anesthesia and the common carotid artery was exposed without ligation and hypoxia. The normal brains from P7 mice without any treatment were used as the normal group. In total, six animals were used in each experimental group. All procedures were approved by the Animal Care and Use Committee of Nanjing University.

The male pups received a stereotaxic injection of BDNF-AS short hairpin (sh)RNA (5′- CCGGCCGGCATTGGAACTCCCAGTGTTCAAGACGCACTGGGAGTTCCAATGCCTTTTTTG-3′) or scrambled shRNA (5′-AATGCCAGTTCCGGTTTTTTGGCCGGCCTGGGAACTGGCATTTGTTCAAGACCCCAGCAC-3′) of 2 µl concentrated BDNF-AS shRNA viral stocks (3×10⁹ particles/µl) or scrambled shRNA viral stocks (3×10⁹ particles/µl) into the hippocampus after HI treatment. The injection was performed using a Hamilton syringe and conducted unilaterally at the following coordinates calculated from Bregma and the skull surface: Anterior, -2.4; lateral, +1.5 (right side); ventral, -2.0 (20). Then, 48 h after HI, measurement of the brain infarct size and immunostaining of Glial fibrillary acidic protein (GFAP), CD11b/c or neuronal nuclei (NeuN) were performed in the cornu ammonis 1 hippocampal region. Subsequently, 8 weeks after HI, the neurobehavioral function of the brain was evaluated by water maze or rotarod tests.

Animal experiments were approved by the Animal Care and Use Committee of Nanjing University, and were conducted according to the suggested method of euthanasia of fetuses by the University of California, Los Angeles (https://rsawa.research.ucla.edu/arc/euthanasia-fetuses/). The pregnant mice at ~18 days post-fertilization were euthanized by cervical dislocation. The use of anesthesia to euthanize the pregnant female is not recommended, as anesthesia is known to cause brain cell death (21,22). The fetuses were euthanized by decapitation. Sterile scissors were used to open the cranium of pup from back of the neck to the nose. The entire brain was removed with the forceps. Then, a small section of meninges surrounding the hippocampus was grasped with the sterile forceps and pulled gently away. The hippocampi were treated with 0.25% trypsin (Sigma-Aldrich; Merck KGaA) supplemented with 100 ng/ml DNase (Roche Diagnostics) at 37°C for 30 min and dissociated using repeated passage through a series of fire-polished constricted Pasteur pipettes. The digestion was terminated with DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 5% FBS (Gibco; Thermo Fisher Scientific, Inc.). The hippocampal neurons were distributed in 8-well poly-l-lysine-treated chamber slide and cultured in the neurobasal medium (DMEM; 4.5 g/liter glucose; 100 U/ml penicillin; 100 µg/ml streptomycin; 2 mM glutamine) at 5×10⁴ cell/well. Cells were incubated at 37°C with 5% CO₂ and 95% relative humidity. Half of the medium was replaced once a week. Hippocampal cultures were used after a culturing period of 10-14 days. For hypoxic induction, cells were cultured in a NAPCO 7001 incubator (Precision Scientific Company) with 1% oxygen, 6% CO₂ and balance nitrogen at 37°C for 24 and 48 h. For oxidative stress induction, cells were exposed to H₂O₂ (150 µM) to mimic oxidative stress for 24 and 48 h.

The male pups were anesthetized after neurological evaluation by intraperitoneal injection of ketamine (80 mg/kg) and xylazine (4 mg/kg) and euthanized by cervical dislocation. The death of mice was verified using the following criteria, including lack of pulse, breathing, corneal reflex, failure of a response to firm toe pinch, graying of mucus membranes and an inability to auscultate respiratory or heart sounds. The brain was quickly removed and placed in ice-cold sterile saline for 5 min. The infarct size of brain was detected with 2,3,5-triphenyltetrazolium chloride mono-hydrate (TTC; Sigma-Aldrich) staining (23). The slices of pup brains were cut into 2-mm thick sections and were immersed in 2% TTC solution for 5 min at 37°C. The slices were then fixed by 10% formaldehyde at 4°C overnight. The caudal and the rostral surfaces of each slice were imaged using a fluorescence microscope (magnification, ×400). The percentage of infarct size for each slice was traced and analyzed using the Image-Pro plus version 7.0 software (Media Cybernetics, Inc.).

In HI neonatal brain injury model, the male pups were anaesthetized with 3% isoflurane, decapitated and the striatum, hippocampi and cortex were excised and stored in liquid nitrogen for RNA extraction. Total RNAs were extracted from the primary hippocampal neurons or infarcted brain tissues using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Ultraviolet analysis and formaldehyde gel electrophoresis were performed to detect RNA quality. RT was performed using the miScript II RT kit (Invitrogen; Thermo Fisher Scientific, Inc.).

The temperature protocols for RT were as follows: 37°C for 60 min, 95°C for 5 min and maintenance at 4°C. Following this step, qPCR assays were performed using the Brilliant SYBR Green II RT-qPCR kit (Agilent Technologies, Inc.) according to the manufacturer's instructions. qPCR assays were performed in a final volume of 25 µl and each PCR reaction mixture consisted of the specific primers and SYBR Green Supermix. The thermocycling protocols were as follows: Initial denaturation at 95°C for 2 min, followed by 40 cycles at 95°C for 10 sec, 55°C for 30 sec and 72°C for 30 sec, followed by the final extension at 72°C for 60 sec. All qPCR assays were performed in triplicate and normalized to GAPDH. All reactions were carried out on the Applied Biosystems 7500 RT PCR system (Thermo Fisher Scientific, Inc.). Relative gene expression was analyzed using the 2^−ΔΔCq method (24). The primers were designed as follows: BDNF-AS forward, 5′-CCGTGAGAAGATCTCATTGGG-3′ and reverse, 5′-GGGTCACAAGTCACGTAGCA-3′; and GAPDH forward, 5′-GTCAAGGCTGAGAACGGGAA-3′ and reverse, 5′-AAATGAGCCCCAGCCTTCTC-3′.

CCK-8 assay kit was performed to detect cell viability (Beyotime Institute of Biotechnology) according to the manufacturer's instructions. Primary hippocampal cells were seeded onto 96-well plates at the density of 5×10⁴ cells/well. Then, ~10 µl CCK-8 solution was added to each well of the plate after hypoxic stress induction (1% oxygen, 6% CO₂ and balance nitrogen) with or without BDNF-AS expression intervention and incubated for 3 h at 37°C. Cell viability was detected by a microplate reader (Molecular Devices, LLC) at 450 nm.

Calcein-AM/PI double staining was performed to detect the apoptosis of hippocampal cells. Hippocampal cells were fixed in 4% paraformaldehyde (Beyotime Institute of Biotechnology) for 10 min at 37°C, stained using Calcein-AM (10 µmol/l; Biosharp Life Sciences) for 10 min at 37°C and then stained with PI (10 µmol/l; BD Pharmingen; BD Biosciences) for 10 min at 37°C. The 490 nm excitation filter was used to observe the alive cells. The 545 nm excitation filter was used to observe the dead or dying cells. Calcein-AM/PI double staining was observed in ten selected visual fields under an IX71 inverted light microscope (Olympus Corporation) at magnification, ×500.

Primary hippocampal cells were fixed in 4% paraformaldehyde (Beyotime Institute of Biotechnology) for 15 min at room temperature. After permeabilizing with Triton-X 100, cells were stained with Hoechst 33342 solution (10 µg/ml; Biosharp Life Sciences) for an additional 10 min at 37°C. Hoechst staining was observed in ten selected visual fields under an IX71 inverted fluorescent microscope (Olympus Corporation) at magnification, ×500.

The male pups were anesthe-tized after neurological evaluation by intraperitoneal injection of ketamine (80 mg/kg) and xylazine (4 mg/kg) and euthanized by cervical dislocation. The brains were quickly removed and the slices of brain were cut into 2-mm thick sections. The brain slices were fixed in 4% paraformaldehyde (Beyotime Institute of Biotechnology) for 10 min at room temperature. Then, brain slices were blocked with 5% BSA (Beyotime Institute of Biotechnology) for 1 h at room temperature, incubated antibodies against CD11b/c (Abcam; 1:100; cat. no. ab226482), GFAP (Abcam; 1:100; cat. no. ab7260) and NeuN (Abcam; 1:100; cat. no. ab128886) overnight at 4°C, followed by the Alexa Fluor 594-conjugated secondary antibody (Invitrogen; Thermo Fisher Scientific, Inc.; 1:200; cat. no. R37117) for 1 h at room temperature. Fluorescent mounting medium was used to mount the slices. All slices were observed using a fluorescent microscope. CD11b/c and GFAP staining was observed in ten selected visual fields under an IX71 inverted fluorescent microscope (Olympus Corporation) at magnification, ×200. NeuN staining was observed in ten selected visual fields at magnification, ×500.

Primary hippocampal cells were lysed in RIPA lysis buffer (Beyotime Institute of Biotechnology) and the concentration of protein was determined using a bicinchoninic acid assay (Beyotime Institute of Biotechnology). A total of 30 µg total proteins were separated by 10-12% SDS-PAGE and transferred to PVDF membranes (Beyotime Institute of Biotechnology). The membranes were blocked with 5% BSA (Sigma-Aldrich; Merck KGaA) for 1 h at room temperature and then incubated with the primary antibody overnight at 4°C using antibodies against BDNF (1:1,000; cat. no. ab108319; Abcam), tropomyosin receptor kinase B (TrkB; 1:1,000; cat. no. ab33655; Abcam), phosphorylated (p)-TrkB (phospho S479; 1:2,000; cat. no. ab228507; Abcam), Akt (1:2,000; cat. no. ab18785; Abcam), p-Akt (phosphor T308; 1:2,000; cat. no. ab38449; Abcam) or GAPDH (1:2,000; cat. no. ab181602; Abcam). Each PVDF membrane was washed three times in Tris buffered saline-0.1% Tween-20 for 10 min per wash and then incubated with the horseradish peroxidase-conjugated secondary antibody (1:1,000; cat. no. A0208; Beyotime Institute of Biotechnology) at room temperature for 1 h. The membranes were washed three times in Tris buffered saline-0.1% Tween-20 for 10 min per wash and then visualized using enhanced chemiluminescence methods (Nanjing KeyGen Biotech Co., Ltd.). Quantity One software version 4.6.5 (Bio-Rad Laboratories, Inc.) was used to analyze protein bands, which were expressed as a relative level against the internal reference.

The lentiviral vector expressing BDNF-AS cDNA (cat. no. LQP0010926) was purchased from Guangzhou RiboBio Co., Ltd. The controlled lentiviral vector expressing a non-specific cDNA (cat. no. LQP0010926-C) was also purchased from Guangzhou RiboBio Co., Ltd. The primary hippocampal cells were transduced with the lentiviral vector containing either BDNF-AS (1×10¹³ U/ml) or non-specific cDNA (1×10¹³ U/ml), in the presence of 8 µg/ml polybrene (EMD Millipore) for 48 h. RT-qPCR assays were conducted to verify the transduction efficiency.

Tissue lipid peroxide level was determined by thiobarbituric acid reactive substances (TBARS) using a reagent kit (BioAssay Systems; cat. no. DTBA-100) according to the manufacturer's instruction. The activities of superoxide dismutase (SOD; cat. no. A001-3-2) and glutathione peroxidase (GPx; cat. no. A005-1-2) were measured using kits obtained from the Institute of Biological Engineering of Nanjing Jianchen, according to the manufacturer's protocol. The content of protein in the homogenate was determined using a bicinchoninic acid assay (Beyotime Institute of Biotechnology).

Rotarod test and water maze test was performed to detect the neurobehavioral function (25). To measure motor coordination, the mice were assessed on the rotarod apparatus. The rotarod consisted of the horizontal cylinder divided into four lanes. In total, three consecutive block trials were administered, in which the rotarod rotated at a constant speed of 5 RPM (rotations per min) for two trials for 300 sec, followed by two trials of acceleration by 3 RPM every 5 sec and finally two trials of acceleration by 5 RPM every 3 sec. The time that each mouse was able to remain on the rotating rod before falling was measured. All of the tests were repeated three times in a blinded fashion.

The Morris water maze test was performed for the assessment of spatial learning and memory. A circular pool (1.3 m in diameter; 50 cm in depth) was filled with room-temperature water. In addition, 1 cm below the surface of the water, a trans-parent platform was placed in the southeastern quadrant. The water maze tests consisted of cued learning, spatial learning and probe trial. In the cued learning trial, the mice were released from different starting points and allowed to swim for 60 sec to search for the platform. The escape latency time was defined by the time spent to find the hidden platform by the mice. In the spatial learning trial, the mice were allowed to find and climb onto the escape platform, and performed ten trials per day in five blocks of two consecutive trials (120 sec trial; 120 sec inter-trial interval during which time the mouse remained on the escape platform). The cumulative distance from the platform and escape latency to find the platform in each test was recorded. In the probe trial, the mice were released from a new start position in the pool without the platform. The amount of time spent in the southeastern quadrant was recorded. All behavioral tests were recorded by video tracking software (TopScan; version 2.0; CleverSys, Inc.).

Data are presented as the mean ± SEM, and analyzed using SPSS statistics software (version 21.0; SPSS, Inc.). Each experiment was repeated three times. Comparisons between two groups were determined using Student's t-test (unpaired; 2-tailed). Comparisons between multiple groups were determined using one-way or two-way ANOVA followed by Tukey's test. As for two-way ANOVA, the parameters BDNF-AS expression and training location, were used for the interaction analysis of neurobehavioral function. P<0.05 was considered to indicate a statistically significant difference.

The normal brains were collected from P7 mice without any treatment. The P7 mice were anaesthetized with 3% isoflurane, decapitated and the striatum, hippocampi and cortex were excised and stored in liquid nitrogen for RNA extraction. Absolute quantification of BDNF-AS expression demonstrated that BDNF-AS expression was higher in hippocampi compared with the cortex or striatum in the normal brain (Fig. 1A). P7 mice received ligation of the unilateral common carotid artery, and were exposed to 8% O₂ for ~30 min. Then, 5 and 7 days after HI stress, the striatum, hippocampi and cortex were excised. RT-qPCR assays demonstrated that BDNF-AS and BDNF expression levels were compared in the striatum, hippocampi and cortex between HI brains and normal brains. The results indicated that BDNF-AS expression was significantly increased in HI brains compared with Sham group (Control; Fig. 1B), while BDNF expression was reduced in these brains (Fig. 1C). The highest significant difference was detected in the hippocampal cells of HI brains compared with the control hippocampal neurons.

Primarily isolated hippocampal neurons were also exposed to hypoxia stress or oxidative stress. BDNF-AS expression was significantly upregulated after hypoxia stress or oxidative stress (Fig. 1D and E), while BDNF demonstrated an opposite expression pattern (Fig. 1F and G). Collectively, these results suggested that HI stress led to increased BDNF-AS expression in vivo and in vitro.

To determine the role of BDNF-AS in hippocampal cells in vitro, BDNF-AS shRNA transfection was used to silence BDNF-AS expression in the primary hippocampal cells (Fig. 2A). CCK-8 results suggested that hypoxia-induced decrease in cell viability was partially rescued by BDNF-AS silencing (Fig. 2B).

Hoechst 33342 staining and Calcein-AM/PI staining demonstrated that compared with hypoxia group, BDNF-AS silencing significantly decreased the number of apoptotic nuclei (condensed or fragmented) and PI-positive cells (dying or dead cells), thus suggesting that hypoxia-induced cell apoptosis was reduced by BDNF-AS silencing (Fig. 2C and D). Therefore, these results indicated that BDNF-AS silencing protected primary hippocampal cells against HI stress in vitro.

The present study further investigated whether BDNF-AS silencing protected against HI-induced brain injury in vivo. BDNF-AS shRNA or scrambled shRNA (used as the negative control) were administered before HI treatment. Compared with the scrambled shRNA group, BDNF-AS shRNA injection significantly decreased BDNF-AS expression (Fig. 3A). Furthermore, BDNF-AS silencing significantly attenuated HI-induced brain injury as demonstrated by a decreased brain infarct size (Fig. 3B).

The degree of astrocytosis was examined by GFAP staining, which is an astrocytic marker, and the degree of microgliosis by CD11b/c staining, which is a microglial marker (14). BDNF-AS silencing led to decreased GFAP and CD11b/c staining signaling in the hippocampus (Fig. 3C). NeuN staining was also performed to detect the neurons in the hippocampus. It was found that BDNF-AS silencing led to increased NeuN staining signaling in the hippocampus compared with control group (Fig. 3D). The neonatal brain is usually vulnerable to oxidative stress (3). The results indicated that BDNF-AS silencing led to decreased biological activities of SOD and GPx, and reduced level of TBARS in the damaged hemispheres after HI injury (Table I).

Subsequently, whether BDNF-AS silencing was able to ameliorate brain neurological function in vivo was investigated. A total of 8 weeks after HIBD, the water maze experimental results demonstrated that BDNF-AS silencing did not affect the swimming distance to reach the platform in the cued learning task (Fig. 4A). However, BDNF-AS silencing improved the spatial learning ability as indicated by shorter swimming distance to reach the platform (Fig. 4B). A probe experiment was then conducted to determine the effects of BDNF-AS silencing on spatial memory. The results suggested that the animal injected with BDNF-AS shRNA did not show a preference for the target quadrant (Fig. 4C). Moreover, BDNF-AS silencing improved the motor function during the constant and slow acceleration trials, but did not improved the motor function during the fast acceleration trials in the rotarod task (Fig. 4D).

As BDNF-AS is the antisense RNA of BDNF (16), the present study determined whether intervention of BDNF-AS expression affected the expression of BNDF. RT-qPCR results suggested that BDNF-AS overexpression significantly decreased the expression of BDNF mRNA, suggesting that BDNF-AS affected BDNF expression at the transcriptional level (Fig. 5A). It was also determined whether the intervention of BDNF-AS expression affected the activation of BDNF-mediated signaling. BDNF-AS overexpression led to decreased expression levels of BDNF, p-Akt and p-TrkB (Fig. 5B), indicating that BDNF-AS affected hippocampal cell function via BDNF-mediated signaling.