The levels of TSPYL5 expressed in CRC tumors and normal tissues were identified using the online Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.cancer-pku.cn/index.html), which is an interactive website that includes information for 9,736 tumor samples and 8,587 normal tissue samples obtained from TCGA and GTEx projects. The GEPIA database was also used to generate survival curves based on the levels of TSPYL5 gene expression in CRC tissues, as determined by the log-rank test.

Thirty pairs of CRC and para-carcinoma tissue samples were collected from CRC patients who underwent surgical resection of their tumors at the Renmin Hospital of Wuhan University from February 2017 to December 2018 (age range, 45–86 years; Females, 41%). None of the patients had received any radiotherapy or chemotherapy prior to surgery, and each patient provided a written informed consent. All the tissue samples were immediately frozen in liquid nitrogen and stored at −80°C until use. The protocol for this study was approved by the Ethics Committee of The Renmin Hospital of Wuhan University (Wuhan, Hubei, China). All procedures involving human subjects were performed in accordance with the 1964 Helsinki declaration.

Total RNA was isolated from frozen tissues using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and reversed transcribed into cDNA with an iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc.). Quantitative real-time PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories, Inc.) on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems). The PCR reaction conditions consisted of 95°C for 3 min, followed by 40 cycles of 95°C for 30 sec and 60°C for 30 sec. The primer sequences used were as follows: TSPYL5 forward, GGTTGTTTTTTGTGTAGTTGTAGT and reverse, CATCACAAACATACAACTATACCA. TSPYL5 expression was normalized to that of GAPDH, and analyzed using the 2^−ΔΔCq method (21).

Human CRC cell lines HCT116 and HT29 were obtained from the American Type Culture Collection (ATCC) and cultured in Dulbecco's modified Eagle's medium (DMEM; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.). Both cell lines were maintained in a humidified atmosphere containing 5% CO₂ at 37°C.

For TSPYL5 overexpression, the cDNA for TSPYL5 without its 3′-UTR was inserted into a pcDNA3.1 vector using Lipofectamine 2000 transfection reagent (both from Invitrogen; Thermo Fisher Scientific, Inc.) to generate the recombinant vector, pcDNA3.1-TSPYL5. Subsequently, HCT116 and HT29 cells were seeded into 6-well plates and transfected with pcDNA3.1-TSPYL5 or empty pcDNA3.1, to produce TSPYL5 and negative control (NC) groups, respectively. Non-transfected cells served as a blank group.

A Cell Light™ EDU Apollo^®488 In Vitro Imaging Kit (Guangzhou RiboBio) was used to detect the proliferation rates of the transfected CRC cells, according to instructions provided by the manufacturer. Briefly, HCT116 and HT29 cells were fixed with 4% paraformaldehyde for 15 min, washed three times with PBS, and then stained with 200 µl of 1X Apollo solution for 30 min. After another wash with PBS, the cells with EdU-positive signals were detected by flow cytometry (BD Biosciences).

Cell apoptosis was detected with an Annexin V-fluorescein Isothiocyanate Propidium Iodide (FITC/PI) apoptosis detection kit (cat. no. 70-AP101-100; Hangzhou MultiSciences Biotech Co., Ltd.). Briefly, HCT116 and HT29 cells were harvested, washed twice in PBS, and then stained with Annexin V-FIFC/PI for 15 min; after which, they were analyzed by flow cytometry (BD Biosciences). The total apoptotic rate, including early apoptosis and late apoptosis, was calculated and averaged for three experiments.

HCT116 and HT29 cells in their logarithmic growth phase were plated into 6-well plates and incubated for 48 h. The cells were then washed twice with PBS, incubated in the dark for 10 min with Hoechst 33342 nucleic acid stain (Sigma-Aldrich; Merck KGaA), and subsequently examined for their nuclear morphology under a fluorescence microscope (Olympus Corp.).

Cell migration and invasion abilities were examined using Transwell assays. Briefly, ~2×10⁴ HCT116 or HT29 cells suspended in 1 ml of serum-free medium were added into the upper chamber (without Matrigel for migration or with Matrigel for invasion) of a Transwell plate (Costar, cat. no. 3422; Corning Life Sciences). The lower chamber was filled with 500 µl of culture medium containing 10% FBS. After a 48-h incubation, the migrated cells in the lower chamber were fixed with formaldehyde for 5 min, and then stained with 0.5% crystal violet solution (Sigma-Aldrich; Merck KGaA). The stained cells were observed under a phase-contrast microscope (Olympus Corp.) at a magnification of ×200, and various visual fields were randomly selected for cell counting.

ERS was examined by transmission electron microscopy as previously described (22). In brief, transfected HCT116 and HT29 cells were harvested, fixed in glutaraldehyde, and then dehydrated in serial dilutions of acetone (30, 80 and 90%). Next, ultrathin sections were produced by embedding cells in Ultracut (Leica, Germany) and cutting into 60-nm sections. After staining with uranyl acetate, the ultrathin sections were examined with a JEM-1230 transmission electron microscope (JEOL Ltd.).

Total cellular protein was obtained by lysing CRC cells in RIPA buffer (Pierce; Thermo Fisher Scientific, Inc.) that contained a protease inhibitor cocktail and phosphatase inhibitors (Sigma-Aldrich; Merck KGaA). Protein concentrations were detected using a BCA Protein Assay Kit (Thermo Fisher Scientific, Inc.). Samples containing ~30 µg of protein were separated by 10% SDS-PAGE, and the protein bands were transferred onto PVDF membranes (Invitrogen; Thermo Fisher Scientific, Inc.). The membranes were then blocked with 5% skim milk and subsequently incubated overnight with primary antibodies against TSPYL5 (cat. no. ab203657, dilution: 1:800; Abcam), caspase-1 (cat. no. ab62698, dilution: 1:800; Abcam), caspase-3 (cat. no. ab49822, dilution: 1:500; Abcam), Bax (cat. no. M00183-2, dilution: 1:1,000, Boster), ATF4 (cat. no. A00371, dilution: 1:500; Boster), CHOP (cat. no. A00311, dilution: 1:500; Boster), and GAPDH (cat. no. ab9485, dilution: 1:800; Abcam) at 4°C. On the following day, the membranes were incubated with an HRP conjugated secondary antibody (cat. no. ab97080, dilution: 1:30,000; Abcam). The immunostained proteins were detected using an enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc.). Quantification of western blot bands was performed using Image-Pro Plus (Version 6; Media Cybernetics, Inc.).

All statistical analyses were performed using IBM SPSS Statistics for Windows, version 21.0 (IBM Corp.). Quantitative results are expressed as the mean ± SD of data obtained from at least three experiments. Differences between two groups were analyzed using Student's t-test and differences among groups were assessed by one-way analysis of variance (ANOVA). A P-value <0.05 was considered to indicate a statistically significant difference.

To determine differences in TSPYL5 expression in CRC tumor tissues vs. normal tissues, the TSPYL5 mRNA levels in COAD (colon adenocarcinoma) and READ (rectum adenocarcinoma) were analyzed using the GEPIA database. As shown in Fig. 1A, TSPYL5 expression was significantly lower in the COAD and READ tissues when compared to levels in the respective adjacent normal tissues (P<0.05). To verify the expression results obtained from the GEPIA database, we determined the levels of TSPYL5 expression in 30 pairs of CRC tumor and para-carcinoma tissues by quantitative real-time PCR. As shown in Fig. 1B, TSPYL5 expression was significantly downregulated in the tumor tissues when compared with that noted in the para-carcinoma tissues (P<0.05). Western blot analyses of 8 pairs of representative tissues showed a result similar to that obtained by quantitative real-time PCR (Fig. 1C and D, P<0.01). These results suggest the role of TSPYL5 as a possible tumor suppressor in CRC.

To further confirm that TSPYL5 acts as a tumor suppressor in CRC in vitro, two CRC cell lines, HCT116 and HT29, were transfected with pcDNA3.1-TSPYL5, and then used in a series of functional experiments. Firstly, RT-qPCR and western blot analysis were performed to validated the overexpression of TSPYL5 in HCT116 and HT29 cell lines. Results showed that expression of TSPYL5 was enhanced after cell transfection (Fig. 2A and B).

As shown in Fig. 3A, flow cytometry of EdU-positive cells revealed that TSPYL5 overexpression decreased the percentage of EDU-positive HCT116 cells from 46.7 to 31.5% and the percentage of EDU-positive HT29 cells from 33.5 to 27.6%. In addition, flow cytometry with Annexin V/PI double staining was performed to evaluate cell apoptosis. As illustrated in Fig. 3B, the apoptotic rate of the TSPYL5-overexpressing HCT116 cells was significantly increased (27.69±0.52%) when compared to the apoptotic rates of cells in the blank (6.81±0.30%) and NC (7.05±0.49%) groups (P<0.001). Similarly, overexpression of TSPYL5 promoted the apoptosis of HT29 cells (Fig. 3B, P<0.001). Next, HCT116 and HT29 cells stained with a DNA-specific dye (Hoechst 33342) were examined for morphologic changes. The results showed that TSPYL5-overexpressing HCT116 and HT29 cells exhibited bright fluorescence and characteristic features of apoptosis, including chromatin condensation when compared with cells in the NC and blank groups (Fig. 3C).

Overexpression of TSPYL5 suppresses the migration and invasion abilities of CRC cells. Transwell assays were performed to investigate the effect of TSPYL5 on the migration and invasion abilities of CRC cells. As shown in Fig. 4A, overexpression of TSPYL5 significantly reduced the numbers of migrated HCT116 cells when compared to the numbers of migrated control cells (TSPYL5-overexpressing HCT116 cells vs. NC cells: 77.00±12.12 vs. 128.00±4.36; P<0.05), and similar results were obtained for the TSPYL5-overexpressing HT29 cells (TSPYL5-overexpressing HT29 cells vs. NC cells: 70.33±12.66 vs. 126.33±10.26, P<0.05). Moreover, after transfection with pcDNA3.1-TSPYL5, the numbers of invading HCT166 and HT29 (Fig. 4B) cells were also decreased when compared to the numbers of invading NC cells (TSPYL5-overexpressing HCT116 cells vs. NC cells: 49.33±3.06 vs. 88.00±12.12, P<0.05 and TSPYL5-overexpressing HT29 cells vs. NC cells: 32.00±7.94 vs. 67.33±15.57, P<0.05).

As the effect of TSPYL5 on ERS in CRC cells remains unknown, we next investigated whether TSPYL5 overexpression could induce ERS. First, ERS was detected using a transmission electron microscope. As shown in Fig. 5, larger amounts of swollen ER were observed in the cytoplasm of HCT116 and HT29 cells that overexpressed TSPYL5, and that change was not observed in the control or NC cells. Next, western blot analyses were performed to examine the direct effects of TSPYL5 on ERS and apoptosis. As shown in Fig. 6, the levels of caspase-1, caspase-3, bcl-2-like protein 4 (Bax), activating transcription factor 4 (ATF4) and CCAAT-enhancer-binding protein homologous protein (CHOP) proteins were upregulated after TSPYL5 overexpression. These observed changes indicated that TSPYL5 overexpression-induced apoptosis may be correlated with activated ERS in CRC cells.